The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	372943	416539	4888768	lysis,holin,integrase,coat,terminase,portal,protease	Enterobacteria_phage(44.44%)	64	376790:376835	416055:416100
WP_001043660.1|372943_373996_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|374278_375382_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|375393_376644_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
376790:376835	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|376849_378013_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|378242_378878_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|378978_379158_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|379254_379941_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|379951_380215_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|380216_380702_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|380698_381325_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|381321_381486_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|381496_381793_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|382123_382741_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|382737_382881_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|382870_383059_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|383039_383198_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|383283_383595_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|383742_383946_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|383945_384182_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|384218_384413_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|384627_385206_+	superinfection exclusion B family protein	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|385226_385529_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|385882_386533_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|386613_386799_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|386905_387184_+	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|387218_387365_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|387357_388173_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|388169_389546_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|389619_390057_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|390053_390227_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|390193_390370_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|390372_390705_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|390697_390874_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|390866_391478_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|391474_391699_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|391695_391899_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|391879_392059_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|392055_392679_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|393117_393321_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|393298_393796_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|393884_394322_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|394534_395221_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|395523_395766_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|395767_395947_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|395970_396459_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|396436_397936_+|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|397935_400113_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|400126_401038_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|401037_402330_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|402368_402578_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|402561_403062_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|403021_404440_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|404443_405145_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|405144_405600_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|405602_406295_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|406304_407600_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|407599_409597_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|409687_410173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|410575_410863_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
WP_000129930.1|410965_412969_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|413027_414485_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|414474_415407_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|415403_415766_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|416263_416539_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
416055:416100	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	1023163	1031186	4888768	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1023163_1024282_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1024278_1026225_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1026354_1026576_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1026899_1027220_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1027250_1029527_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1029717_1030176_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1030449_1030647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1030808_1031186_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	1081795	1180953	4888768	tail,lysis,holin,transposase,terminase,portal,protease,tRNA	Salmonella_phage(43.1%)	104	NA	NA
WP_001154025.1|1081795_1082599_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1082591_1083914_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1083894_1084599_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1084598_1089065_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|1089409_1091230_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1091489_1092038_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1092065_1092713_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1092774_1093965_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1094149_1095241_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1095847_1097248_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1097448_1097910_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1098226_1099441_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1099685_1101119_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1101199_1102402_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1102596_1103889_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1103933_1104182_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1104222_1104462_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1104467_1105337_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1105333_1106014_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1106010_1106796_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1106801_1107098_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1107188_1107389_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1107676_1107883_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1107909_1108344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1108345_1108771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1108813_1109209_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1109313_1109550_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1109515_1109890_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|1109981_1110887_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|1110883_1111585_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1111629_1112031_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1112027_1112561_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224238.1|1112562_1112823_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	92.4	9.0e-36
WP_000019440.1|1112863_1113844_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000208143.1|1114029_1114431_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1114538_1115183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1115413_1115647_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1115763_1116012_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1116046_1116649_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1116857_1117469_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1117465_1117612_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1117601_1118399_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1118565_1118784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1119064_1119253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1119455_1119758_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000301013.1|1119735_1120275_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|1120582_1121077_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|1121287_1121821_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1121777_1123916_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1123912_1124119_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1124115_1125663_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|1125586_1127665_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1127755_1128079_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1128071_1128371_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1128351_1128918_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1128914_1129316_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1129327_1130077_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1130122_1130521_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1130517_1130847_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1130926_1133914_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1133910_1134243_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1134341_1134866_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1134955_1135489_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1135578_1136274_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1136283_1137021_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1136918_1137623_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000033414.1|1137694_1141045_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.3	0.0e+00
WP_000178849.1|1141083_1141326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1141379_1143755_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1144255_1144576_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1144565_1145147_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1145343_1146066_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000343758.1|1146716_1147937_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1147933_1148431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1148865_1151478_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1151685_1152696_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1152861_1153404_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1153400_1154510_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1154608_1156717_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1156729_1158637_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1158651_1159905_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1159909_1161550_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1161546_1162110_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1162365_1162533_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1162632_1163151_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1163219_1164980_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1165165_1165618_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1165689_1166742_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1167098_1167608_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1167824_1168430_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1168416_1170570_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1170588_1171035_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1171158_1173213_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1173248_1173707_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1173801_1174464_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1174637_1175051_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1175095_1175413_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1175470_1176682_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1176896_1177445_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1177470_1178250_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1178298_1178580_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1178576_1178906_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1178992_1179652_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1180272_1180953_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	1515699	1556062	4888768	integrase,transposase	Escherichia_phage(33.33%)	39	1523809:1523824	1558621:1558636
WP_001067856.1|1515699_1516404_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000904906.1|1517639_1518254_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_085959879.1|1518318_1519447_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_001082319.1|1519554_1520358_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1520357_1521194_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000689410.1|1521321_1521792_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	2.8e-19
WP_001243650.1|1522206_1522452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001235772.1|1522471_1523689_+	DNA topoisomerase III	NA	NA	NA	NA	NA
1523809:1523824	attL	CAGCTCGCCGTCCACC	NA	NA	NA	NA
WP_001067856.1|1524336_1525041_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_001235713.1|1525219_1525777_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|1525959_1526820_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000983249.1|1527526_1528312_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|1528846_1529347_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|1529474_1530314_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|1530307_1530655_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067856.1|1530745_1531450_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_001072144.1|1531577_1532162_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	58.7	4.2e-49
WP_000179435.1|1532240_1533230_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000253881.1|1533250_1535794_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_001255889.1|1536739_1537705_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_000034358.1|1538408_1538663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273954.1|1538741_1539059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047333922.1|1539160_1539430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000393195.1|1539489_1539681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000158825.1|1539795_1540233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165799451.1|1540287_1540446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161800395.1|1540507_1540615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000874729.1|1540738_1543324_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000162862.1|1543588_1544455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012512938.1|1544663_1548101_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001090457.1|1548097_1548454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000821094.1|1548504_1548765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799172.1|1548936_1549125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000415771.1|1549127_1549670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001245879.1|1549756_1552492_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_024132227.1|1552668_1552887_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012512940.1|1553106_1554348_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000126620.1|1554482_1554851_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000868888.1|1554847_1556062_-|integrase	site-specific integrase	integrase	A0A1B0WMK0	Flavobacterium_phage	30.7	3.0e-09
1558621:1558636	attR	GGTGGACGGCGAGCTG	NA	NA	NA	NA
>prophage 5
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	2009486	2016943	4888768	tail,integrase,transposase	Salmonella_phage(42.86%)	10	2006162:2006184	2017074:2017096
2006162:2006184	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_001682430.1|2009486_2009726_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	93.3	1.1e-16
WP_000457876.1|2010306_2010432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019440.1|2010763_2011744_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_010989029.1|2012200_2012401_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_015675561.1|2012497_2012998_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	78.0	8.8e-64
WP_000789529.1|2014103_2014271_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2014527_2015061_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2015114_2015345_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_023602538.1|2015534_2016029_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	67.6	2.0e-20
WP_176731523.1|2016100_2016943_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.3e-71
2017074:2017096	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
>prophage 6
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	2121948	2129200	4888768		Morganella_phage(33.33%)	8	NA	NA
WP_001157304.1|2121948_2123379_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2123452_2124148_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2124227_2124539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2125189_2126386_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2126643_2126832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2126842_2127055_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2127509_2128778_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2128780_2129200_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	2218544	2229050	4888768		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2218544_2219858_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2219884_2220964_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2220968_2221742_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2221738_2222731_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2222736_2223288_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2223288_2224167_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2224214_2225114_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2225113_2226199_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2226575_2227469_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2227646_2229050_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 8
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	2297326	2306497	4888768	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2297326_2299360_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2299600_2300059_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2300230_2300761_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2300817_2301285_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2301331_2302051_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2302047_2303733_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2303955_2304687_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2304746_2304854_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2304834_2305566_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2305549_2306497_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	2325904	2392291	4888768	tail,lysis,holin	Salmonella_phage(25.0%)	59	NA	NA
WP_000989295.1|2325904_2326600_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2326753_2327638_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2327814_2328534_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2328530_2328776_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|2328980_2330222_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|2330215_2331451_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2331525_2332536_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2332551_2334072_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2334205_2335204_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2335702_2336725_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|2336874_2338017_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2338031_2338700_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2339029_2339887_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2339875_2340265_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|2340269_2341637_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|2341853_2342741_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2342773_2344096_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|2344139_2346131_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2346476_2347946_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2348135_2348999_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2349119_2350169_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|2350247_2351105_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|2351169_2352858_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2352874_2353813_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2353812_2354943_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2355310_2356492_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|2356555_2357221_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2357222_2357345_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|2357732_2357987_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2358310_2358883_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|2359095_2360082_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2360111_2360831_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2361244_2361817_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|2362142_2363699_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|2363805_2365611_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|2365620_2366715_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|2366714_2367740_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|2367741_2369331_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|2369334_2369679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2370069_2371260_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|2371287_2371983_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|2372134_2373895_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|2374019_2374304_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|2374412_2375033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2375060_2376068_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2376247_2376475_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2376506_2378267_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2378547_2379051_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2379078_2379369_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2381592_2382036_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215678.1|2382413_2382941_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	5.3e-11
WP_000554739.1|2382943_2384185_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2384777_2385107_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2385403_2386735_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2386763_2387132_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2387146_2388136_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2388464_2390831_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2390999_2391203_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2391499_2392291_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	3364969	3419862	4888768	tail,head,holin,integrase,capsid,terminase,portal,tRNA,plate	Cronobacter_phage(61.9%)	61	3362642:3362662	3410640:3410660
3362642:3362662	attL	CCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_001264394.1|3364969_3365983_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3366210_3366426_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3366661_3368407_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3368556_3370404_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3370527_3371034_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001128281.1|3371456_3371618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000977534.1|3372206_3373910_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_000200796.1|3373909_3374455_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	1.4e-59
WP_000267951.1|3374426_3375152_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_001215677.1|3375141_3375672_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000083767.1|3375674_3377687_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001001827.1|3377696_3378284_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
WP_000136922.1|3378276_3379461_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.1	2.0e-178
WP_001002797.1|3379457_3379787_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811089.1|3379783_3381754_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	67.4	1.6e-254
WP_000411340.1|3381941_3382199_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376374.1|3382345_3382678_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000175560.1|3382677_3383019_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3383015_3383309_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3383318_3383774_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220205.1|3383770_3384898_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000560081.1|3384894_3385602_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000084220.1|3385598_3386105_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_023181179.1|3386101_3386554_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	2.3e-63
WP_000398492.1|3386650_3386845_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_001218534.1|3386848_3387553_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000550496.1|3387556_3388579_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018798.1|3388640_3389441_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_001151944.1|3389601_3391377_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	2.2e-290
WP_000038207.1|3391373_3392435_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	5.1e-162
WP_001552031.1|3392431_3392755_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3392728_3392935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170880.1|3393054_3395076_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.8	9.4e-298
WP_000279405.1|3395072_3395933_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	1.3e-131
WP_000153510.1|3395922_3396252_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	44.0	2.5e-11
WP_000422609.1|3396248_3396845_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_071601531.1|3396835_3397012_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022787.1|3397157_3397559_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.2	3.2e-48
WP_000996838.1|3397558_3397984_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	7.6e-24
WP_000643375.1|3397973_3398201_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460877.1|3398210_3398714_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000102874.1|3399101_3399683_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	39.8	2.5e-33
WP_000568369.1|3399699_3400266_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	35.0	3.0e-20
WP_001145216.1|3400269_3401307_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	6.6e-122
WP_000213760.1|3401517_3402285_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000983441.1|3402516_3403164_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478472.1|3403160_3404726_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000094651.1|3405113_3406634_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_001536702.1|3407063_3408443_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	3.8e-32
WP_000121536.1|3408612_3410631_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000019983.1|3410711_3411848_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
3410640:3410660	attR	CCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_000202966.1|3411933_3412431_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000951045.1|3412582_3413275_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000617690.1|3413363_3414362_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098833.1|3414634_3415603_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000235361.1|3415857_3417102_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_000422143.1|3417551_3418214_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917516.1|3418217_3418601_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877297.1|3418745_3419114_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3419155_3419461_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785626.1|3419463_3419862_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 11
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	4413388	4460909	4888768	tail,holin,tRNA,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_000587739.1|4413388_4414030_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|4414608_4415025_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|4415405_4415861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|4415857_4416472_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|4416478_4418137_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|4418139_4418772_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|4418764_4419880_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4419870_4420230_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|4420393_4421941_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|4421940_4422870_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|4422866_4423229_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4423556_4424279_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4424288_4425332_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4425319_4425529_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|4425528_4426482_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4426481_4428836_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4428932_4429061_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4429020_4429338_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|4429389_4429914_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|4429913_4431341_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4431330_4431528_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4431524_4431980_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4432139_4432454_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4432466_4433072_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4433074_4433362_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4433937_4434285_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|4434417_4435767_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790037.1|4436111_4437761_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4438204_4438447_+	outer membrane protein	NA	NA	NA	NA	NA
WP_022742863.1|4438480_4439149_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977979.1|4439145_4439883_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4439882_4441979_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4442121_4442532_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4442697_4443588_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4443602_4445147_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4445278_4446469_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4446830_4447940_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973681.1|4448028_4449387_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4449550_4450468_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4450648_4451146_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4451159_4452032_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4452130_4454551_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4454721_4455090_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4455198_4455807_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|4455985_4457311_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4457307_4457421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4457442_4457652_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|4457750_4458266_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039342.1|4458512_4459823_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182224.1|4459910_4460909_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 12
NC_011083	Salmonella enterica subsp. enterica serovar Heidelberg str. SL476, complete sequence	4888768	4600288	4662656	4888768	integrase,protease,transposase,tRNA	Vibrio_phage(15.38%)	58	4596797:4596812	4643631:4643646
4596797:4596812	attL	CGCGGGTATTGATTTT	NA	NA	NA	NA
WP_001352368.1|4600288_4601497_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|4601862_4603068_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562369.1|4603511_4603793_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_085948175.1|4603868_4605075_+|transposase	IS3-like element ISEc48 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	7.0e-99
WP_000460651.1|4605176_4605563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|4605570_4606257_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|4606234_4606858_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|4606939_4608145_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000019440.1|4608733_4609714_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_001398114.1|4610295_4611033_+	porin family protein	NA	NA	NA	NA	NA
WP_000228490.1|4611452_4612349_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
WP_001207396.1|4612397_4613477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100184.1|4613523_4615095_+	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_000766272.1|4615091_4615358_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001238008.1|4615497_4615695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281242.1|4615760_4617434_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000999859.1|4617577_4618621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218741.1|4619068_4620259_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
WP_001188508.1|4620626_4621202_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068882.1|4621238_4622942_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000887832.1|4622917_4623265_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000637595.1|4623385_4624687_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069440.1|4624801_4626238_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267291.1|4626578_4627055_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_001670701.1|4627113_4628355_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_000027827.1|4628630_4628924_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_000729126.1|4628967_4630614_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
WP_000558210.1|4630848_4631202_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001229227.1|4631249_4632107_-	YjeJ family protein	NA	NA	NA	NA	NA
WP_000940484.1|4632388_4633417_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257282.1|4633457_4634024_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977686.1|4634084_4634219_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_000239598.1|4634326_4634473_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000912959.1|4634503_4635091_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000118469.1|4635347_4635665_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238396.1|4635681_4636215_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	9.4e-48
WP_000609650.1|4636326_4636686_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208750.1|4636696_4637092_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829509.1|4637102_4637837_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192954.1|4637829_4639620_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004794.1|4639942_4640920_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
WP_000149871.1|4641145_4642648_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_001737341.1|4642712_4643033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236755.1|4643169_4646496_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
4643631:4643646	attR	CGCGGGTATTGATTTT	NA	NA	NA	NA
WP_000934949.1|4646514_4647483_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041945.1|4647574_4648627_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001271546.1|4648733_4649279_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
WP_000727897.1|4649340_4650081_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001670426.1|4651165_4652305_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000968675.1|4652303_4653851_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981984.1|4653822_4654284_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000640354.1|4654300_4655623_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
WP_001122540.1|4655632_4657489_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
WP_001000736.1|4657481_4658432_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051892.1|4658514_4658823_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460338.1|4658894_4660175_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312505.1|4660389_4661649_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_001232417.1|4661651_4662656_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
