The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011094	Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633, complete sequence	4709075	586187	699362	4709075	integrase,portal,capsid,terminase,tRNA,protease,tail,lysis,holin	Salmonella_phage(47.32%)	147	600667:600687	696436:696456
WP_000912377.1|586187_587573_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_000819116.1|587616_588441_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_001038576.1|588437_588875_-	STM0539 family protein	NA	NA	NA	NA	NA
WP_001143505.1|588867_589413_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190281.1|589540_589753_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729165.1|589754_590621_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000681026.1|591167_591725_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000619614.1|591799_592333_+	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_001531073.1|592376_593069_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000754218.1|593099_595712_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000708659.1|595726_596734_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000603406.1|596743_597262_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000801272.1|597307_597940_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001258113.1|598543_599266_-	fimbria biosynthesis regulator FimY	NA	NA	NA	NA	NA
WP_000226498.1|599284_599596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000948629.1|599757_600354_-	fimbria biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
600667:600687	attL	AATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001531071.1|600700_601864_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	96.1	1.9e-218
WP_157747414.1|602093_602234_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	95.7	9.4e-16
WP_001060562.1|602302_602980_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	29.6	6.9e-19
WP_001531074.1|602976_603219_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000206020.1|603327_603600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661511.1|603637_603937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000230225.1|603940_604384_-	ead/Ea22-like family protein	NA	I6RSM9	Salmonella_phage	96.2	2.6e-35
WP_001531070.1|604549_605047_-	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	86.7	2.6e-76
WP_012512998.1|605043_605208_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	96.3	3.0e-21
WP_001111318.1|605218_605512_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	3.2e-50
WP_000951330.1|605535_605919_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	97.6	2.1e-65
WP_000031362.1|605918_606524_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	98.5	7.8e-107
WP_001243355.1|606780_606933_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|606917_607049_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000005780.1|607073_608042_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.4	2.2e-55
WP_000167595.1|608224_608695_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000216029.1|608985_609288_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	98.0	4.8e-49
WP_023138238.1|609672_610305_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	2.8e-30
WP_000447947.1|610405_610621_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	69.0	1.1e-18
WP_001103492.1|610731_611013_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_001125982.1|611047_611194_+	DUF2740 family protein	NA	A0A0M4S617	Salmonella_phage	100.0	1.9e-19
WP_000067066.1|611186_612047_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	1.1e-159
WP_024132273.1|612154_614035_+	toprim domain-containing protein	NA	Q5G8S8	Enterobacteria_phage	97.9	0.0e+00
WP_001064628.1|614035_614314_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	100.0	5.2e-50
WP_000736922.1|614387_614825_+	recombination protein NinB	NA	C6ZR55	Salmonella_phage	100.0	7.7e-80
WP_000679702.1|614821_614995_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113764.1|614961_615138_+	NinE family protein	NA	I6RSI9	Salmonella_phage	96.6	4.3e-26
WP_000566853.1|615134_615311_+	protein ninF	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.0e-27
WP_001014910.1|615566_615962_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	1.4e-69
WP_000149926.1|615958_616162_+	phage NinH family protein	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_000219138.1|616142_616322_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
WP_001235449.1|616318_616942_+	antitermination protein	NA	C6ZR62	Salmonella_phage	98.6	3.4e-113
WP_000947857.1|617228_617747_+	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
WP_000781414.1|617970_618243_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
WP_001089360.1|618242_618740_+	lysozyme	NA	A5LH83	Enterobacteria_phage	93.3	1.5e-87
WP_023253534.1|618828_619296_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	88.4	1.9e-68
WP_001530409.1|619505_620003_+	KilA-N domain-containing protein	NA	A0A1V0E5R9	Salmonella_phage	100.0	1.4e-93
WP_001283924.1|619999_620257_+	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	3.8e-39
WP_000147264.1|620651_621083_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
WP_000445802.1|621066_622386_+|terminase	terminase	terminase	H6WRS9	Salmonella_phage	100.0	1.9e-262
WP_000130171.1|622518_623871_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	99.6	1.3e-258
WP_000162583.1|623824_624784_+|capsid	minor capsid protein	capsid	H6WRT1	Salmonella_phage	99.4	3.9e-177
WP_000868160.1|624799_626062_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	99.3	5.8e-237
WP_000092738.1|626074_626524_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	99.3	1.3e-77
WP_000273927.1|626541_627618_+	hypothetical protein	NA	I6RSK5	Salmonella_phage	99.7	9.0e-207
WP_001151799.1|627627_627807_+	hypothetical protein	NA	H6WRT5	Salmonella_phage	100.0	6.8e-27
WP_000633370.1|627858_628260_+	hypothetical protein	NA	Q5G8X8	Enterobacteria_phage	100.0	1.4e-72
WP_000312329.1|628259_628439_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	100.0	8.6e-30
WP_001289333.1|628431_628794_+	hypothetical protein	NA	H6WRT8	Salmonella_phage	100.0	3.3e-68
WP_001144359.1|628881_629319_+	hypothetical protein	NA	H6WRT9	Salmonella_phage	100.0	2.1e-77
WP_000198516.1|629315_629702_+	hypothetical protein	NA	H6WRU0	Salmonella_phage	100.0	3.5e-68
WP_000896574.1|629719_630460_+	immunoglobulin domain-containing protein	NA	H6WRU1	Salmonella_phage	100.0	3.5e-133
WP_000644471.1|630504_631158_+	hypothetical protein	NA	H6WRU2	Salmonella_phage	100.0	1.0e-120
WP_000065269.1|631379_632108_+	KilA-N domain-containing protein	NA	H6WRU3	Salmonella_phage	100.0	3.1e-142
WP_001260076.1|632129_632501_-	hypothetical protein	NA	H6WRU4	Salmonella_phage	99.2	1.9e-63
WP_023230837.1|632421_632679_+	hypothetical protein	NA	H6WRU5	Salmonella_phage	98.8	1.0e-39
WP_000049860.1|632699_633026_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	100.0	3.3e-51
WP_001154344.1|633136_633310_+	hypothetical protein	NA	H6WRU7	Salmonella_phage	100.0	5.8e-23
WP_001028069.1|633383_634022_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	100.0	2.1e-118
WP_001187765.1|634101_634890_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	100.0	5.2e-127
WP_023167675.1|635296_635671_+	hypothetical protein	NA	H6WRV1	Salmonella_phage	99.2	4.1e-66
WP_024132274.1|635744_636041_+	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	100.0	8.6e-43
WP_000758150.1|636123_636477_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	99.1	9.3e-60
WP_000184444.1|636598_637453_-	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	46.0	5.2e-56
WP_000006601.1|637762_638176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000721957.1|638190_638487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193226.1|638551_641722_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	69.0	9.9e-302
WP_000730009.1|641746_641986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001115294.1|642071_642419_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	93.9	2.4e-60
WP_001204732.1|642454_643159_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.0	2.3e-134
WP_001156981.1|643158_643878_+	C40 family peptidase	NA	H6WRW2	Salmonella_phage	99.5	9.8e-133
WP_016062821.1|643820_644348_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	100.0	1.9e-72
WP_000094329.1|644357_647537_+|tail	phage tail protein	tail	H6WRW4	Salmonella_phage	99.9	0.0e+00
WP_001113925.1|647545_648505_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
WP_001272645.1|648515_649652_+|tail	tail fiber domain-containing protein	tail	H6WRW6	Salmonella_phage	99.7	7.1e-210
WP_000778544.1|650259_651447_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.4	1.3e-121
WP_000884168.1|651787_652093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130045058.1|652089_652524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083329.1|652743_652941_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.3	5.1e-07
WP_001037933.1|653042_653639_+	hypothetical protein	NA	A0A1X9SFL9	Acinetobacter_phage	47.7	4.6e-19
WP_000240511.1|653718_654051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000752430.1|654244_654532_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001293161.1|654524_654686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001530407.1|654678_655077_+	DNA primase	NA	A0A286SGR4	Klebsiella_phage	54.2	2.0e-10
WP_001246435.1|655069_655240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000360563.1|655232_655460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001530385.1|655440_655761_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	73.1	3.5e-21
WP_001240985.1|655771_656566_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	66.0	1.2e-46
WP_000065153.1|656562_656868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001530372.1|656957_657341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001246607.1|657333_657981_+	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	42.1	9.1e-29
WP_000710141.1|657990_660132_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.7	1.3e-193
WP_000123960.1|660128_660524_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001031186.1|660567_661482_+	hypothetical protein	NA	F1C596	Cronobacter_phage	47.9	1.8e-59
WP_001530426.1|661575_662379_+	antitermination protein	NA	F1C595	Cronobacter_phage	72.2	6.7e-106
WP_001527046.1|664202_664547_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005903.1|664549_665164_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.1e-108
WP_000173714.1|665160_665697_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	47.9	3.6e-07
WP_001100259.1|665693_665945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051068.1|666020_666554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157747412.1|666965_667157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280369.1|667211_667709_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	55.1	2.8e-38
WP_001260047.1|667695_669810_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.3	1.2e-295
WP_000196423.1|669806_670013_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
WP_001009893.1|670009_671545_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	63.4	7.4e-178
WP_000718456.1|671507_673577_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	71.9	7.9e-276
WP_001107910.1|673665_673989_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	64.2	2.7e-29
WP_000002965.1|673981_674257_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	42.9	1.3e-13
WP_000053600.1|674260_674845_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.6	1.1e-76
WP_001032974.1|674841_675243_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	69.2	1.1e-51
WP_000971954.1|675250_675997_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|676047_676443_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|676439_676778_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372064.1|676749_679845_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.4	1.7e-277
WP_000447369.1|679847_680177_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152691.1|680186_680885_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	2.7e-103
WP_000662741.1|680891_681629_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	6.8e-129
WP_000246124.1|681526_682174_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
WP_001530402.1|682235_685598_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.1	0.0e+00
WP_000178849.1|685636_685879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144667.1|685932_688611_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	68.3	1.9e-157
WP_000421115.1|688625_689144_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_001674128.1|689715_689871_-	hypothetical protein	NA	E5G6P4	Salmonella_phage	75.0	2.2e-05
WP_000758585.1|689968_690739_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000334630.1|691457_692129_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	9.6e-82
WP_000434707.1|692428_693127_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	1.4e-88
WP_023237793.1|693212_693533_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	3.2e-19
WP_000477689.1|693577_694867_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	3.5e-165
WP_000065760.1|694879_695305_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	5.0e-52
WP_000077927.1|695658_695892_-	DinI family protein	NA	K7P797	Enterobacteria_phage	63.0	4.9e-17
WP_000143759.1|697904_699362_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	59.4	1.9e-154
696436:696456	attR	AATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NC_011094	Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633, complete sequence	4709075	1288080	1296360	4709075		Escherichia_phage(42.86%)	9	NA	NA
WP_000444506.1|1288080_1289331_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.0e-19
WP_000917280.1|1289776_1290901_+	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000275700.1|1291947_1292361_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	4.2e-19
WP_000733630.1|1292377_1293106_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_000158843.1|1293298_1293841_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001277616.1|1293988_1294366_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_001529135.1|1294438_1295248_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001036548.1|1295745_1295910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497451.1|1296120_1296360_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 3
NC_011094	Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633, complete sequence	4709075	2051495	2058755	4709075		Morganella_phage(33.33%)	8	NA	NA
WP_001157312.1|2051495_2052926_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.5	3.5e-105
WP_000377042.1|2052999_2053695_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2053786_2054086_-	membrane protein	NA	NA	NA	NA	NA
WP_001080663.1|2054735_2055938_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	4.4e-109
WP_024131109.1|2056198_2056387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2056397_2056610_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457657.1|2057064_2058333_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	2.4e-227
WP_000394197.1|2058335_2058755_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 4
NC_011094	Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633, complete sequence	4709075	2124201	2163363	4709075	integrase,head,portal,capsid,terminase,protease,tail,plate,holin	Salmonella_phage(84.62%)	56	2136618:2136632	2171952:2171966
WP_000798891.1|2124201_2124468_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	89.8	4.0e-39
WP_000343069.1|2124483_2124675_-	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_001530989.1|2124783_2125218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532385.1|2125691_2126066_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	35.0	9.0e-13
WP_001259328.1|2126117_2127251_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	7.2e-37
WP_000267959.1|2127326_2127500_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	65.1	1.7e-11
WP_086011185.1|2127489_2128095_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	94.1	1.7e-101
WP_000554743.1|2128064_2129609_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	91.0	2.1e-257
WP_001207832.1|2129595_2130183_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2130185_2131265_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2131257_2131671_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2131675_2132209_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2132208_2133267_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2133263_2134604_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2134637_2136566_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
2136618:2136632	attL	CGGATATCGCCGCCC	NA	NA	NA	NA
WP_022742746.1|2136650_2136944_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2136973_2137330_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2137329_2138826_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2138815_2138980_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2138983_2139544_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2139540_2140053_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2140024_2140429_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2140425_2140749_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2140751_2140952_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2141002_2142208_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2142222_2142873_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466263.1|2142850_2144092_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.0	6.5e-241
WP_000605609.1|2144091_2144274_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2144285_2146019_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2146015_2146510_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2146635_2146986_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2147036_2147369_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2147831_2148224_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001005893.1|2148220_2148835_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	97.1	5.0e-109
WP_162264800.1|2148837_2149179_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001097244.1|2149379_2150069_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000801757.1|2150065_2150206_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2150202_2150814_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929805.1|2151022_2151625_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2151707_2151929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2152040_2152274_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|2152565_2152856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2152933_2153245_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2153241_2153589_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800009.1|2153599_2154349_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.2	1.4e-137
WP_000062941.1|2154351_2155335_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2155419_2155794_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2155759_2155999_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2156118_2156529_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|2156578_2156839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2156831_2156990_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2157011_2157362_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2157488_2160416_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_071892913.1|2160378_2161536_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2161578_2161818_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001007943.1|2162181_2163363_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	99.5	1.3e-227
2171952:2171966	attR	CGGATATCGCCGCCC	NA	NA	NA	NA
>prophage 5
NC_011094	Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633, complete sequence	4709075	2192467	2202974	4709075		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2192467_2193781_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565904.1|2193807_2194887_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
WP_000648783.1|2194891_2195665_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018225.1|2195680_2196655_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973712.1|2196660_2197212_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.9e-52
WP_024132299.1|2197212_2198091_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	3.5e-108
WP_001023663.1|2198138_2199038_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697850.1|2199037_2200123_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_000981469.1|2200499_2201393_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111835.1|2201570_2202974_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 6
NC_011094	Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633, complete sequence	4709075	2270203	2279375	4709075	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195345.1|2270203_2272237_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703136.1|2272478_2272937_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_001221798.1|2273108_2273639_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2273695_2274163_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2274209_2274929_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2274925_2276611_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2276833_2277565_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2277624_2277732_+	protein YohO	NA	NA	NA	NA	NA
WP_000824858.1|2277712_2278444_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2278427_2279375_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NC_011094	Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633, complete sequence	4709075	4314689	4358561	4709075	integrase,portal,head,capsid,terminase,tRNA,protease,tail,plate,holin	Salmonella_phage(50.0%)	63	4353007:4353022	4356413:4356428
WP_000956555.1|4314689_4315223_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	88.7	1.3e-89
WP_000678277.1|4315416_4315590_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	98.2	2.9e-22
WP_001093920.1|4315652_4315925_-	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	94.3	2.2e-40
WP_000156435.1|4316060_4316429_-	hypothetical protein	NA	G9L6B4	Escherichia_phage	80.2	3.6e-46
WP_000267994.1|4316425_4316719_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	97.9	9.4e-50
WP_000850456.1|4316760_4317063_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	70.5	4.5e-31
WP_001017878.1|4317066_4317768_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	97.9	8.9e-46
WP_000008354.1|4317838_4318378_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	98.9	6.5e-97
WP_000080411.1|4318514_4319342_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	97.8	1.6e-150
WP_000997190.1|4319399_4319771_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000078504.1|4320342_4320594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067434.1|4320669_4320861_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_000450735.1|4321044_4321671_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|4321768_4321969_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|4322006_4322558_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|4322733_4322913_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104967.1|4322902_4323844_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_000066917.1|4323938_4324592_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210148.1|4324588_4324915_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_000767130.1|4324911_4325301_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061375.1|4325320_4326118_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	1.3e-149
WP_012513026.1|4326125_4327115_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	8.9e-193
WP_001047097.1|4327128_4327881_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	96.4	2.3e-140
WP_000508331.1|4328060_4328279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658039.1|4328559_4328748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|4328837_4329227_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226307.1|4329213_4329495_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075994.1|4329494_4330109_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.6	2.2e-109
WP_001050814.1|4330105_4330648_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001252724.1|4330750_4331254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749169.1|4331321_4331666_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.0	4.4e-46
WP_000919034.1|4331798_4332263_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_000229717.1|4332216_4333959_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.7	3.1e-140
WP_000002706.1|4333958_4335263_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.9	5.1e-220
WP_000039024.1|4335276_4336125_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	4.4e-132
WP_000005720.1|4336134_4337352_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.4	3.9e-198
WP_000691031.1|4337395_4337665_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	3.0e-10
WP_000886224.1|4337664_4337988_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_001255649.1|4337999_4338413_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.0	1.3e-49
WP_001180259.1|4338384_4338897_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	86.5	1.4e-80
WP_001241332.1|4338893_4339439_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_000497756.1|4339460_4339625_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	2.2e-24
WP_001007994.1|4339614_4341111_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515952.1|4341110_4341467_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|4341463_4341790_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785382.1|4341874_4343800_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.6	0.0e+00
WP_001033736.1|4343816_4344266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000863821.1|4344325_4345666_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	1.7e-250
WP_001066631.1|4345662_4346721_+	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_001273648.1|4346720_4347254_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_000605051.1|4347258_4347672_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_000785578.1|4347664_4348744_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_001207832.1|4348746_4349334_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554741.1|4349320_4350415_+	hypothetical protein	NA	A0A1C9II52	Salmonella_phage	99.1	7.9e-57
WP_000006335.1|4350421_4350829_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
WP_000161707.1|4351025_4351748_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000639149.1|4352272_4352836_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_001217553.1|4352979_4353228_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
4353007:4353022	attL	TTCCCAGGTATCTTTC	NA	NA	NA	NA
WP_000332264.1|4353289_4354387_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_000543820.1|4354475_4355513_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|4355680_4355923_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235555.1|4356097_4357081_-	quinone oxidoreductase	NA	NA	NA	NA	NA
4356413:4356428	attR	TTCCCAGGTATCTTTC	NA	NA	NA	NA
WP_000918353.1|4357145_4358561_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
>prophage 1
NC_011092	Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 plasmid pCVM19633_110, complete sequence	110227	8635	68874	110227	integrase,transposase	Escherichia_phage(38.46%)	51	37869:37928	66520:67341
WP_000331736.1|8635_9361_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	42.2	4.4e-40
WP_000750474.1|9460_9871_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000208727.1|9973_10933_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000633445.1|11078_12167_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	61.7	9.7e-124
WP_001067852.1|12229_12934_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000557466.1|13197_14271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000550473.1|14314_14464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534857.1|14805_15045_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	2.0e-18
WP_000323025.1|15044_15332_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_001531258.1|15635_16418_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_000627495.1|16414_17437_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_001162839.1|18236_20444_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000449742.1|20446_23029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085950818.1|23449_24570_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000600827.1|24998_25976_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
WP_001214977.1|28787_29195_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|29332_30217_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|30248_31448_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|31553_32204_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|32235_32478_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138073.1|33548_36521_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|36523_37081_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
37869:37928	attL	AGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067855.1|37922_38627_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|40016_40685_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|40720_40957_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|40953_41316_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|41333_43028_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000027057.1|43191_44052_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|44445_45150_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000084744.1|45484_45877_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_063102497.1|46196_46583_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_001138062.1|46714_49681_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_000147567.1|49683_50244_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_072266016.1|50369_50519_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|50554_51259_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_011264039.1|51331_51571_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|51716_52580_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|52617_52863_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|53331_54123_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|54125_54401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|55302_55635_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|55804_56596_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|56688_57948_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|58209_59001_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|59058_59667_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|59762_60605_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|60771_61785_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067858.1|62276_62981_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000168937.1|65317_65788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|66573_67278_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067858.1|68169_68874_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
66520:67341	attR	AGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
