The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	139269	193098	2885038	transposase	Streptococcus_phage(37.5%)	51	NA	NA
WP_012535799.1|139269_140589_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535798.1|140710_141025_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_012535826.1|141168_141801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535827.1|141846_143166_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_012535828.1|143185_144202_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_155115419.1|144498_144630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535829.1|144896_146084_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_012535830.1|146113_146818_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_012535831.1|146834_147035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535832.1|147045_148416_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_012535834.1|148973_149381_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_080515392.1|149430_149919_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_012535836.1|149932_151354_+	FAD-dependent pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	31.0	2.1e-22
WP_012535837.1|151505_152192_-	heavy metal transport/detoxification protein	NA	NA	NA	NA	NA
WP_049756731.1|152205_152628_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_012535839.1|152743_153151_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012535840.1|153521_154436_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155115420.1|154933_155254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535841.1|155528_157553_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	6.9e-75
WP_012535842.1|157840_158104_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_080515394.1|158803_159157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535843.1|159250_160561_+	TolC family protein	NA	NA	NA	NA	NA
WP_012535844.1|160557_161874_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012535845.1|161866_164977_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.7	2.2e-51
WP_012535846.1|165002_165749_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_012535847.1|165877_166240_+	copper-binding protein	NA	NA	NA	NA	NA
WP_012535848.1|166354_166663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535850.1|167195_168023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535852.1|168755_168959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155115421.1|169725_171033_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.7	5.2e-47
WP_012535855.1|171178_171448_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	47.7	1.1e-12
WP_012535856.1|171699_174798_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012535857.1|174838_175966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155115422.1|175962_177423_-	TolC family protein	NA	NA	NA	NA	NA
WP_012535859.1|177419_179432_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	3.8e-89
WP_012535860.1|179461_179845_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	40.6	1.2e-12
WP_012535861.1|180169_181318_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.5	1.9e-29
WP_012535862.1|181317_181959_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012535863.1|182108_182792_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_155115423.1|182895_183297_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_012535865.1|183287_183533_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_155115448.1|183591_184158_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155115449.1|184466_184730_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012535868.1|184834_186019_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012535869.1|186311_187421_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012535870.1|187639_187849_-	DUF4926 domain-containing protein	NA	NA	NA	NA	NA
WP_012535871.1|187845_188259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535872.1|188596_188971_-	copper-binding protein	NA	NA	NA	NA	NA
WP_155115424.1|189316_190882_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012535798.1|191342_191657_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_012535799.1|191778_193098_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	253329	310280	2885038	transposase,integrase	Stx2-converting_phage(20.0%)	56	308892:308923	312274:312305
WP_012535935.1|253329_254967_-|transposase	IS66-like element ISAfe4 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	2.0e-104
WP_012535936.1|255016_255364_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012535937.1|255354_255687_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_155115427.1|256222_256675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535938.1|257290_258190_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_012535939.1|258517_258775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535940.1|258858_260097_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_012535941.1|260098_260869_-	ParA family protein	NA	NA	NA	NA	NA
WP_012535942.1|260871_261267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535944.1|261780_262371_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_041838726.1|262517_262781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535946.1|262843_264202_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_012535947.1|264198_264792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535948.1|265275_265572_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	47.3	7.1e-13
WP_012535949.1|266348_268403_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.7	3.0e-33
WP_012535950.1|268615_268861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535951.1|268863_269637_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012535952.1|270085_270589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535953.1|270588_272049_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_012535954.1|272041_273073_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012535955.1|273094_273844_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_155115428.1|273759_275316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535957.1|275637_276117_+	hypothetical protein	NA	A0A2I7QW36	Vibrio_phage	38.1	1.9e-15
WP_155115429.1|276244_276616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155115430.1|277141_277819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535959.1|277815_278763_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_012535960.1|278956_281278_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012535961.1|281274_283164_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_012535962.1|283487_283793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535963.1|283967_284141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535964.1|284127_284658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535965.1|284754_285138_-	NifU family protein	NA	NA	NA	NA	NA
WP_012535966.1|285143_285884_-	pteridine reductase	NA	NA	NA	NA	NA
WP_041646706.1|285779_287021_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012535968.1|287123_288059_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_012535799.1|288536_289856_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535798.1|289977_290292_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_009564895.1|290590_291982_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_012535969.1|292019_292952_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012535970.1|293187_294030_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_012535798.1|294197_294512_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_012535799.1|294633_295953_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535972.1|296659_297790_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_009566816.1|297791_298556_-	RMD1 family protein	NA	NA	NA	NA	NA
WP_009566815.1|298559_299945_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_012535973.1|299941_301018_-	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	42.6	1.0e-16
WP_012535974.1|301014_301380_-	YraN family protein	NA	NA	NA	NA	NA
WP_012535975.1|301383_303222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535976.1|303291_304167_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_009569274.1|304696_304942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111122543.1|305213_305600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009565818.1|305752_306547_-	transferase	NA	NA	NA	NA	NA
WP_012535979.1|306661_307060_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_009567530.1|307228_307432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535980.1|307442_308282_-	AAA family ATPase	NA	NA	NA	NA	NA
308892:308923	attL	GTACCATTATGTGGCGCTTTAAAATATGTGGC	NA	NA	NA	NA
WP_012535982.1|309035_310280_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012535982.1|309035_310280_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
312274:312305	attR	GCCACATATTTTAAAGCGCCACATAATGGTAC	NA	NA	NA	NA
>prophage 3
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	443772	452558	2885038		Staphylococcus_phage(66.67%)	11	NA	NA
WP_012536070.1|443772_445017_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.6	1.5e-99
WP_012536071.1|445023_445515_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_111122540.1|445501_446605_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.0	3.8e-43
WP_009560911.1|446608_447265_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.2	8.4e-30
WP_012536073.1|447261_448395_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.3	9.3e-53
WP_009568607.1|448391_448856_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	51.0	3.6e-35
WP_012536074.1|448866_449310_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_012536075.1|449437_449719_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_012536076.1|449877_450450_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012536077.1|450467_450821_-	LapA family protein	NA	NA	NA	NA	NA
WP_012536078.1|450875_452558_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	G9E5W0	Micromonas_pusilla_virus	29.3	2.2e-34
>prophage 5
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	1689552	1745474	2885038	transposase,tRNA,protease	uncultured_Mediterranean_phage(12.5%)	50	NA	NA
WP_012536938.1|1689552_1690668_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.2	8.8e-88
WP_012536939.1|1690664_1691702_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_012536940.1|1691710_1693060_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012536941.1|1693074_1693668_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012536942.1|1693730_1694945_-	O-succinylhomoserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	27.8	8.0e-18
WP_012536943.1|1694941_1696387_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	3.6e-57
WP_012536944.1|1696376_1696874_-	CvpA family protein	NA	NA	NA	NA	NA
WP_012536945.1|1696870_1698160_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012536946.1|1698188_1699073_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_009567136.1|1699069_1699888_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_012536947.1|1699884_1701084_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_012536948.1|1701094_1701706_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_012536949.1|1701766_1702582_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_009564641.1|1702594_1704790_-	Tfp pilus assembly protein FimV-like protein	NA	NA	NA	NA	NA
WP_012536950.1|1704853_1705876_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012536951.1|1705883_1706960_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_009567445.1|1707061_1707676_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_012536952.1|1707672_1708167_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_012536953.1|1708169_1709411_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_012536954.1|1709419_1710061_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	46.6	9.7e-31
WP_012536955.1|1710150_1711968_-	signal peptide peptidase SppA	NA	Q8W6U6	Burkholderia_virus	24.3	1.4e-10
WP_012536956.1|1712175_1715085_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_012536957.1|1715090_1716947_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_012536958.1|1716967_1718203_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012536959.1|1718192_1718885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012536960.1|1719203_1719845_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009567699.1|1720006_1720444_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_009567700.1|1720782_1721790_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_080513198.1|1721768_1722569_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_009567117.1|1722891_1723833_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_012536962.1|1723937_1725467_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_146235861.1|1725837_1726653_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012536965.1|1726649_1726970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012607314.1|1726979_1727339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012536966.1|1728131_1728998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012536967.1|1729099_1730404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155115434.1|1730513_1731191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535936.1|1731257_1731605_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012535935.1|1731654_1733292_+|transposase	IS66-like element ISAfe4 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	2.0e-104
WP_080515402.1|1733316_1733691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148208624.1|1733745_1734432_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080513199.1|1734445_1735030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111122617.1|1735297_1737580_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012536971.1|1737576_1738674_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012536972.1|1738670_1741775_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.7	2.2e-72
WP_012536973.1|1741800_1742520_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	2.5e-11
WP_012536974.1|1742512_1743238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012536975.1|1743280_1743664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535799.1|1743718_1745038_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535798.1|1745159_1745474_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
>prophage 6
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	2031454	2091693	2885038	transposase,integrase	Streptococcus_phage(22.22%)	57	2029546:2029576	2035436:2035466
2029546:2029576	attL	TACCATTATGTGGCGCTTTAAAATATGTGGC	NA	NA	NA	NA
WP_012536794.1|2031454_2032939_-|transposase	IS21-like element ISAfe9 family transposase	transposase	NA	NA	NA	NA
WP_012535983.1|2033438_2034380_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009561339.1|2034372_2035371_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.5	1.5e-17
WP_012537169.1|2036439_2036988_-	hypothetical protein	NA	NA	NA	NA	NA
2035436:2035466	attR	GCCACATATTTTAAAGCGCCACATAATGGTA	NA	NA	NA	NA
WP_155115437.1|2037110_2038073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012607406.1|2039632_2040007_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012537173.1|2040223_2040415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146235842.1|2040993_2042304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537175.1|2042313_2044743_+	DEAD/DEAH box helicase	NA	A0A0P0YML3	Yellowstone_lake_phycodnavirus	27.9	4.8e-30
WP_012537176.1|2045279_2045765_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009561179.1|2045998_2046475_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_012537178.1|2046551_2048729_-	phosphoenolpyruvate-utilizing protein	NA	NA	NA	NA	NA
WP_012537179.1|2048817_2049480_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.4	1.7e-30
WP_012537180.1|2049758_2050040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009567395.1|2050036_2050279_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_049756722.1|2050423_2051245_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_009567396.1|2051335_2052133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537182.1|2052804_2054280_-	recombinase	NA	NA	NA	NA	NA
WP_012537183.1|2054511_2055513_-	cation transporter	NA	NA	NA	NA	NA
WP_012537184.1|2055612_2056089_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012537185.1|2056101_2056752_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012537186.1|2056768_2057260_-	ATP synthase F1 subunit epsilon	NA	NA	NA	NA	NA
WP_012537187.1|2057384_2058011_-	cation transporter	NA	NA	NA	NA	NA
WP_012537188.1|2058186_2058399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537189.1|2058547_2058856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537190.1|2058971_2059334_-	copper-binding protein	NA	NA	NA	NA	NA
WP_012537191.1|2059462_2060218_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_012537192.1|2060276_2060966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537193.1|2061033_2064144_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.6	1.1e-55
WP_012537194.1|2064136_2065585_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012537195.1|2065581_2066892_-	TolC family protein	NA	NA	NA	NA	NA
WP_012607422.1|2066984_2067335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537197.1|2068037_2068301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537198.1|2068440_2070465_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	8.5e-73
WP_009569249.1|2071071_2071383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155115438.1|2071736_2071889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009569252.1|2072745_2073012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537200.1|2074193_2074589_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_009560961.1|2074650_2074857_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	42.9	2.2e-05
WP_009560960.1|2074861_2075101_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_012607428.1|2075245_2075548_+	cytochrome c	NA	NA	NA	NA	NA
WP_012537203.1|2076869_2078471_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	36.2	1.3e-23
WP_009569704.1|2078591_2078858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535799.1|2079554_2080874_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535798.1|2080995_2081310_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_012537204.1|2081671_2083291_-	APC family permease	NA	NA	NA	NA	NA
WP_012607432.1|2083315_2083729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537206.1|2083800_2084160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537207.1|2084218_2084518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009561063.1|2084514_2084886_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012537208.1|2084943_2086134_-	porin	NA	NA	NA	NA	NA
WP_009566656.1|2086213_2087212_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.4	2.6e-38
WP_012537209.1|2087365_2088922_-	RimK family alpha-L-glutamate ligase	NA	NA	NA	NA	NA
WP_080513212.1|2088955_2089237_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012535937.1|2089335_2089668_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012535936.1|2089658_2090006_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012535935.1|2090055_2091693_+|transposase	IS66-like element ISAfe4 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	2.0e-104
>prophage 7
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	2117402	2162934	2885038	transposase,tRNA	Bacillus_phage(33.33%)	45	NA	NA
WP_012535798.1|2117402_2117717_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_012535799.1|2117838_2119158_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535799.1|2120864_2122184_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535798.1|2122305_2122620_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_012537231.1|2123767_2124457_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_074874161.1|2124534_2125236_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012537232.1|2125382_2125760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009561598.1|2126001_2126484_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009561601.1|2127297_2127822_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012537233.1|2127849_2129469_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	35.0	4.6e-13
WP_012537234.1|2129475_2129952_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_012537235.1|2129953_2130622_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_012537236.1|2130621_2132547_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.7	6.8e-96
WP_009569361.1|2132616_2132979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537237.1|2133191_2134289_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	30.3	2.5e-10
WP_012537238.1|2134789_2136046_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_012537239.1|2136078_2136366_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_012537240.1|2136362_2138711_+	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_012537241.1|2138707_2139007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537242.1|2139104_2139977_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	3.7e-73
WP_009562419.1|2139969_2140722_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	29.4	8.7e-07
WP_009562418.1|2140718_2141366_-	membrane protein	NA	NA	NA	NA	NA
WP_009562417.1|2141397_2141754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537243.1|2141750_2142503_-	GMP synthase	NA	NA	NA	NA	NA
WP_009564938.1|2142504_2143431_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009564939.1|2143515_2144118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537244.1|2144139_2145285_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012607461.1|2145281_2146448_-	acetoin utilization protein AcuC	NA	NA	NA	NA	NA
WP_009563394.1|2146492_2148988_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_041838693.1|2148997_2149828_-	AAA domain-containing protein	NA	A0A2H4N7N3	Lake_Baikal_phage	30.4	1.1e-13
WP_012537246.1|2149824_2150226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009563398.1|2150352_2150676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012607465.1|2150730_2151090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074874163.1|2151163_2152066_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_009567349.1|2152175_2152589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537248.1|2152715_2154059_-	membrane protein	NA	NA	NA	NA	NA
WP_012537249.1|2154271_2155408_-	radical SAM protein	NA	NA	NA	NA	NA
WP_009565665.1|2155432_2156494_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012537250.1|2156490_2157561_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_012537251.1|2157609_2158731_-	radical SAM protein	NA	NA	NA	NA	NA
WP_012537252.1|2158815_2159253_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_012537253.1|2159308_2159707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009565261.1|2159703_2160150_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_012537254.1|2160218_2161130_-	disulfide reductase	NA	NA	NA	NA	NA
WP_012535799.1|2161614_2162934_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	2339472	2393627	2885038	transposase,tRNA,protease	uncultured_Mediterranean_phage(15.38%)	56	NA	NA
WP_009565976.1|2339472_2340012_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012537366.1|2340014_2341337_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.9	1.6e-40
WP_009568269.1|2341359_2341692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537367.1|2341688_2342549_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.8	5.6e-42
WP_009568267.1|2342692_2343598_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009568266.1|2343594_2344266_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	39.2	3.1e-32
WP_009568264.1|2344262_2345294_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_009568262.1|2345416_2345986_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_012537368.1|2345978_2346503_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.2	6.2e-28
WP_012537369.1|2346531_2346783_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	7.9e-21
WP_012537370.1|2346766_2348746_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_009567582.1|2348762_2349575_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	25.2	1.9e-15
WP_009567581.1|2349577_2350444_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_012537371.1|2350433_2351531_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	42.4	1.5e-07
WP_012537372.1|2351527_2352859_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_012537373.1|2352913_2354575_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009567130.1|2354571_2355228_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_012537374.1|2355224_2356070_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_009567132.1|2356197_2357145_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.7	2.3e-44
WP_041646513.1|2357978_2358890_-	DUF2034 domain-containing protein	NA	NA	NA	NA	NA
WP_009566528.1|2359178_2359331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009566530.1|2359859_2360099_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012537379.1|2360279_2360549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012535799.1|2361623_2362943_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535798.1|2363064_2363379_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_009561129.1|2363803_2364046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537380.1|2364352_2365138_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012536793.1|2365613_2366441_-	cell division protein ZapE	NA	U5N3V8	Enterobacteria_phage	33.1	1.6e-33
WP_012536794.1|2366437_2367922_-|transposase	IS21-like element ISAfe9 family transposase	transposase	NA	NA	NA	NA
WP_080515405.1|2367994_2369320_-	benzoylformate decarboxylase	NA	NA	NA	NA	NA
WP_012537381.1|2369547_2370168_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_009561617.1|2370199_2370478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537382.1|2370692_2372717_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.9	8.5e-73
WP_041646518.1|2373034_2373388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155115441.1|2373481_2373871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009569871.1|2373925_2374288_+	copper-binding protein	NA	NA	NA	NA	NA
WP_009569872.1|2374412_2374721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041647500.1|2375167_2375995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537385.1|2376275_2377430_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_009569877.1|2378337_2378691_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_012537386.1|2378810_2379593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537387.1|2379804_2382873_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.9	3.6e-67
WP_012537388.1|2382869_2383655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537389.1|2383642_2384899_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_009565342.1|2385038_2385260_-	DUF4926 domain-containing protein	NA	NA	NA	NA	NA
WP_009565339.1|2385294_2385561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537390.1|2385585_2387163_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_111122581.1|2387186_2387672_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_080513214.1|2387648_2387942_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_012537392.1|2388373_2389054_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012537393.1|2389163_2389574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012607533.1|2389683_2390208_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	38.8	2.5e-21
WP_012537395.1|2390245_2391736_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_012537396.1|2391967_2392366_+	VOC family protein	NA	NA	NA	NA	NA
WP_012537397.1|2392362_2393106_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	30.3	5.4e-17
WP_012535798.1|2393312_2393627_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
>prophage 9
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	2753139	2767473	2885038	transposase	Enterobacteria_phage(100.0%)	13	NA	NA
WP_012535798.1|2753139_2753454_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_012535799.1|2753575_2754895_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012536793.1|2755867_2756695_-	cell division protein ZapE	NA	U5N3V8	Enterobacteria_phage	33.1	1.6e-33
WP_012536794.1|2756691_2758176_-|transposase	IS21-like element ISAfe9 family transposase	transposase	NA	NA	NA	NA
WP_009565743.1|2758415_2758643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012607643.1|2758752_2758911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012536826.1|2760166_2761195_-|transposase	IS110-like element ISAfe1 family transposase	transposase	NA	NA	NA	NA
WP_041646670.1|2762787_2763084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012537644.1|2763313_2764231_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_009565616.1|2764698_2764959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012607644.1|2765129_2765408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012535799.1|2765717_2767037_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535798.1|2767158_2767473_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
>prophage 10
NC_011206	Acidithiobacillus ferrooxidans ATCC 53993, complete genome	2885038	2779424	2818766	2885038	transposase,tRNA,integrase	Paramecium_bursaria_Chlorella_virus(25.0%)	36	2806823:2806838	2824078:2824093
WP_012535799.1|2779424_2780744_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012535798.1|2780865_2781180_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_009568473.1|2782126_2783956_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009568474.1|2783967_2785623_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012537651.1|2785606_2787772_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012607647.1|2787768_2788605_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_012537653.1|2788778_2790614_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	42.8	3.8e-128
WP_012537654.1|2790659_2792027_-	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A1V0SB89	Catovirus	29.3	4.3e-12
WP_009569104.1|2792155_2792581_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_012537655.1|2792584_2793994_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_012537656.1|2794035_2794902_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_012537657.1|2794911_2796456_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_009561112.1|2796472_2797012_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_009561113.1|2797022_2797502_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_009561114.1|2797544_2797799_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_012537658.1|2797840_2798590_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_012537659.1|2798592_2798964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009566150.1|2799018_2799903_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	32.9	5.3e-11
WP_012537660.1|2799899_2800682_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	31.3	7.7e-14
WP_012537661.1|2800728_2801394_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_012537662.1|2801398_2803273_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_012537663.1|2803291_2803741_-	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_012607648.1|2803728_2804268_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012537664.1|2804277_2804820_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_009560967.1|2804968_2805904_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_009560966.1|2805934_2806876_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
2806823:2806838	attL	TTTGTGGTATCCGGCA	NA	NA	NA	NA
WP_012537665.1|2806883_2807783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009566393.1|2807798_2808713_+	magnesium transporter	NA	NA	NA	NA	NA
WP_012537666.1|2808793_2809864_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_009560955.1|2810254_2810707_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_009560954.1|2810710_2811583_+	pirin family protein	NA	NA	NA	NA	NA
WP_012537667.1|2811789_2812467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080513205.1|2812363_2812645_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_009568470.1|2813216_2815523_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012537668.1|2815608_2818404_+	bifunctional YncE family protein/alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_009561902.1|2818550_2818766_-|integrase	phage integrase	integrase	NA	NA	NA	NA
2824078:2824093	attR	TGCCGGATACCACAAA	NA	NA	NA	NA
