The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011586	Acinetobacter baumannii AB0057, complete sequence	4055148	263612	301726	4055148	integrase,transposase	uncultured_Caudovirales_phage(38.46%)	39	253444:253458	267619:267633
253444:253458	attL	TTGAGCATCAGTTAA	NA	NA	NA	NA
WP_000736404.1|263612_264323_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	9.1e-06
WP_000573062.1|264323_266234_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000417085.1|266238_267159_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_002018150.1|267188_268304_+	TniQ family protein	NA	NA	NA	NA	NA
267619:267633	attR	TTGAGCATCAGTTAA	NA	NA	NA	NA
WP_005116093.1|268296_269745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000192758.1|269848_270916_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	58.7	7.1e-95
WP_001172025.1|271017_271971_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.1	2.4e-62
WP_000174605.1|271988_272693_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.9	1.3e-92
WP_000068656.1|272698_273742_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000670219.1|273749_274223_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.2	3.9e-37
WP_000372102.1|274229_274550_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	63.7	2.1e-26
WP_001275666.1|274607_275042_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	56.5	2.9e-39
WP_001219642.1|275864_276272_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000021528.1|277269_277782_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000137809.1|277803_279093_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_000340224.1|279155_279830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210271.1|279900_281919_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.1	1.1e-80
WP_001037424.1|281945_282299_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001258304.1|282332_282659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004369.1|283113_283533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|283630_284470_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|284597_285098_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|285604_286369_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000993245.1|286606_286819_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|286884_287121_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|287117_287483_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|287500_289186_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|289224_289650_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|289677_289953_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|289968_290334_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|290405_290861_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|290998_291241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|291272_291923_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|292028_293228_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|293259_294144_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|294281_294689_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000656305.1|296495_296873_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|297073_297733_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001143757.1|298720_301726_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.1	0.0e+00
>prophage 2
NC_011586	Acinetobacter baumannii AB0057, complete sequence	4055148	553502	616693	4055148	integrase,transposase,protease	uncultured_Caudovirales_phage(18.18%)	60	579705:579721	605191:605207
WP_088631513.1|553502_554593_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000165735.1|555961_556207_+	SlyX family protein	NA	NA	NA	NA	NA
WP_000648641.1|556254_557265_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001029768.1|557364_557742_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000368721.1|557889_558339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024269.1|558374_561011_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.5	2.6e-90
WP_000265761.1|561098_561857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859455.1|561994_562567_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_000050371.1|562683_564663_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	28.4	1.6e-63
WP_000699342.1|564736_564976_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_001183874.1|564983_565343_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000985993.1|565393_565927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027403.1|566039_566318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119808.1|566355_568065_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_001205031.1|568213_568369_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000048256.1|568381_568618_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001088252.1|568785_570234_-	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000056618.1|570346_571039_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080849.1|571086_571977_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_000730960.1|572407_573124_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_001011664.1|573168_573789_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_000885431.1|573788_574193_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_001183413.1|574253_574775_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000551518.1|574875_575931_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_000312548.1|575945_576455_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.0	2.4e-24
WP_001203170.1|576499_577342_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	7.1e-98
WP_000881950.1|577464_577827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000889270.1|577837_578197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959085.1|578270_579089_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_085920645.1|579191_579962_+	NRDE family protein	NA	NA	NA	NA	NA
579705:579721	attL	GAGTTAAGTTTGCAGCA	NA	NA	NA	NA
WP_001144964.1|582212_584009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190004.1|584366_585457_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001046004.1|585562_586384_+	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_001992510.1|587048_587603_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000262332.1|587610_587943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947913.1|588044_589134_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001277980.1|589138_590605_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
WP_000034564.1|590617_591469_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001095006.1|591536_591836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|591908_592280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002017214.1|592654_594085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081835.1|594077_595193_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000417085.1|595222_596143_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000573060.1|596147_598058_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736399.1|598058_598769_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_000205448.1|599228_601409_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_001072727.1|601582_602353_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_000887761.1|602349_602787_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_000908081.1|602798_603017_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_001196409.1|603268_604144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106715.1|604339_604966_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	30.8	8.9e-13
WP_002009379.1|605134_605677_-	sel1 repeat family protein	NA	NA	NA	NA	NA
605191:605207	attR	GAGTTAAGTTTGCAGCA	NA	NA	NA	NA
WP_001217230.1|605718_606312_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_000009638.1|606311_607472_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000978841.1|607555_609253_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_001984475.1|609711_610395_-	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	30.1	4.3e-21
WP_000052885.1|610499_612731_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001198432.1|613145_614480_+	trigger factor	NA	NA	NA	NA	NA
WP_000289452.1|614672_615278_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
WP_001289250.1|615379_616693_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
>prophage 3
NC_011586	Acinetobacter baumannii AB0057, complete sequence	4055148	1315031	1329617	4055148		Acinetobacter_phage(50.0%)	25	NA	NA
WP_001038586.1|1315031_1315376_-	hypothetical protein	NA	A0A0P0IYD2	Acinetobacter_phage	78.8	7.4e-38
WP_000578498.1|1315372_1315882_-	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	85.1	1.1e-32
WP_000609003.1|1315878_1316415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|1316407_1316587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986116.1|1316587_1316878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805204.1|1317018_1318047_-	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_000645466.1|1318059_1318740_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_000856471.1|1318914_1319286_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.0	6.4e-11
WP_001072361.1|1319282_1319612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183423.1|1319692_1320031_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	39.3	1.6e-13
WP_000794429.1|1320225_1320510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001108434.1|1320513_1321278_-	S24 family peptidase	NA	A0A0P0I8E0	Acinetobacter_phage	63.0	1.6e-77
WP_000172739.1|1321413_1321617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|1321652_1322027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290739.1|1322060_1322261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200145.1|1322257_1322443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000575722.1|1322439_1322895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218440.1|1322891_1323530_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	39.9	9.0e-29
WP_000606802.1|1323526_1324501_+	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	47.7	2.7e-77
WP_002029044.1|1324506_1324893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001055561.1|1324889_1326368_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
WP_000124475.1|1326371_1327415_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_000994864.1|1327411_1328176_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	1.0e-63
WP_000991091.1|1328172_1328706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136753.1|1329161_1329617_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
>prophage 4
NC_011586	Acinetobacter baumannii AB0057, complete sequence	4055148	1466614	1478284	4055148	capsid,terminase	Acinetobacter_phage(30.0%)	14	NA	NA
WP_001138417.1|1466614_1467073_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	2.0e-30
WP_001004672.1|1467381_1467726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113266.1|1468473_1468956_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	85.8	2.2e-67
WP_001086349.1|1468933_1470424_+|terminase	phage terminase large subunit	terminase	I3PGT7	Xanthomonas_phage	41.2	1.4e-88
WP_000852322.1|1470432_1471767_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	40.0	3.7e-85
WP_001273094.1|1471711_1472524_+|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	42.1	2.7e-54
WP_000032786.1|1472603_1472792_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001140766.1|1472832_1473465_+	hypothetical protein	NA	U5U717	Lactobacillus_phage	24.5	2.8e-06
WP_000653192.1|1473518_1474718_+	DUF2213 domain-containing protein	NA	A0A2I7R2U8	Vibrio_phage	28.5	2.0e-21
WP_000060043.1|1474736_1475207_+	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	41.8	8.1e-19
WP_001990240.1|1475210_1475702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001990242.1|1475698_1476697_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_001068512.1|1476757_1477744_-	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	31.7	5.7e-14
WP_000433906.1|1477894_1478284_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	96.9	1.1e-64
>prophage 5
NC_011586	Acinetobacter baumannii AB0057, complete sequence	4055148	2763709	2796631	4055148	capsid,terminase	Acinetobacter_phage(100.0%)	41	NA	NA
WP_001197968.1|2763709_2763898_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	96.7	1.1e-27
WP_000079982.1|2764194_2764716_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000208716.1|2764882_2765437_-	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	79.9	1.3e-79
WP_001083663.1|2765426_2765645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138204.1|2765641_2765998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598523.1|2766064_2769511_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	98.2	0.0e+00
WP_000835153.1|2769503_2769866_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
WP_000368382.1|2769862_2770369_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
WP_000277446.1|2770368_2770767_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000991941.1|2770903_2771611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959543.1|2771637_2772282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134295.1|2772271_2773003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046535.1|2773471_2777779_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	97.1	0.0e+00
WP_000106804.1|2777856_2778132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000722131.1|2778150_2778672_-	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
WP_000453244.1|2778758_2778995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065059.1|2779203_2780133_+	ORF6N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	86.5	4.7e-87
WP_001258718.1|2780247_2780958_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001185605.1|2781508_2782024_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	98.5	1.1e-72
WP_000094258.1|2782093_2783011_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	94.4	1.5e-162
WP_001284999.1|2783106_2784204_-	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	41.2	4.2e-74
WP_000064570.1|2784203_2784554_-	hypothetical protein	NA	J7I469	Acinetobacter_phage	89.7	6.4e-53
WP_171278893.1|2784649_2784874_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	97.1	2.8e-30
WP_002040017.1|2784870_2785314_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	86.4	4.4e-67
WP_000539748.1|2785270_2785639_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
WP_000247952.1|2785610_2786015_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_000524213.1|2786023_2786392_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
WP_000008496.1|2786393_2786783_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_000692540.1|2786787_2787453_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000214198.1|2787518_2788475_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000770049.1|2788502_2789270_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_001139861.1|2789383_2789575_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004363.1|2789792_2790035_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_000965231.1|2790133_2790562_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000179763.1|2790570_2791674_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_001286352.1|2791675_2793127_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.6	3.2e-284
WP_000102080.1|2793123_2794551_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_000212566.1|2794540_2795011_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000435252.1|2795069_2795711_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.1	6.7e-125
WP_000378508.1|2795679_2796114_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
WP_001136767.1|2796175_2796631_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.0	1.0e-82
>prophage 6
NC_011586	Acinetobacter baumannii AB0057, complete sequence	4055148	2799937	2816648	4055148	integrase	Acinetobacter_phage(81.48%)	34	2803977:2803991	2819375:2819389
WP_001277128.1|2799937_2800414_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000206497.1|2800410_2800803_-	DUF559 domain-containing protein	NA	A0A1B1P9J0	Acinetobacter_phage	80.8	2.1e-52
WP_001123238.1|2800799_2801111_-	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.1e-59
WP_000356498.1|2801101_2801551_-	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	64.1	3.4e-14
WP_001204257.1|2801554_2801887_-	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_001278405.1|2801879_2802065_-	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_000066269.1|2802130_2802310_-	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_000801877.1|2802302_2802614_-	hypothetical protein	NA	A0A0P0I8J0	Acinetobacter_phage	73.1	1.8e-35
WP_001001967.1|2802610_2802787_-	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	1.7e-17
WP_001068421.1|2802783_2803035_-	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	88.0	5.6e-35
WP_000106165.1|2803031_2804357_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	98.2	1.3e-247
2803977:2803991	attL	GGTCAAATCTTTAGC	NA	NA	NA	NA
WP_000200304.1|2804356_2805100_-	replication protein	NA	A0A0P0HSN8	Acinetobacter_phage	91.6	1.1e-46
WP_001070070.1|2805096_2805270_-	hypothetical protein	NA	A0A0P0J0G1	Acinetobacter_phage	96.5	1.8e-24
WP_000051088.1|2805466_2805733_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	79.5	1.2e-32
WP_001068245.1|2805743_2805974_-	hypothetical protein	NA	A0A1B1P9I7	Acinetobacter_phage	100.0	1.6e-36
WP_000867174.1|2806098_2806845_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	100.0	1.3e-140
WP_000418027.1|2806854_2807064_+	hypothetical protein	NA	A0A1B1P9G7	Acinetobacter_phage	98.5	2.5e-28
WP_000923284.1|2807209_2807719_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	36.5	1.3e-17
WP_000560785.1|2808147_2808363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021797.1|2808565_2808943_+	hypothetical protein	NA	A0A068CDD9	Acinetobacter_phage	38.3	7.7e-12
WP_000991217.1|2808962_2809229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453627.1|2809228_2809519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993522.1|2809528_2810380_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	G8CLD3	Synechococcus_phage	31.6	9.5e-34
WP_001056663.1|2810382_2811279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000839.1|2811283_2811541_+	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	77.5	3.6e-29
WP_000717852.1|2811537_2811801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130804.1|2811812_2812154_+	hypothetical protein	NA	I2GUB3	Acinetobacter_phage	57.3	1.7e-21
WP_000028947.1|2812150_2812360_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
WP_001291999.1|2812356_2812572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123991.1|2812583_2812853_+	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	100.0	4.7e-48
WP_000135937.1|2812849_2813836_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	97.9	2.9e-183
WP_000128669.1|2814133_2815069_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_001010536.1|2815065_2815839_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000110172.1|2815835_2816648_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
2819375:2819389	attR	GCTAAAGATTTGACC	NA	NA	NA	NA
>prophage 7
NC_011586	Acinetobacter baumannii AB0057, complete sequence	4055148	2862591	2877388	4055148		Acinetobacter_phage(100.0%)	10	NA	NA
WP_000566783.1|2862591_2863167_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	4.2e-110
WP_000960544.1|2863262_2865962_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.8	0.0e+00
WP_000281154.1|2866040_2868773_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.7	0.0e+00
WP_001982145.1|2869129_2870179_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608308.1|2870188_2870995_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_000066126.1|2871004_2871700_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164227.1|2871710_2872694_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	99.4	1.0e-188
WP_001076822.1|2872700_2875076_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.7	0.0e+00
WP_000893677.1|2875077_2876577_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.0	1.2e-278
WP_001187843.1|2876839_2877388_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	1.5e-96
>prophage 8
NC_011586	Acinetobacter baumannii AB0057, complete sequence	4055148	3316539	3368438	4055148	integrase,capsid,terminase	Acinetobacter_phage(90.16%)	75	3316351:3316371	3369177:3369197
3316351:3316371	attL	TTCGAGTCCCGCAGGGCGCAC	NA	NA	NA	NA
WP_001127117.1|3316539_3317784_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.5	8.0e-82
WP_000854583.1|3318111_3318516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107290.1|3318556_3319063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091121.1|3319182_3319449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019703.1|3319654_3320197_-	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	88.9	1.2e-90
WP_000433920.1|3320199_3320589_-	hypothetical protein	NA	A0A0D4DBQ9	Acinetobacter_phage	85.3	3.1e-56
WP_000590487.1|3320657_3324104_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	97.7	0.0e+00
WP_000835156.1|3324096_3324459_-	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	2.6e-65
WP_000368384.1|3324455_3324962_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.6	3.8e-91
WP_000277446.1|3324961_3325360_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000046172.1|3325409_3330305_-	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	95.7	0.0e+00
WP_000130334.1|3330365_3330713_-	hypothetical protein	NA	A0A0N7IRG4	Acinetobacter_phage	97.4	1.6e-59
WP_000835375.1|3331043_3332045_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	42.2	6.4e-21
WP_000538615.1|3332041_3332212_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000041780.1|3332327_3332639_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000599538.1|3332652_3333396_-	hypothetical protein	NA	A0A0N7IRG5	Acinetobacter_phage	91.5	5.6e-123
WP_000725052.1|3333457_3333841_-	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	67.7	2.2e-46
WP_000523931.1|3333873_3334197_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001983384.1|3334205_3334382_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	59.6	8.2e-09
WP_000274931.1|3334487_3334946_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000335868.1|3334954_3335254_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_001185578.1|3335756_3336272_-	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	95.9	3.6e-76
WP_000094258.1|3336341_3337259_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	94.4	1.5e-162
WP_001284999.1|3337354_3338452_-	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	41.2	4.2e-74
WP_000064570.1|3338451_3338802_-	hypothetical protein	NA	J7I469	Acinetobacter_phage	89.7	6.4e-53
WP_001277691.1|3338897_3339116_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
WP_002039534.1|3339117_3339561_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	88.4	3.9e-71
WP_000539744.1|3339517_3339886_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	99.2	5.0e-64
WP_000043392.1|3339927_3340458_-	hypothetical protein	NA	A0A0D4DCP9	Acinetobacter_phage	100.0	3.4e-98
WP_000524214.1|3340519_3340888_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	95.9	9.3e-63
WP_000505830.1|3340887_3341268_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	83.3	3.4e-52
WP_000524483.1|3341271_3341628_-	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	83.9	1.0e-42
WP_000502910.1|3341672_3342623_-	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	97.8	1.6e-175
WP_001278744.1|3342636_3343392_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	98.0	3.8e-127
WP_000589034.1|3343500_3343815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291449.1|3343866_3344019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004552.1|3344034_3344265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146968.1|3344261_3345368_-|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	91.0	7.1e-191
WP_000268265.1|3345377_3346718_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	93.8	1.3e-239
WP_001132930.1|3346757_3348050_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000729387.1|3348009_3348525_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000372122.1|3348583_3349225_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	87.8	3.1e-114
WP_000378515.1|3349193_3349661_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	78.1	9.7e-65
WP_000433694.1|3349962_3350445_-	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	73.1	3.1e-66
WP_000020584.1|3350502_3351573_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	32.6	5.9e-33
WP_000091776.1|3351669_3351855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001203942.1|3351854_3352130_-	DUF968 domain-containing protein	NA	A0A0D4DC07	Acinetobacter_phage	69.2	2.7e-30
WP_000994942.1|3352829_3353366_-	hypothetical protein	NA	A0A0D4DCD6	Acinetobacter_phage	96.6	1.0e-94
WP_000837877.1|3353376_3353646_-	hypothetical protein	NA	A0A0D4DC03	Acinetobacter_phage	97.8	5.4e-44
WP_000524894.1|3353656_3354331_-	metallophosphoesterase	NA	A0A1J0MGN8	Acinetobacter_phage	51.0	7.2e-53
WP_000206511.1|3354340_3354766_-	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	97.2	2.7e-74
WP_000360554.1|3354762_3355320_-	hypothetical protein	NA	I2GUD3	Acinetobacter_phage	59.7	2.5e-43
WP_001204261.1|3355390_3355738_-	hypothetical protein	NA	I2GUD2	Acinetobacter_phage	91.1	1.8e-23
WP_001278405.1|3355730_3355916_-	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_000066269.1|3355981_3356161_-	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_000801875.1|3356153_3356519_-	hypothetical protein	NA	A0A1J0MGQ3	Acinetobacter_phage	64.5	1.4e-34
WP_000826377.1|3356515_3357172_-	hypothetical protein	NA	A0A0N7IRF9	Acinetobacter_phage	100.0	2.1e-129
WP_001001967.1|3357168_3357345_-	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	1.7e-17
WP_001068421.1|3357341_3357593_-	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	88.0	5.6e-35
WP_000093310.1|3357589_3358915_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	91.8	9.0e-233
WP_000061204.1|3358914_3359808_-	GntR family transcriptional regulator	NA	A0A068C8G6	Acinetobacter_phage	46.8	3.5e-47
WP_000047869.1|3359804_3359972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000051086.1|3360067_3360334_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	77.3	6.2e-32
WP_001217698.1|3360330_3360507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105769.1|3360634_3361417_+	helix-turn-helix domain-containing protein	NA	J7I4M9	Acinetobacter_phage	77.1	3.7e-101
WP_000370485.1|3361431_3361647_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000065151.1|3361779_3364047_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
WP_001076118.1|3364241_3364433_+	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	65.2	4.1e-14
WP_000380112.1|3364432_3364660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371040.1|3364652_3365414_+	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	52.3	4.2e-57
WP_001056658.1|3365410_3365803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993558.1|3366032_3366971_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	82.3	7.5e-141
WP_000765548.1|3366967_3367627_+	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	59.0	9.8e-79
WP_000130785.1|3367623_3368232_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	57.0	3.6e-43
WP_000028947.1|3368228_3368438_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
3369177:3369197	attR	TTCGAGTCCCGCAGGGCGCAC	NA	NA	NA	NA
