The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011772	Bacillus cereus G9842, complete genome	5387334	249072	257172	5387334		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|249072_249357_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|249396_251031_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_000743914.1|251437_252976_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	6.8e-22
WP_000833086.1|253362_254688_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.1	3.2e-44
WP_000929886.1|254981_255683_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-39
WP_000719237.1|255666_257172_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.3e-30
>prophage 2
NC_011772	Bacillus cereus G9842, complete genome	5387334	296919	305295	5387334		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625687.1|296919_298227_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	1.1e-20
WP_001170545.1|298315_299035_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|299027_299282_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666782.1|299278_299962_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055594.1|299945_302165_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	3.3e-163
WP_000879026.1|302149_303565_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262424.1|303670_304711_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.3	5.5e-68
WP_000088586.1|304707_305295_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	7.0e-28
>prophage 3
NC_011772	Bacillus cereus G9842, complete genome	5387334	1833566	1842424	5387334		Bacillus_phage(71.43%)	8	NA	NA
WP_000755522.1|1833566_1834865_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.5	1.7e-10
WP_001194308.1|1834964_1835729_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453881.1|1835965_1837726_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	99.2	1.5e-275
WP_000612415.1|1837766_1838444_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_001231625.1|1838440_1839514_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	99.2	3.1e-191
WP_000818985.1|1839741_1840461_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_133963882.1|1840563_1841028_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	98.6	1.8e-71
WP_001258545.1|1841554_1842424_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.2	2.8e-65
>prophage 4
NC_011772	Bacillus cereus G9842, complete genome	5387334	1882893	1931175	5387334	terminase,coat,capsid,protease,portal	Clostridium_phage(20.0%)	51	NA	NA
WP_000087513.1|1882893_1883436_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_000866230.1|1883437_1883695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000523694.1|1883718_1885020_+|portal	phage portal protein	portal	A0A060AFC9	Staphylococcus_phage	39.4	8.1e-85
WP_142308479.1|1885003_1886686_+|capsid	phage major capsid protein	capsid	A0A1I9KK60	Lactobacillus_phage	27.5	9.6e-54
WP_000834720.1|1886828_1887137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799108.1|1887366_1887588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000804004.1|1887680_1889186_+	recombinase family protein	NA	I2E8X2	Clostridium_phage	29.3	1.5e-45
WP_000431420.1|1889377_1889890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025994.1|1890104_1891985_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000648324.1|1892100_1892388_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.7	7.6e-12
WP_000099758.1|1892663_1893611_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.1	1.8e-94
WP_001259903.1|1893650_1893959_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000877949.1|1894065_1895001_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001082501.1|1895048_1896224_+	MFS transporter	NA	NA	NA	NA	NA
WP_000162602.1|1896543_1896768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426317.1|1896852_1897200_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001073085.1|1898105_1899155_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000517283.1|1899355_1901338_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	1.5e-29
WP_000539571.1|1901534_1901840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965066.1|1902161_1902527_+	DUF3979 domain-containing protein	NA	NA	NA	NA	NA
WP_000370209.1|1902561_1903602_-	membrane protein	NA	NA	NA	NA	NA
WP_000105199.1|1903843_1904287_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000488205.1|1904389_1904845_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000798311.1|1905059_1906004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594036.1|1906048_1907050_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000683363.1|1907154_1907346_-	DUF3896 domain-containing protein	NA	NA	NA	NA	NA
WP_001168122.1|1907523_1908987_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.7	6.7e-11
WP_001068739.1|1909071_1909656_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000442823.1|1909680_1910583_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000613429.1|1910748_1911699_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001048684.1|1911811_1912282_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001126157.1|1912420_1913371_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001042730.1|1913902_1914562_+	oxidoreductase	NA	NA	NA	NA	NA
WP_001086172.1|1914591_1915629_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_000283913.1|1915762_1916215_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_015945758.1|1916240_1917227_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000824270.1|1917311_1918973_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000943764.1|1919032_1919449_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	2.5e-40
WP_000858837.1|1920021_1920633_+	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000817480.1|1920678_1921239_-	exosporium protein ExsB	NA	NA	NA	NA	NA
WP_000938005.1|1921420_1922497_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000153595.1|1922601_1923219_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000880690.1|1923323_1923926_+	DedA family protein	NA	NA	NA	NA	NA
WP_000678844.1|1924028_1925408_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000932389.1|1925591_1926533_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000418726.1|1926731_1927628_+	permease	NA	NA	NA	NA	NA
WP_000488058.1|1927631_1928501_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000141164.1|1928620_1929127_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000505094.1|1929253_1929340_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000680093.1|1929500_1930685_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_000340541.1|1930716_1931175_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 5
NC_011772	Bacillus cereus G9842, complete genome	5387334	2036663	2043590	5387334		Bacillus_phage(33.33%)	8	NA	NA
WP_000427801.1|2036663_2036939_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_000478850.1|2037137_2037401_+	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	38.9	4.4e-06
WP_000456183.1|2038047_2038395_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.5	6.6e-10
WP_000109862.1|2038585_2039659_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	6.9e-74
WP_000709202.1|2039655_2039781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499693.1|2040077_2040941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165956.1|2041050_2041698_+	HD domain-containing protein	NA	S4W232	Pandoravirus	28.7	5.0e-11
WP_000783164.1|2041694_2043590_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	2.6e-55
>prophage 6
NC_011772	Bacillus cereus G9842, complete genome	5387334	2449441	2541570	5387334	tRNA,tail,transposase,integrase,head,terminase,bacteriocin,capsid,protease,portal,holin	Bacillus_phage(63.04%)	93	2488316:2488353	2550781:2550818
WP_000558610.1|2449441_2450995_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001128402.1|2451054_2451483_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_000285670.1|2451633_2452548_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_000238995.1|2452675_2453383_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025989039.1|2453379_2454363_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000354655.1|2454564_2455461_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	33.7	2.0e-05
WP_000395976.1|2455519_2456509_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002082721.1|2457027_2458656_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	34.3	1.2e-53
WP_000503550.1|2458676_2459270_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000404444.1|2460001_2460772_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	5.2e-31
WP_000144144.1|2460746_2462678_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000975387.1|2462728_2463415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165517.1|2463492_2463834_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_000517058.1|2464110_2465352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701760.1|2465439_2466465_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000471637.1|2466554_2468003_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002082718.1|2468007_2468922_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_000144509.1|2469228_2469918_+	thiaminase II	NA	NA	NA	NA	NA
WP_002082716.1|2470315_2470579_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_001071350.1|2471032_2471344_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002082715.1|2471837_2472323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736198.1|2472629_2473331_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675861.1|2473369_2474479_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.1	6.4e-147
WP_000265314.1|2475023_2476175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000720923.1|2476212_2476359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000491236.1|2476680_2477034_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	86.2	2.1e-48
WP_000973259.1|2477517_2478639_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.7	4.9e-171
WP_000522030.1|2478878_2479145_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	94.1	2.9e-37
WP_001093548.1|2479366_2480431_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.9	8.2e-59
WP_000799078.1|2480434_2480713_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	64.4	3.5e-14
WP_001125977.1|2480705_2481065_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	56.0	2.9e-32
WP_000806866.1|2481084_2481249_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	53.7	3.1e-10
WP_001272173.1|2481274_2481748_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	49.2	4.1e-10
WP_041488122.1|2481768_2482284_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	41.7	1.8e-27
WP_000679229.1|2482287_2482764_+	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	66.9	1.7e-61
WP_000973259.1|2483189_2484311_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.7	4.9e-171
WP_000456897.1|2484440_2485043_+	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	43.6	6.1e-43
WP_001163834.1|2485670_2486243_-	cupin domain-containing protein	NA	Q2Q459	Bacillus_phage	85.8	4.3e-91
WP_000973259.1|2486501_2487623_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.7	4.9e-171
2488316:2488353	attL	AGAATATAGTCCGGCTAGAAAACTAGAGGACACCAATT	NA	NA	NA	NA
WP_000166176.1|2488621_2489104_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.8	6.5e-72
WP_001012121.1|2489103_2489646_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	2.1e-87
WP_000069269.1|2489900_2490527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272764.1|2490953_2491709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357601.1|2492101_2492416_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	48.4	1.2e-15
WP_000773593.1|2492412_2492628_+	hypothetical protein	NA	B5LPQ8	Bacillus_virus	90.1	1.1e-28
WP_000333450.1|2492762_2493191_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	78.5	1.9e-54
WP_000575247.1|2493187_2493523_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	94.5	5.0e-55
WP_000382046.1|2493525_2493738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000635290.1|2494208_2495864_+|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	95.5	2.7e-311
WP_000583777.1|2495869_2497033_+|portal	phage portal protein	portal	D2XR16	Bacillus_phage	89.0	6.8e-184
WP_000216410.1|2497016_2497799_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	52.8	1.9e-57
WP_000234868.1|2497802_2498957_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	90.1	5.7e-199
WP_000381900.1|2498962_2499256_+	hypothetical protein	NA	D2XR19	Bacillus_phage	94.8	1.8e-45
WP_001247283.1|2499257_2499611_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	95.7	1.5e-57
WP_000997568.1|2499612_2499954_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	92.0	2.0e-51
WP_000172071.1|2499953_2500283_+	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	3.6e-50
WP_001004914.1|2500283_2500871_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.0	3.3e-86
WP_000415920.1|2500875_2501238_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	89.2	3.7e-56
WP_000918798.1|2501468_2502680_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.1	2.2e-185
WP_015945795.1|2502933_2503191_+	hypothetical protein	NA	A0A1B1P763	Bacillus_phage	84.7	2.2e-34
WP_000180077.1|2503408_2505574_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	81.8	6.7e-92
WP_000093926.1|2505615_2507091_+|tail	phage tail protein	tail	A0A1Z1LZM7	Bacillus_phage	56.2	4.5e-164
WP_001275796.1|2507087_2511722_+	peptidase S74	NA	D2XR28	Bacillus_phage	58.4	0.0e+00
WP_000373890.1|2511761_2512187_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	92.9	6.5e-68
WP_000405807.1|2512186_2513122_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	93.6	3.8e-177
WP_001294984.1|2513401_2514103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795509.1|2514228_2515086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000626096.1|2515457_2517140_+	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_015945798.1|2517347_2518115_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_000905580.1|2518259_2518676_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878369.1|2518798_2519002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416836.1|2519330_2519543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565701.1|2519752_2520757_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282691.1|2520903_2521308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062093.1|2521468_2522704_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000106407.1|2522970_2524254_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069207.1|2524243_2524876_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2524946_2525102_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289121.1|2525204_2525702_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168021.1|2525842_2527057_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954440.1|2527165_2527744_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_000766389.1|2527918_2528770_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001088545.1|2529192_2530980_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000743784.1|2531214_2533341_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_002162782.1|2533417_2533948_+	signal peptidase I	NA	NA	NA	NA	NA
WP_000932152.1|2534207_2535395_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.3	4.0e-06
WP_000864388.1|2535486_2536167_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038209.1|2536576_2537125_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001182503.1|2537135_2538836_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	4.7e-16
WP_000556365.1|2538828_2539629_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2539765_2539873_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_015945799.1|2539973_2541233_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.2e-24
WP_001074707.1|2541357_2541570_-|transposase	transposase	transposase	A0A0U3U8Y8	Bacillus_phage	75.0	1.8e-18
2550781:2550818	attR	AGAATATAGTCCGGCTAGAAAACTAGAGGACACCAATT	NA	NA	NA	NA
>prophage 7
NC_011772	Bacillus cereus G9842, complete genome	5387334	2753634	2760620	5387334		Bacillus_phage(100.0%)	11	NA	NA
WP_001268070.1|2753634_2755074_-	recombinase family protein	NA	Q2LIA5	Bacillus_phage	59.6	3.6e-158
WP_000200735.1|2755373_2755589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050810.1|2755608_2755788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079997175.1|2756028_2756652_-	hypothetical protein	NA	H0USY2	Bacillus_phage	79.9	6.6e-93
WP_000891525.1|2756593_2757778_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	63.9	3.9e-142
WP_000170793.1|2757893_2758076_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	83.3	4.8e-20
WP_001267621.1|2758072_2758375_-	hypothetical protein	NA	H0USY0	Bacillus_phage	57.0	6.8e-27
WP_000669090.1|2758833_2759034_+	helix-turn-helix domain-containing protein	NA	Q2I8E4	Bacillus_phage	51.5	4.1e-12
WP_001169626.1|2759670_2759793_-	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	59.5	2.4e-07
WP_001999824.1|2759947_2760214_+	helix-turn-helix transcriptional regulator	NA	A0A288WFZ7	Bacillus_phage	61.8	4.1e-20
WP_000448283.1|2760290_2760620_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	46.8	1.9e-19
>prophage 8
NC_011772	Bacillus cereus G9842, complete genome	5387334	2763862	2806448	5387334	coat,portal,tail,terminase	Bacillus_phage(75.0%)	43	NA	NA
WP_000753420.1|2763862_2764927_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	96.6	4.3e-201
WP_000461720.1|2764923_2765163_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	97.5	3.5e-34
WP_000398728.1|2765162_2765399_-	hypothetical protein	NA	A0A0A7AQY5	Bacillus_phage	97.4	2.5e-08
WP_001260211.1|2765437_2770012_-	hypothetical protein	NA	I7ILV8	Bacillus_phage	50.2	0.0e+00
WP_000959911.1|2770008_2771508_-|tail	phage tail protein	tail	A0A0A7AQV1	Bacillus_phage	50.0	1.4e-128
WP_015945817.1|2771522_2775416_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	47.6	9.4e-12
WP_000931846.1|2775452_2775707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818630.1|2775796_2776174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777416.1|2776244_2776463_-	hypothetical protein	NA	A0A288WG47	Bacillus_phage	62.0	1.6e-14
WP_000355284.1|2776459_2776801_-	hypothetical protein	NA	A0A1B1P7D1	Bacillus_phage	61.5	2.8e-05
WP_000852560.1|2776851_2777355_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_000930923.1|2777368_2777776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001222699.1|2777778_2778138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000954645.1|2778137_2778512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016918.1|2778515_2779322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868480.1|2779326_2779668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001007960.1|2779696_2779921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141526684.1|2779971_2780364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145079.1|2780504_2781629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041488125.1|2781689_2782475_-	scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	39.1	2.8e-08
WP_001265881.1|2782533_2784051_-|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.4	2.3e-67
WP_000323339.1|2784067_2785783_-|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.2	4.5e-168
WP_001086032.1|2785799_2786228_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.2e-32
WP_000216931.1|2786296_2786611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184529.1|2786725_2787019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196740.1|2787805_2788186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000282650.1|2788677_2789082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180533.1|2789441_2790209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106359.1|2790374_2790557_-	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	64.0	1.7e-12
WP_000172502.1|2790680_2791406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141526683.1|2791415_2791610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843023.1|2791806_2792088_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.4	3.4e-12
WP_000790089.1|2792214_2792361_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_000805620.1|2793232_2793550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015945822.1|2796354_2797197_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001037228.1|2797386_2798763_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.1	2.5e-15
WP_000865984.1|2798755_2799403_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	2.2e-35
WP_000591758.1|2799524_2799941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001079713.1|2800615_2802016_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_000372659.1|2802033_2802783_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_001155362.1|2802795_2804385_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_000538300.1|2804674_2805535_-	DegV family protein	NA	NA	NA	NA	NA
WP_000415813.1|2805995_2806448_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 9
NC_011772	Bacillus cereus G9842, complete genome	5387334	3624093	3633392	5387334	bacteriocin	Bacillus_phage(40.0%)	13	NA	NA
WP_000413739.1|3624093_3624714_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976234.1|3624804_3625608_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031383.1|3625608_3626151_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3626143_3626467_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392443.1|3626838_3627069_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	77.6	1.7e-25
WP_001051370.1|3627130_3627973_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	1.4e-32
WP_000981478.1|3628096_3629086_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.3	1.7e-34
WP_000464422.1|3629320_3629707_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	67.5	2.7e-44
WP_000511422.1|3630115_3631003_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	64.6	1.0e-94
WP_001189066.1|3631155_3631350_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	72.6	2.6e-16
WP_000531298.1|3631361_3632120_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	70.2	4.1e-97
WP_000283430.1|3632316_3632529_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_000708856.1|3632732_3633392_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
>prophage 10
NC_011772	Bacillus cereus G9842, complete genome	5387334	3687326	3807318	5387334	tRNA,tail,head,integrase,coat,terminase,bacteriocin,capsid,protease,portal,holin	Bacillus_phage(47.06%)	113	3693983:3693999	3812587:3812603
WP_000878483.1|3687326_3687683_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000454959.1|3687716_3689150_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000006462.1|3689336_3689528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000351405.1|3689543_3689753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008148.1|3690041_3691757_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.2	2.5e-09
WP_001244684.1|3691956_3692937_-	phosphatidylinositol diacylglycerol-lyase	NA	NA	NA	NA	NA
WP_000689210.1|3693116_3694958_-	peptidase	NA	NA	NA	NA	NA
3693983:3693999	attL	CAGCACGAATTGCATCA	NA	NA	NA	NA
WP_000771008.1|3695252_3696050_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	39.4	2.8e-35
WP_000272409.1|3696315_3697653_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000791036.1|3698157_3700077_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	36.8	3.4e-95
WP_001235296.1|3700174_3702958_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000461138.1|3703462_3703648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516486.1|3703925_3705869_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	1.9e-61
WP_000195991.1|3705877_3708556_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	24.2	2.3e-33
WP_001288799.1|3708736_3709279_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870460.1|3709405_3709837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005392.1|3709840_3711370_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190155.1|3711798_3712665_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3712651_3714409_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_141526697.1|3714634_3715594_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3715616_3715877_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221092.1|3716026_3716821_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000099770.1|3716979_3718545_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001283853.1|3719028_3720060_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	71.5	3.2e-137
WP_000990683.1|3720204_3721443_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_001052967.1|3721463_3722042_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137465.1|3722107_3723022_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3723043_3723829_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114444.1|3723967_3724216_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759625.1|3724291_3725005_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411972.1|3725105_3726392_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.4	3.8e-10
WP_000772416.1|3726392_3727667_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.3	1.6e-56
WP_000008857.1|3727876_3728836_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085255.1|3728836_3729895_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456928.1|3729887_3731420_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	1.1e-11
WP_000725767.1|3731537_3732614_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	33.6	5.6e-47
WP_000114182.1|3732706_3733432_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118795.1|3733969_3736351_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605034.1|3736563_3736767_-	ribonuclease	NA	NA	NA	NA	NA
WP_000139825.1|3736763_3737513_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823089.1|3737617_3739288_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564763.1|3740214_3741093_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692456.1|3741104_3742337_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3742360_3743407_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_085964469.1|3743557_3743794_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_000612422.1|3744142_3744670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000644995.1|3744700_3745885_+	DUF3994 domain-containing protein	NA	NA	NA	NA	NA
WP_000791286.1|3745966_3746707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000722940.1|3747227_3747734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540631.1|3747935_3748745_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	83.3	1.2e-134
WP_001261076.1|3748744_3748981_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	100.0	1.7e-25
WP_001075307.1|3749011_3749377_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	69.7	2.8e-43
WP_001260220.1|3749398_3753718_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	62.8	0.0e+00
WP_000094136.1|3753714_3755184_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	77.9	1.5e-228
WP_000566750.1|3755225_3757643_-|tail	phage tail tape measure protein	tail	A0A2H4JC82	uncultured_Caudovirales_phage	87.6	3.6e-155
WP_000897027.1|3757897_3759112_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	89.5	6.0e-191
WP_000415912.1|3759344_3759707_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.4e-42
WP_001004907.1|3759711_3760299_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_000176452.1|3760299_3760635_-	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	7.5e-51
WP_000064421.1|3760631_3760976_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	78.8	1.8e-44
WP_001247295.1|3760977_3761331_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	92.2	1.3e-56
WP_000450783.1|3761332_3761626_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	87.6	3.8e-43
WP_000234874.1|3761631_3762783_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	95.6	5.7e-207
WP_041488173.1|3762786_3763527_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	83.8	5.1e-108
WP_000256286.1|3763526_3764672_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.9	6.3e-182
WP_000621034.1|3764680_3766348_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	90.5	2.9e-305
WP_000301142.1|3766344_3766656_-|terminase	terminase	terminase	D2XR14	Bacillus_phage	98.1	7.9e-47
WP_001008148.1|3766779_3767115_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	87.4	1.5e-51
WP_000564708.1|3767293_3767527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000862444.1|3767620_3768418_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_000390547.1|3768889_3769603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000434821.1|3770211_3770412_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	2.4e-20
WP_001012173.1|3770533_3771076_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	3.3e-88
WP_000068015.1|3771075_3771540_-	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	92.9	1.1e-73
WP_015945881.1|3771823_3772132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141526706.1|3772239_3772434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281634.1|3773266_3773545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000604163.1|3774629_3775037_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_000512845.1|3775145_3775337_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	61.9	4.1e-14
WP_001125996.1|3775409_3775772_-	hypothetical protein	NA	D2XR47	Bacillus_phage	90.8	2.2e-56
WP_000926798.1|3775746_3775935_-	hypothetical protein	NA	D2XR45	Bacillus_phage	85.5	9.7e-16
WP_000063904.1|3775937_3777260_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.5	2.5e-235
WP_000312136.1|3777256_3778207_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	60.2	3.0e-73
WP_000998370.1|3778486_3778771_-	hypothetical protein	NA	D2XR42	Bacillus_phage	55.3	1.1e-23
WP_000652091.1|3778959_3779184_+	hypothetical protein	NA	Q9T1I9	Lactobacillus_phage	63.2	6.8e-16
WP_000832648.1|3779175_3779385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215318.1|3779570_3779792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537273.1|3779805_3780393_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.2	4.9e-74
WP_002082295.1|3780483_3780732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038781.1|3780784_3780973_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	55.9	4.2e-11
WP_000946009.1|3781128_3781563_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	53.2	1.2e-29
WP_000693586.1|3781575_3782004_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	81.0	7.1e-62
WP_000688335.1|3782046_3783096_+	hypothetical protein	NA	A0A1C8E993	Bacillus_phage	68.8	3.0e-53
WP_000435192.1|3783164_3783968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844790.1|3784043_3785591_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	7.8e-143
WP_000954735.1|3786045_3786948_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239759.1|3787118_3787370_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000593001.1|3787505_3788747_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_000868226.1|3788834_3789734_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076744.1|3789886_3792025_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3792185_3792455_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766703.1|3792555_3793527_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.8	2.1e-05
WP_000399364.1|3793570_3794494_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3794580_3794937_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000634349.1|3794952_3795234_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036346.1|3795230_3797297_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	1.9e-19
WP_001286522.1|3797301_3797613_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071123.1|3797613_3797886_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102598.1|3797897_3799004_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359095.1|3799021_3799492_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000059996.1|3799825_3804127_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000814295.1|3804251_3805952_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090241.1|3806061_3807318_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
3812587:3812603	attR	CAGCACGAATTGCATCA	NA	NA	NA	NA
>prophage 11
NC_011772	Bacillus cereus G9842, complete genome	5387334	4467331	4475019	5387334		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221121.1|4467331_4468255_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.6e-45
WP_000247674.1|4468380_4469316_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.4e-24
WP_000018046.1|4469317_4470010_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	26.9	6.8e-06
WP_001014310.1|4470354_4470549_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255945.1|4470588_4471788_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	6.1e-71
WP_000587818.1|4472082_4472406_+	heme oxygenase	NA	NA	NA	NA	NA
WP_002162479.1|4472478_4473243_-	class B sortase	NA	NA	NA	NA	NA
WP_000403765.1|4473275_4474046_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.7e-13
WP_001036829.1|4474035_4475019_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.9e-17
