The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011386	Oligotropha carboxidovorans OM5, complete sequence	3745629	478039	485111	3745629		Caulobacter_phage(16.67%)	7	NA	NA
WP_012561664.1|478039_478498_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	64.8	1.8e-47
WP_012561665.1|478494_479919_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.6e-39
WP_013912700.1|479978_481538_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	26.1	1.8e-22
WP_012561667.1|481549_482314_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_012561668.1|482390_483275_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	27.3	4.0e-19
WP_012561669.1|483287_484088_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	27.6	1.0e-05
WP_012561670.1|484109_485111_-	D-glycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.6	5.9e-19
>prophage 2
NC_011386	Oligotropha carboxidovorans OM5, complete sequence	3745629	786169	823001	3745629	tail,portal,head,terminase,capsid	Acidithiobacillus_phage(33.33%)	46	NA	NA
WP_012561969.1|786169_787015_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	49.3	4.6e-65
WP_012561970.1|787050_787773_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	38.2	1.3e-20
WP_012561971.1|787785_788019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013913379.1|788015_788360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561973.1|788368_789241_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	53.9	4.6e-68
WP_012561974.1|789252_791799_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	36.9	2.9e-70
WP_012561975.1|791875_792259_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_013913378.1|792279_792543_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_012561977.1|792578_792827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561978.1|793159_793696_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	61.0	9.8e-45
WP_013913377.1|793692_794010_+	hypothetical protein	NA	F8TUR0	EBPR_podovirus	39.2	7.9e-10
WP_012561980.1|794006_794222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561981.1|794218_794770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013913376.1|794806_795007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561983.1|795167_795524_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012561984.1|795532_795814_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012561986.1|796162_797530_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	38.0	1.8e-74
WP_012561987.1|797531_798608_+	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	44.3	2.4e-34
WP_012561988.1|798625_798856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013913375.1|798981_799701_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	55.0	5.1e-12
WP_012561990.1|799805_800024_-	hypothetical protein	NA	A0A0K0PVN5	Roseobacter_phage	51.5	1.8e-13
WP_013913374.1|800212_800797_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	42.7	1.0e-23
WP_012561992.1|800789_802763_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	57.7	1.4e-213
WP_012561993.1|802766_802979_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	52.9	2.9e-08
WP_012561994.1|802979_804455_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	71.9	1.3e-192
WP_013913373.1|804447_805752_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	49.3	3.3e-86
WP_012561996.1|805780_806170_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	54.8	7.4e-26
WP_012561997.1|806250_807273_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	58.1	2.9e-106
WP_013913372.1|807279_807600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561999.1|807604_808261_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	43.6	1.0e-35
WP_012562000.1|808343_808775_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	43.0	1.2e-21
WP_012562001.1|808805_809747_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	51.3	3.9e-81
WP_012562002.1|809747_810101_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013913371.1|810076_810352_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_012562004.1|810445_810799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162096602.1|810948_811101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562006.1|811129_813862_+|tail	phage tail protein	tail	K4I464	Providencia_phage	48.6	2.7e-05
WP_012562007.1|813858_814446_+	DUF2460 domain-containing protein	NA	A0A1W6DWM9	Sphingobium_phage	45.2	1.6e-35
WP_012562008.1|814449_815289_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	39.2	9.6e-55
WP_013913370.1|815288_815804_+	peptidase P60	NA	A0A0B5A615	Paracoccus_phage	33.6	7.0e-16
WP_012562010.1|815806_816439_+	hypothetical protein	NA	M4QNR6	Tetraselmis_viridis_virus	38.7	5.4e-26
WP_012562011.1|816442_820270_+	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A1V0DY94	Dinoroseobacter_phage	27.2	3.1e-140
WP_012562012.1|820298_821369_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	37.4	6.3e-51
WP_012562013.1|821386_821677_+	hypothetical protein	NA	V9QL93	Rhizobium_phage	38.4	3.0e-08
WP_012562014.1|821767_822502_+	secretion activator protein	NA	A0A223W052	Agrobacterium_phage	60.3	9.3e-54
WP_012562015.1|822494_823001_+	hypothetical protein	NA	A0A1Y0SY13	Sinorhizobium_phage	43.0	6.0e-28
>prophage 3
NC_011386	Oligotropha carboxidovorans OM5, complete sequence	3745629	1494963	1558937	3745629	tail,integrase,tRNA,head,protease,terminase,capsid,plate	Aurantimonas_phage(20.0%)	84	1487951:1487978	1566804:1566831
1487951:1487978	attL	TTCACCTCTCCCCAACGGGGAGAGGGAG	NA	NA	NA	NA
WP_012562690.1|1494963_1496178_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_148261430.1|1496446_1496746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012562693.1|1496932_1497349_-	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	53.3	2.0e-16
WP_013913228.1|1497345_1497648_-	DUF4326 domain-containing protein	NA	A0A2P1CHK0	Mycobacterium_phage	47.5	1.4e-19
WP_013913227.1|1497644_1498331_-	hypothetical protein	NA	A0A068CCC0	Rhizobium_phage	41.6	9.4e-24
WP_012562697.1|1498327_1499251_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	53.4	7.5e-85
WP_013913226.1|1499250_1499676_-	hypothetical protein	NA	K4F726	Cronobacter_phage	37.0	1.7e-15
WP_012562699.1|1499675_1500161_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	60.1	1.3e-48
WP_012562700.1|1500162_1500930_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	49.3	8.6e-34
WP_012562701.1|1500933_1502319_-	recombinase RecT	NA	I6WAZ3	Burkholderia_virus	37.2	1.4e-31
WP_012562702.1|1502345_1503080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012562703.1|1503150_1504086_-	YqaJ viral recombinase family protein	NA	NA	NA	NA	NA
WP_012562704.1|1504082_1504370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012562705.1|1504443_1504737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013913225.1|1504729_1504933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012562706.1|1504929_1505292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012562707.1|1505291_1505507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013913224.1|1505506_1505863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013913223.1|1506122_1506551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013913222.1|1506559_1507264_-	hypothetical protein	NA	A0A1X9HW95	Ruegeria_phage	31.2	4.5e-13
WP_012562711.1|1507342_1507597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562712.1|1507665_1508238_+	cell division protein	NA	NA	NA	NA	NA
WP_012562713.1|1508304_1508541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562714.1|1508597_1508960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562715.1|1509038_1509563_+	Holliday junction DNA helicase	NA	NA	NA	NA	NA
WP_012562716.1|1509562_1512133_+	DNA methylase N-4	NA	R9TRS8	Rhizobium_phage	58.2	5.5e-303
WP_012562717.1|1512132_1512411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013913221.1|1512413_1514147_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012562719.1|1514146_1514365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562720.1|1514361_1514778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562721.1|1514789_1516493_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012562722.1|1516489_1516927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013913220.1|1516919_1517288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562724.1|1517284_1518127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562725.1|1518123_1520382_+	DNA cytosine methyltransferase	NA	A0A1X9HVK8	Ruegeria_phage	42.7	4.8e-125
WP_012562726.1|1520378_1521059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041559564.1|1521048_1521372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013913219.1|1521352_1522225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041559565.1|1522424_1522652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013913218.1|1522648_1523200_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_041559566.1|1523196_1523535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562730.1|1523539_1523710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562731.1|1523710_1524199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562732.1|1524208_1524448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013913216.1|1524447_1524684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012562734.1|1525187_1525721_+	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	42.3	1.1e-27
WP_013913215.1|1525876_1526521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148261450.1|1526528_1528370_+|terminase	phage terminase large subunit family protein	terminase	A2I2W6	Vibrio_virus	39.5	1.3e-104
WP_012562739.1|1530001_1530256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562740.1|1530268_1531567_+	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	40.2	1.6e-45
WP_012562741.1|1531614_1532289_+|head	head decoration protein	head	NA	NA	NA	NA
WP_012562742.1|1532366_1533386_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	40.5	3.0e-58
WP_041559567.1|1533405_1533804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013913212.1|1533887_1534610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562744.1|1534614_1535247_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_012562745.1|1535246_1535669_+	GPW/gp25 family protein	NA	A0A219VH96	Ochrobactrum_phage	34.2	2.3e-12
WP_012562746.1|1535665_1536565_+|plate	baseplate J/gp47 family protein	plate	A0A0A8IKZ9	Aurantimonas_phage	56.9	7.3e-77
WP_012562747.1|1536561_1537182_+|tail	phage tail protein I	tail	A0A0A8IL57	Aurantimonas_phage	54.7	4.9e-48
WP_012562748.1|1537190_1539461_+	hypothetical protein	NA	A0A0A8ILB4	Aurantimonas_phage	46.8	7.5e-187
WP_012562749.1|1539471_1539642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562750.1|1539654_1540632_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	42.9	1.9e-09
WP_012562751.1|1540642_1541266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562752.1|1541341_1542607_+|tail	tail protein	tail	A0A0A8IL59	Aurantimonas_phage	34.0	5.5e-54
WP_012562753.1|1542656_1543190_+|tail	tail protein	tail	NA	NA	NA	NA
WP_012562754.1|1543214_1543613_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012562755.1|1543709_1545875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562756.1|1545881_1546304_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012562757.1|1546300_1546522_+|tail	tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	46.7	1.3e-06
WP_012562758.1|1546526_1547567_+	late control protein D	NA	NA	NA	NA	NA
WP_012562759.1|1547621_1548419_+	glycosyl hydrolase	NA	A0A291AUN6	Sinorhizobium_phage	39.5	1.2e-11
WP_012562760.1|1548415_1548580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562761.1|1548576_1548768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013913211.1|1548764_1549169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562763.1|1549165_1549600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562764.1|1549583_1549886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562765.1|1549921_1550503_+	TIGR02594 family protein	NA	A0A1X9SGQ2	Bradyrhizobium_phage	46.9	1.2e-11
WP_013913210.1|1550630_1551056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013913209.1|1551264_1551834_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_042200972.1|1552378_1553128_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012562769.1|1553294_1553723_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012562770.1|1553790_1554834_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_012562772.1|1555052_1556114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012562773.1|1556196_1556760_-	nitroreductase	NA	NA	NA	NA	NA
WP_012562775.1|1556894_1558937_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	5.3e-123
1566804:1566831	attR	TTCACCTCTCCCCAACGGGGAGAGGGAG	NA	NA	NA	NA
>prophage 5
NC_011386	Oligotropha carboxidovorans OM5, complete sequence	3745629	2170984	2187059	3745629	tRNA	uncultured_Mediterranean_phage(55.56%)	13	NA	NA
WP_012563363.1|2170984_2172400_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	2.3e-08
WP_012563364.1|2172650_2173631_-	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	50.2	4.9e-74
WP_013913075.1|2173828_2174074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012563366.1|2174070_2175204_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.6	1.2e-87
WP_012563367.1|2175200_2176286_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_012563368.1|2176401_2176866_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	51.9	3.0e-34
WP_013913074.1|2176926_2177469_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	49.7	1.3e-36
WP_012563370.1|2177564_2178062_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.8	1.2e-25
WP_012563371.1|2178231_2178507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012563372.1|2178510_2181228_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.9	1.2e-103
WP_012563373.1|2181510_2182134_+	MarC family protein	NA	NA	NA	NA	NA
WP_012563374.1|2182154_2182637_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	69.2	3.7e-43
WP_012563377.1|2184080_2187059_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	63.7	0.0e+00
>prophage 6
NC_011386	Oligotropha carboxidovorans OM5, complete sequence	3745629	2203575	2210411	3745629	tRNA	uncultured_Mediterranean_phage(83.33%)	8	NA	NA
WP_012563399.1|2203575_2204904_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	42.7	7.9e-19
WP_012563400.1|2205090_2205744_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.2	3.9e-27
WP_012563401.1|2205906_2206284_+	response regulator	NA	NA	NA	NA	NA
WP_012563402.1|2206311_2207088_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	36.1	4.9e-37
WP_012563403.1|2207211_2208531_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	1.1e-102
WP_012563404.1|2208767_2209616_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.6	4.2e-50
WP_012563405.1|2209612_2210122_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_012563406.1|2210174_2210411_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	59.3	1.2e-07
>prophage 7
NC_011386	Oligotropha carboxidovorans OM5, complete sequence	3745629	2234840	2243315	3745629		Burkholderia_phage(28.57%)	10	NA	NA
WP_012563430.1|2234840_2235401_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	28.2	8.2e-10
WP_012563431.1|2235833_2237117_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	62.0	1.0e-140
WP_012563432.1|2237269_2237746_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	53.8	6.9e-26
WP_012563433.1|2237752_2238022_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.6	4.8e-16
WP_012563434.1|2237981_2238251_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	52.3	2.5e-17
WP_012563435.1|2238342_2239182_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.3	2.3e-48
WP_012563436.1|2239440_2240349_-	VOC family protein	NA	NA	NA	NA	NA
WP_012563437.1|2240345_2240678_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_012563438.1|2240783_2241605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012563439.1|2241686_2243315_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.0	3.7e-151
>prophage 8
NC_011386	Oligotropha carboxidovorans OM5, complete sequence	3745629	2483439	2540554	3745629	tail,head,tRNA,protease	Rhodobacter_phage(28.57%)	52	NA	NA
WP_013913018.1|2483439_2483952_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_012563683.1|2483952_2484951_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_013913017.1|2485063_2485528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012563685.1|2485807_2486164_+	YbaN family protein	NA	NA	NA	NA	NA
WP_012563686.1|2486330_2487023_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012563687.1|2487151_2487697_+	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_012563688.1|2487882_2489157_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_012563689.1|2489230_2490976_-	oxalyl-CoA decarboxylase	NA	E5EQ70	Micromonas_sp._RCC1109_virus	22.1	5.5e-20
WP_012563690.1|2491645_2492950_+	oxalate/formate MFS antiporter	NA	NA	NA	NA	NA
WP_012563691.1|2493283_2495416_+	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_012563692.1|2495428_2496625_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_012563693.1|2496629_2497538_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_013913016.1|2497707_2498436_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012563695.1|2498710_2499484_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012563696.1|2499520_2500930_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_012563697.1|2501085_2502105_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_012563698.1|2502169_2503060_-	2-hydroxy-3-oxopropionate reductase	NA	E3SPS4	Prochlorococcus_phage	28.8	3.4e-10
WP_013913015.1|2503099_2503870_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_012563700.1|2503924_2505718_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.7	4.2e-39
WP_012563701.1|2506006_2506831_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012563702.1|2506930_2507284_+	GFA family protein	NA	NA	NA	NA	NA
WP_012563703.1|2507472_2508354_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	34.3	2.1e-12
WP_012563704.1|2508355_2509528_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_012563707.1|2512344_2515311_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_012563708.1|2515307_2516717_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_041559586.1|2516700_2517420_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012563710.1|2517559_2519146_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	7.0e-22
WP_012563711.1|2519308_2519875_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012563712.1|2519957_2521943_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_013913013.1|2521939_2522434_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_012563714.1|2522493_2523594_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_012563715.1|2523704_2525087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012563716.1|2525215_2526598_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012563717.1|2526587_2527262_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012563718.1|2527410_2527716_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_012563719.1|2527874_2528126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012563720.1|2528127_2528520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012563721.1|2528539_2528788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012563722.1|2528852_2529383_-	lysozyme	NA	A0A088FRS5	Escherichia_phage	40.4	1.8e-22
WP_013913012.1|2529487_2530159_+	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	45.9	3.0e-06
WP_012563724.1|2530199_2531669_-	DUF2793 domain-containing protein	NA	A0A0K1LM54	Rhodobacter_phage	39.2	3.4e-39
WP_012563725.1|2531675_2535545_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0K1LL82	Rhodobacter_phage	41.1	8.5e-223
WP_012563726.1|2535544_2535988_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	51.5	5.5e-33
WP_012563727.1|2535996_2536887_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	41.2	2.5e-61
WP_012563728.1|2536883_2537525_-	DUF2460 domain-containing protein	NA	A0A0K1LLZ8	Rhodobacter_phage	51.8	1.4e-50
WP_012563729.1|2537641_2538232_-|tail	phage tail tape measure protein	tail	C0LP53	Escherichia_virus	30.7	2.7e-11
WP_012563730.1|2538228_2538432_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_012563731.1|2538428_2538773_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_012563732.1|2538782_2539190_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_012563733.1|2539223_2539634_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012563734.1|2539667_2539988_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_012563735.1|2539984_2540554_-|head,tail	phage head-tail connector protein	head,tail	I3UM02	Rhodobacter_phage	32.4	8.9e-12
