The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011773	Bacillus cereus AH820, complete genome	5302683	259149	267098	5302683		uncultured_virus(33.33%)	6	NA	NA
WP_000917306.1|259149_259434_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
WP_001029999.1|259472_261107_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000743900.1|261514_263053_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_000833104.1|263436_264762_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	1.2e-43
WP_000929888.1|264907_265609_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000719215.1|265592_267098_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.2e-31
>prophage 2
NC_011773	Bacillus cereus AH820, complete genome	5302683	304940	313317	5302683		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625683.1|304940_306248_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170542.1|306336_307056_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278820.1|307048_307303_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666779.1|307299_307983_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|307966_310186_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|310170_311586_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262436.1|311692_312733_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000088592.1|312729_313317_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
>prophage 3
NC_011773	Bacillus cereus AH820, complete genome	5302683	493769	565745	5302683	terminase,protease,tail,integrase,tRNA,portal,capsid,transposase,plate	Bacillus_phage(80.0%)	79	519229:519247	572578:572596
WP_113712782.1|493769_494675_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.3	2.0e-26
WP_000506628.1|494897_495428_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_001161615.1|495482_497243_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.8e-56
WP_000765785.1|497256_498345_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_000932986.1|498605_503042_-	glutamate synthase	NA	NA	NA	NA	NA
WP_000260528.1|503241_504546_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
WP_000843645.1|504667_505681_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	5.8e-22
WP_000521523.1|505673_506465_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000639352.1|506469_507255_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964357.1|507327_507732_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000259041.1|507776_508232_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002002038.1|508524_508959_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_000025061.1|509157_509514_-	YgzB family protein	NA	NA	NA	NA	NA
WP_000149822.1|516319_516640_-	DUF3884 family protein	NA	NA	NA	NA	NA
WP_000532948.1|516992_517712_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000400446.1|517862_518324_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000664707.1|518810_519587_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
519229:519247	attL	GTACATTTACAAAGGATGA	NA	NA	NA	NA
WP_000842723.1|519774_520428_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000345218.1|520815_521958_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000260551.1|522002_522890_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_000538147.1|522948_523437_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_000664304.1|523564_525634_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000353280.1|526038_527934_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.2	9.0e-101
WP_000503509.1|528379_529480_+	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.1	8.3e-22
WP_000286207.1|529464_531015_-	recombinase	NA	D2XR37	Bacillus_phage	99.5	1.4e-253
WP_000377559.1|531176_531356_+	hypothetical protein	NA	D2XR40	Bacillus_phage	75.0	1.3e-17
WP_000351739.1|531352_531787_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	97.9	3.3e-75
WP_000853781.1|531805_532267_-	XRE family transcriptional regulator	NA	D2XR39	Bacillus_phage	55.4	2.5e-28
WP_001101797.1|532400_532586_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000115363.1|532629_532839_+	hypothetical protein	NA	D2XR40	Bacillus_phage	91.2	4.7e-27
WP_000537288.1|532880_533468_+	hypothetical protein	NA	D2XR41	Bacillus_phage	92.8	6.9e-100
WP_000215303.1|533480_533702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857130.1|533886_534171_+	hypothetical protein	NA	D2XR42	Bacillus_phage	83.0	6.1e-38
WP_000312144.1|534452_535382_+	DnaD domain protein	NA	D2XR43	Bacillus_phage	92.6	1.3e-153
WP_000063898.1|535378_536701_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	99.1	1.8e-244
WP_000926803.1|536703_536892_+	hypothetical protein	NA	D2XR45	Bacillus_phage	100.0	6.7e-25
WP_000604169.1|536866_537136_+	hypothetical protein	NA	D2XR46	Bacillus_phage	100.0	8.9e-47
WP_000549518.1|537128_537491_+	hypothetical protein	NA	D2XR47	Bacillus_phage	100.0	2.7e-62
WP_000974683.1|537564_537756_+	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	98.4	6.6e-28
WP_000778213.1|537777_538293_+	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	98.8	1.9e-90
WP_001270899.1|538330_538531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000431209.1|538575_539295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012614791.1|539321_539495_+	hypothetical protein	NA	A0A140HLS3	Bacillus_phage	55.6	9.6e-10
WP_000589342.1|539491_539869_+	hypothetical protein	NA	A0A0D4DCF5	Staphylococcus_phage	34.4	3.6e-09
WP_001216585.1|540185_540407_+	hypothetical protein	NA	D2XR53	Bacillus_phage	100.0	2.0e-36
WP_041185091.1|540863_541316_+	hypothetical protein	NA	A0A0A7AQW7	Bacillus_phage	75.3	2.3e-63
WP_000017813.1|541363_542059_+	hypothetical protein	NA	A0A2I7RG90	Vibrio_phage	25.7	7.5e-21
WP_000862742.1|542080_542218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001041414.1|542632_543103_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	59.2	1.2e-46
WP_001028530.1|543099_543642_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	91.1	3.8e-89
WP_001226912.1|543844_544087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000448700.1|544477_544657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001177578.1|544647_544851_+	hypothetical protein	NA	H0USV9	Bacillus_phage	37.9	4.4e-06
WP_000447507.1|544854_545166_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	67.0	6.5e-33
WP_000586123.1|545169_545469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228911.1|545576_545897_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	84.9	1.7e-44
WP_000178966.1|545880_547551_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	92.3	4.4e-301
WP_000522856.1|547567_548761_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	60.5	3.9e-134
WP_000217625.1|548726_549470_+|protease	Clp protease ClpP	protease	Q8W605	Listeria_phage	57.6	1.4e-62
WP_000153081.1|549507_550650_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	59.3	9.2e-125
WP_000438402.1|550811_551117_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	55.3	4.0e-19
WP_000844456.1|551100_551448_+	hypothetical protein	NA	A0A1B1P760	Bacillus_phage	62.7	6.8e-31
WP_000950462.1|551437_551824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729812.1|551813_552236_+	hypothetical protein	NA	R4IBU7	Listeria_phage	40.4	3.5e-21
WP_085965404.1|552238_552814_+|tail	phage tail protein	tail	R4IBJ8	Listeria_phage	56.0	1.9e-54
WP_000861919.1|552849_553302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273476.1|553484_555062_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	74.4	4.4e-101
WP_000566742.1|555316_555574_+	hypothetical protein	NA	D2XR26	Bacillus_phage	79.8	1.0e-31
WP_157405710.1|556904_557942_+	hypothetical protein	NA	A0A2I7SCT8	Paenibacillus_phage	63.2	1.1e-20
WP_000884133.1|557943_558621_+	hypothetical protein	NA	A0A1C8EA72	Bacillus_phage	65.5	5.2e-83
WP_000594201.1|558617_561041_+	peptidase S74	NA	A0A1B1P770	Bacillus_phage	58.6	1.5e-265
WP_001064842.1|561109_562459_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P836	Bacillus_phage	33.8	1.0e-37
WP_001152011.1|562471_563143_+	hypothetical protein	NA	A0A1B1P882	Bacillus_phage	63.9	1.4e-53
WP_000151296.1|563184_563466_+	hypothetical protein	NA	D2XR31	Bacillus_phage	90.3	1.2e-38
WP_000032301.1|563468_563675_+	hypothetical protein	NA	D2XR32	Bacillus_phage	92.6	4.0e-31
WP_000509870.1|563674_564475_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	70.9	6.2e-112
WP_000713104.1|564665_565178_-	hypothetical protein	NA	D2XR34	Bacillus_phage	100.0	7.4e-50
WP_000632231.1|565273_565522_-	hypothetical protein	NA	D2XR35	Bacillus_phage	100.0	4.1e-38
WP_002170333.1|565496_565745_-	winged helix DNA-binding protein	NA	D2XR36	Bacillus_phage	100.0	6.8e-41
572578:572596	attR	GTACATTTACAAAGGATGA	NA	NA	NA	NA
>prophage 4
NC_011773	Bacillus cereus AH820, complete genome	5302683	1895064	1903797	5302683		Bacillus_phage(66.67%)	8	NA	NA
WP_000755548.1|1895064_1896327_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	2.6e-11
WP_001194297.1|1896425_1897190_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453756.1|1897430_1899191_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.3	1.4e-265
WP_002036191.1|1899270_1899957_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.4	2.9e-118
WP_000823560.1|1901052_1901640_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1901835_1902555_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_002036196.1|1902670_1902784_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	91.7	2.1e-05
WP_001258549.1|1902924_1903797_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	6.0e-68
>prophage 5
NC_011773	Bacillus cereus AH820, complete genome	5302683	2220038	2227141	5302683		Bacillus_phage(71.43%)	8	NA	NA
WP_000249922.1|2220038_2221244_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	47.0	1.0e-49
WP_000669607.1|2221425_2222577_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000637732.1|2223921_2224386_-	restriction endonuclease	NA	Q331T5	Clostridium_botulinum_C_phage	43.2	7.0e-15
WP_000649834.1|2224422_2224623_-	helix-turn-helix domain-containing protein	NA	A0A288WG80	Bacillus_phage	76.6	9.0e-20
WP_001267637.1|2224788_2225091_+	hypothetical protein	NA	A0A288WG38	Bacillus_phage	51.5	3.1e-24
WP_000156980.1|2225087_2225270_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	80.0	2.4e-19
WP_000571537.1|2225388_2226579_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	64.4	1.2e-148
WP_009879021.1|2226556_2227141_+	hypothetical protein	NA	A0A288WFQ7	Bacillus_phage	77.0	1.9e-81
>prophage 6
NC_011773	Bacillus cereus AH820, complete genome	5302683	4114897	4180127	5302683	terminase,protease,tail,integrase,tRNA,head,capsid,portal,bacteriocin	Bacillus_phage(57.14%)	83	4142066:4142084	4180160:4180178
WP_000108695.1|4114897_4116250_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_001190167.1|4116256_4117006_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000872105.1|4117151_4118090_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_000043939.1|4118118_4119234_-	chaperone protein DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.1	9.9e-23
WP_000034699.1|4119438_4121274_-	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	3.1e-138
WP_000392710.1|4121300_4121867_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000954957.1|4121981_4122998_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_041185085.1|4123131_4124271_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_001293546.1|4124323_4124698_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001030953.1|4124829_4126653_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	7.0e-26
WP_001983721.1|4126863_4127226_-	YqxA family protein	NA	NA	NA	NA	NA
WP_000662639.1|4127225_4128332_-	GPR endopeptidase	NA	NA	NA	NA	NA
WP_001274011.1|4128513_4128771_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001279912.1|4128853_4129864_-	DNA polymerase III subunit delta	NA	D9ZNJ1	Clostridium_phage	24.2	1.7e-05
WP_000997609.1|4130210_4130345_+	YqzM family protein	NA	NA	NA	NA	NA
WP_041185086.1|4130373_4132695_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	36.0	4.3e-36
WP_000439784.1|4132709_4133267_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	50.7	2.4e-30
WP_000989926.1|4133330_4133930_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_001020551.1|4134007_4134835_+	late competence protein ComER	NA	NA	NA	NA	NA
WP_001105570.1|4135006_4135756_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000653200.1|4135752_4136109_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_001078244.1|4136105_4136675_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_001226054.1|4136664_4137234_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_000955224.1|4137365_4137659_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_000812089.1|4137664_4138498_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_000140795.1|4138513_4139620_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_000765311.1|4139623_4140136_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_000850094.1|4140383_4140539_+	sporulation histidine kinase inhibitor Sda	NA	NA	NA	NA	NA
WP_001254997.1|4140685_4141474_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
4142066:4142084	attL	ACTAGACTTTATCCTGTTT	NA	NA	NA	NA
WP_000604232.1|4142181_4142400_+	winged helix-turn-helix transcriptional regulator	NA	A0A1B1P7Q3	Bacillus_phage	61.2	9.2e-18
WP_000633249.1|4142418_4142658_+	hypothetical protein	NA	A0A1B2APX4	Phage_Wrath	59.0	2.2e-20
WP_000509867.1|4142690_4143527_-	N-acetylmuramoyl-L-alanine amidase	NA	A9QTG1	Bacillus_phage	66.0	6.5e-112
WP_000389069.1|4143526_4143754_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	98.6	2.0e-23
WP_000822818.1|4143805_4144765_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR30	Bacillus_phage	94.0	2.0e-173
WP_000511058.1|4144832_4145288_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_001103982.1|4145417_4145558_-	XkdX family protein	NA	NA	NA	NA	NA
WP_001223909.1|4145557_4145908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106369.1|4145924_4146293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000482705.1|4146289_4148161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000962012.1|4148211_4149828_-	hypothetical protein	NA	A0A0K1LLF9	Bacillus_phage	33.9	1.4e-81
WP_000550759.1|4149838_4150660_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	55.5	1.3e-75
WP_041185087.1|4150659_4155345_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	35.0	7.4e-104
WP_000662581.1|4155510_4155900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013841.1|4155957_4156563_-|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	52.4	5.7e-49
WP_001205302.1|4156566_4156941_-	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	47.5	1.9e-23
WP_000002525.1|4156937_4157372_-	hypothetical protein	NA	A0A1B1P7R6	Bacillus_phage	43.8	5.2e-28
WP_001275012.1|4157364_4157697_-|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	43.6	3.0e-12
WP_001181001.1|4157693_4157969_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBP7	Clostridium_phage	44.7	8.4e-08
WP_000695231.1|4158016_4159216_-|capsid	phage major capsid protein	capsid	Q4ZCT8	Staphylococcus_virus	47.8	2.5e-88
WP_000676687.1|4159231_4159951_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	32.3	3.6e-18
WP_001254376.1|4159954_4161133_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	42.1	2.1e-76
WP_000153209.1|4161163_4162852_-	hypothetical protein	NA	A0A1B1P7R3	Bacillus_phage	44.2	1.1e-134
WP_000343051.1|4162841_4163225_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	73.2	5.5e-50
WP_015945683.1|4163402_4163708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201452.1|4163713_4164067_-	HNH endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	57.6	2.3e-26
WP_000813721.1|4164056_4164383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357096.1|4164901_4165237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789356.1|4165285_4165504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001055137.1|4165705_4166248_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	95.0	6.3e-92
WP_000744471.1|4166244_4166715_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	70.3	6.8e-58
WP_000862742.1|4167098_4167236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017813.1|4167257_4167953_-	hypothetical protein	NA	A0A2I7RG90	Vibrio_phage	25.7	7.5e-21
WP_157405708.1|4167997_4168978_-	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	54.1	6.1e-93
WP_000521775.1|4169008_4169350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001037530.1|4169503_4169689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015945685.1|4169726_4170149_-	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	95.0	1.7e-76
WP_157405716.1|4170189_4170642_-	hypothetical protein	NA	U5PVF9	Bacillus_phage	43.9	6.1e-32
WP_000418882.1|4170870_4171050_-	hypothetical protein	NA	A0A0U3B243	Bacillus_phage	67.8	1.0e-14
WP_001255655.1|4171241_4171463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974689.1|4171478_4171670_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	90.5	6.8e-25
WP_001126007.1|4171745_4172108_-	hypothetical protein	NA	D2XR47	Bacillus_phage	90.0	2.2e-56
WP_000926795.1|4172082_4172271_-	hypothetical protein	NA	D2XR45	Bacillus_phage	88.5	2.2e-15
WP_000063894.1|4172273_4173596_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	97.3	6.9e-241
WP_000312165.1|4173592_4174534_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	85.3	4.6e-138
WP_000857129.1|4174817_4175102_-	hypothetical protein	NA	D2XR42	Bacillus_phage	93.6	5.2e-45
WP_000215306.1|4175282_4175504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537284.1|4175516_4176104_-	hypothetical protein	NA	D2XR41	Bacillus_phage	94.9	7.8e-104
WP_015945687.1|4176192_4176441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000405169.1|4176495_4176687_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000172327.1|4176856_4177276_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	59.7	3.9e-33
WP_000351731.1|4177289_4177724_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	82.4	6.5e-63
WP_000760416.1|4177759_4178359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844795.1|4178573_4180127_+	serine recombinase	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	7.8e-151
4180160:4180178	attR	AAACAGGATAAAGTCTAGT	NA	NA	NA	NA
>prophage 7
NC_011773	Bacillus cereus AH820, complete genome	5302683	4263857	4318710	5302683	integrase,protease,coat,tRNA	Klosneuvirus(25.0%)	52	4283975:4283994	4299907:4299926
WP_000690814.1|4263857_4265705_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025295.1|4266079_4267186_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092245.1|4267216_4268050_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138563.1|4268069_4269599_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973794.1|4269751_4270891_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
WP_000812272.1|4270893_4271436_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510694.1|4271517_4272165_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621730.1|4272246_4273098_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026345.1|4273194_4275111_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001011379.1|4275160_4277083_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114531.1|4277057_4277834_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
WP_000865405.1|4277927_4279010_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000276720.1|4278999_4279707_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000496110.1|4279846_4281133_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001037006.1|4281132_4281681_-	sporulation protein	NA	NA	NA	NA	NA
WP_000944957.1|4281744_4282035_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|4282038_4282383_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4282394_4282703_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855430.1|4282872_4284261_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
4283975:4283994	attL	TTCGTATCAATTGCCTCTTT	NA	NA	NA	NA
WP_000599079.1|4284328_4285189_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797461.1|4285181_4285928_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503310.1|4286061_4286859_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|4286861_4287548_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975747.1|4287583_4288129_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135477.1|4288143_4288995_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|4289036_4290056_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_000760789.1|4290612_4292253_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	31.0	4.3e-51
WP_001265888.1|4292269_4292608_-	mercury resistance system substrate-binding protein MerP	NA	NA	NA	NA	NA
WP_000660890.1|4292626_4292929_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000799119.1|4292925_4293195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160578.1|4293208_4293607_-	mercury resistance transcriptional regulator MerR1	NA	NA	NA	NA	NA
WP_000198309.1|4293797_4294163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671711.1|4294164_4296078_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000867972.1|4296081_4297167_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	25.9	4.9e-11
WP_001013375.1|4297280_4297841_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_001226272.1|4297887_4298463_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000360979.1|4298684_4299647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582046.1|4299812_4301114_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
4299907:4299926	attR	TTCGTATCAATTGCCTCTTT	NA	NA	NA	NA
WP_000072239.1|4301207_4303853_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.9	4.7e-164
WP_000366998.1|4304248_4305274_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_002037253.1|4305336_4306350_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_001224512.1|4306429_4307719_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087068.1|4307718_4308708_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000992329.1|4308728_4309481_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001226418.1|4309482_4310412_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000008996.1|4310427_4311261_-	cytochrome c assembly protein	NA	NA	NA	NA	NA
WP_000547860.1|4311278_4312613_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000568752.1|4313028_4313481_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359781.1|4313483_4313900_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869113.1|4313932_4314529_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097302.1|4314525_4316856_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	3.9e-178
WP_009879805.1|4317039_4318710_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	9.6e-14
