The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	17238	81753	4068724	integrase,coat,protease,transposase	Bacillus_virus(15.38%)	52	50739:50755	85622:85638
WP_012634472.1|17238_18222_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_012634473.1|18288_19959_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_012634474.1|20227_20431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634475.1|20579_20846_+	Veg family protein	NA	NA	NA	NA	NA
WP_012634476.1|21119_22688_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_012634477.1|22883_23735_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_012634478.1|23751_24438_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012634479.1|24515_26117_+	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	32.7	6.0e-29
WP_012634480.1|26264_26996_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012634481.1|27020_27515_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012634482.1|27545_28373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634483.1|28446_30024_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_012634484.1|30069_31995_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012634485.1|32021_32426_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_012634486.1|32452_33592_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_012634487.1|33612_35607_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012634488.1|35659_36586_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_012634489.1|36591_37704_-	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_012634490.1|37903_38599_+	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	41.6	4.1e-19
WP_012634491.1|38614_40006_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_157668482.1|40189_40603_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012634493.1|40628_41084_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.3	1.4e-12
WP_012634494.1|41189_42203_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_012634495.1|42368_43385_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012634496.1|43419_44433_-	ATP-binding protein	NA	A7DYC9	Streptococcus_phage	26.2	3.7e-08
WP_012634497.1|44465_45452_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_012634498.1|45661_46177_+	ferritin	NA	NA	NA	NA	NA
WP_012634499.1|46248_47865_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012634500.1|48050_49049_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	9.2e-20
WP_012634501.1|49038_50049_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	5.6e-17
WP_012634502.1|50185_51181_-	ABC transporter permease	NA	NA	NA	NA	NA
50739:50755	attL	ATTCTCATCATAATATT	NA	NA	NA	NA
WP_012634503.1|51197_52121_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012634504.1|52669_54397_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	3.2e-12
WP_012634505.1|54999_55911_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.9	6.2e-23
WP_012634506.1|55928_57095_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_012634507.1|57091_60241_+	SMC family ATPase	NA	G3MAB6	Bacillus_virus	22.4	7.9e-09
WP_012634508.1|60278_62507_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_012634509.1|62579_63638_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012634510.1|63996_64281_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_012634511.1|64292_64721_+	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	47.9	9.6e-27
WP_004619077.1|65009_65303_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_012634512.1|65419_65758_-	helix-turn-helix transcriptional regulator	NA	A0A142LP08	Marinitoga_camini_virus	35.6	3.3e-06
WP_012634514.1|66525_66897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634515.1|67214_67685_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	39.7	3.3e-20
WP_012634516.1|68140_69136_+	hydrolase -like protein	NA	NA	NA	NA	NA
WP_012634517.1|69575_70424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634518.1|70434_70953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634519.1|70966_73924_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041706839.1|74149_77449_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_012634521.1|77669_78827_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF08	Clostridium_phage	21.2	1.9e-05
WP_012634522.1|78823_80209_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012634523.1|80199_81753_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
85622:85638	attR	AATATTATGATGAGAAT	NA	NA	NA	NA
>prophage 2
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	448697	515121	4068724	coat,tRNA,protease,transposase	Bacillus_phage(18.18%)	55	NA	NA
WP_012634844.1|448697_450197_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.4	4.5e-95
WP_012634845.1|450290_451202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634846.1|451240_451558_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_012634847.1|451643_452030_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012634848.1|452032_452782_+	SigB/SigF/SigG family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	31.2	5.1e-23
WP_012634849.1|452852_453287_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012634850.1|460174_461293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634852.1|462778_463928_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	26.4	1.1e-16
WP_012634854.1|464656_465013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634855.1|465220_466162_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_012634672.1|466411_467458_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_012634856.1|467725_468184_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012634857.1|468357_469953_-	MFS transporter	NA	NA	NA	NA	NA
WP_012634858.1|470191_470470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012634859.1|470717_471698_+	cysteine synthase family protein	NA	NA	NA	NA	NA
WP_012634860.1|471711_472275_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012634861.1|472331_473009_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012634862.1|473085_475266_+	EamA family transporter	NA	NA	NA	NA	NA
WP_012634863.1|475627_478174_+	cellulosome protein dockerin type I	NA	NA	NA	NA	NA
WP_012634864.1|478395_479592_-|transposase	IS256-like element ISCce2 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.0	3.5e-58
WP_012634865.1|479705_480701_+	MYG1 family protein	NA	NA	NA	NA	NA
WP_081436723.1|480761_481166_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_012634866.1|481262_481676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081436724.1|481846_483091_-	MFS transporter	NA	NA	NA	NA	NA
WP_157668484.1|483153_484059_-	VanW family protein	NA	NA	NA	NA	NA
WP_012634869.1|484285_484699_+	EamA family transporter	NA	NA	NA	NA	NA
WP_012634870.1|484708_486175_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012634871.1|486549_486705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634872.1|486774_488379_+	recombinase family protein	NA	A0A2I4R675	Erysipelothrix_phage	36.6	9.4e-75
WP_012634873.1|488507_491300_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_095206803.1|491762_491990_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_012634874.1|492171_494757_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_012634875.1|494962_496570_+	recombinase family protein	NA	A0A290FZV2	Caldibacillus_phage	25.2	5.1e-28
WP_041706452.1|496627_496747_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_081436726.1|496753_497164_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_012634877.1|497156_497366_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_012634878.1|497557_498499_+	DUF4825 domain-containing protein	NA	NA	NA	NA	NA
WP_041706456.1|498616_499033_+	sigma-70 family RNA polymerase sigma factor	NA	U5PUF5	Bacillus_phage	44.7	1.3e-12
WP_012634879.1|498992_499763_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	2.0e-30
WP_012634880.1|499752_500520_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012634881.1|500543_501503_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012634882.1|501545_503537_-	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_012634883.1|503742_503931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634884.1|503939_505598_+	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	39.2	6.0e-101
WP_081436727.1|505605_505965_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012634885.1|506115_507456_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012634886.1|507603_508362_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_012634887.1|508481_509129_+	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_012634888.1|509313_510021_+	UMP kinase	NA	NA	NA	NA	NA
WP_012634889.1|510073_510631_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_012634890.1|510636_510900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012634891.1|510974_511730_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.7	3.1e-28
WP_012634892.1|511788_512616_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012634893.1|512653_513799_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_012634894.1|513834_515121_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 3
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	914278	946011	4068724	transposase,integrase,protease,tRNA,holin	Moraxella_phage(20.0%)	32	917615:917631	950934:950950
WP_015924333.1|914278_915016_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_015924334.1|915261_915696_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_015924335.1|915714_916107_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_015924336.1|916170_917475_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
917615:917631	attL	ATTTTTCTGTTTTTCCA	NA	NA	NA	NA
WP_015924337.1|917920_918400_-	DtxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015924338.1|918623_919814_+	amidohydrolase	NA	NA	NA	NA	NA
WP_015924339.1|919806_920259_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_015924340.1|920271_920982_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_015924341.1|920974_921427_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_015924342.1|921470_923876_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015924343.1|923981_924536_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015924344.1|924532_925099_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_015924345.1|925095_925992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015924346.1|926098_926356_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_015924347.1|926526_928368_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_015924348.1|928389_929091_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015924349.1|929328_930615_+	trigger factor	NA	NA	NA	NA	NA
WP_015924350.1|930720_931305_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.1	6.9e-52
WP_015924351.1|931318_932614_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.3	2.4e-145
WP_015924352.1|932761_934444_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	34.4	1.5e-14
WP_015924353.1|934914_935106_+|holin	holin	holin	NA	NA	NA	NA
WP_015924354.1|935298_936327_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.3	2.7e-67
WP_015924355.1|936614_937322_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	60.6	3.2e-35
WP_015924356.1|937427_937733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015924357.1|937919_938402_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_015924358.1|938466_939324_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015924359.1|939486_939951_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.4	1.1e-41
WP_015924360.1|940697_941834_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	30.7	1.1e-40
WP_015924361.1|941887_942139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015924362.1|942457_943231_+	hypothetical protein	NA	A0A0A7S0D9	Clostridium_phage	41.9	2.6e-06
WP_012634672.1|943380_944427_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_012634852.1|944861_946011_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	26.4	1.1e-16
950934:950950	attR	TGGAAAAACAGAAAAAT	NA	NA	NA	NA
>prophage 4
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	1795898	1827622	4068724	tail,transposase	Escherichia_phage(20.0%)	26	NA	NA
WP_012634672.1|1795898_1796945_-|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_081436741.1|1797073_1797592_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_015924974.1|1797594_1798479_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_015924975.1|1798475_1799144_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_015924976.1|1799140_1800172_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_015924977.1|1800181_1800472_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_095206808.1|1801076_1802221_-|transposase	IS3-like element ISCce4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.8	6.5e-62
WP_015924980.1|1802970_1804626_+	peptidoglycan glycosyltransferase	NA	NA	NA	NA	NA
WP_015924981.1|1804705_1805413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015924982.1|1805405_1805702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041706653.1|1805992_1806211_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015924984.1|1806159_1806510_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157668447.1|1806868_1813864_+	HYR domain-containing protein	NA	NA	NA	NA	NA
WP_015924986.1|1813944_1817976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015924987.1|1817993_1818365_+	ankyrin repeat domain-containing protein	NA	A0A068EFL7	Penguinpox_virus	41.9	1.9e-07
WP_157668490.1|1819046_1819541_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_015924989.1|1819563_1820028_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_015924990.1|1820181_1820616_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_015924991.1|1821093_1821315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015924992.1|1821416_1823651_+	ATP-binding protein	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	34.8	2.2e-13
WP_015924993.1|1823651_1824260_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_015924994.1|1824379_1825924_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.1	1.9e-69
WP_015924995.1|1825947_1826391_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_041706946.1|1826588_1826957_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_014312901.1|1826953_1827139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015924998.1|1827148_1827622_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 5
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	1832244	1904154	4068724	tRNA,plate,transposase,tail	Bacillus_phage(25.0%)	42	NA	NA
WP_015925005.1|1832244_1835856_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_015925006.1|1835908_1836778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015925007.1|1836777_1837515_+|tail	tail protein	tail	NA	NA	NA	NA
WP_015925008.1|1837564_1840186_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_015925009.1|1840211_1840388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015925010.1|1840449_1843137_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_015925011.1|1843201_1843381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015925012.1|1843463_1849196_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_015925013.1|1849327_1850083_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_015925014.1|1850088_1850541_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_015925015.1|1857204_1857885_+	single-stranded DNA-binding protein	NA	A0A2H4J8K3	uncultured_Caudovirales_phage	53.9	3.7e-57
WP_015925016.1|1858304_1859357_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_015925017.1|1859340_1859748_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_041706660.1|1859744_1860281_+	Gx transporter family protein	NA	NA	NA	NA	NA
WP_015925019.1|1860290_1861247_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	27.9	2.8e-10
WP_015925020.1|1861292_1863749_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_015925021.1|1863780_1864260_+	peptide deformylase	NA	A0A2I7R586	Vibrio_phage	37.8	6.3e-19
WP_015925022.1|1864300_1865239_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_015925023.1|1865228_1865984_+	DUF116 domain-containing protein	NA	NA	NA	NA	NA
WP_015925024.1|1866014_1866713_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_015925025.1|1866754_1868104_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_015925026.1|1868113_1869163_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_015925027.1|1869189_1869915_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_015925028.1|1869928_1871812_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	31.1	1.7e-22
WP_015925029.1|1871825_1872743_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_015925030.1|1872739_1873408_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_015925031.1|1873433_1874069_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_015925032.1|1874372_1874816_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015925033.1|1874990_1875302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015925034.1|1875571_1876048_+	MGMT family protein	NA	NA	NA	NA	NA
WP_012634864.1|1876285_1877482_-|transposase	IS256-like element ISCce2 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.0	3.5e-58
WP_015925035.1|1878420_1880769_+	cellulosome anchoring protein cohesin subunit	NA	NA	NA	NA	NA
WP_015925036.1|1880959_1882234_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015925037.1|1882801_1884928_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.5	4.6e-29
WP_015925038.1|1884984_1885698_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	2.5e-35
WP_015925039.1|1886033_1895996_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015925040.1|1896178_1897009_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015925041.1|1897150_1899085_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_015925042.1|1899236_1900685_+	glycoside hydrolase	NA	A0A1X9VNM7	Mimivirus	33.9	4.4e-55
WP_015925043.1|1900746_1902498_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_015925044.1|1902781_1903147_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_015925045.1|1903320_1904154_+|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
>prophage 6
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	2144885	2214464	4068724	transposase,integrase,head,protease,tRNA	Escherichia_phage(17.39%)	67	2185983:2186042	2201443:2202739
WP_015925254.1|2144885_2146274_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	29.4	6.3e-51
WP_015925255.1|2146288_2146495_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_015925256.1|2146512_2147118_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.1	9.5e-12
WP_015925257.1|2147127_2147406_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_015925258.1|2147420_2148302_-	YicC family protein	NA	NA	NA	NA	NA
WP_015925259.1|2148553_2148925_-	response regulator	NA	NA	NA	NA	NA
WP_041706684.1|2148911_2149664_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_015925261.1|2149645_2150596_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_015925262.1|2150634_2151774_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	33.0	5.7e-34
WP_015925263.1|2151917_2153768_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	4.8e-139
WP_015925264.1|2153840_2154434_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_015925265.1|2154461_2155508_-	heat-inducible transcription repressor HrcA	NA	NA	NA	NA	NA
WP_015925266.1|2155702_2156572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925267.1|2156608_2157448_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_015925268.1|2157534_2158125_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_015925269.1|2158133_2159279_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015925270.1|2159356_2159872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668452.1|2160016_2160853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041706966.1|2160861_2162868_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_015925273.1|2163000_2163582_-	hydrolase	NA	A0A2K9V2Z3	Faecalibacterium_phage	43.0	4.8e-37
WP_015925274.1|2163791_2164742_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_015924200.1|2165192_2166476_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015925275.1|2166674_2167517_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	28.0	1.0e-11
WP_041706967.1|2167517_2168612_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_015925277.1|2168657_2169476_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015925278.1|2169504_2170917_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.5	5.1e-24
WP_015925279.1|2170972_2172022_-	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	26.4	6.1e-06
WP_015925280.1|2172026_2173028_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.4	6.4e-05
WP_015925281.1|2173053_2174364_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_041706968.1|2174397_2175324_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041706687.1|2175470_2176073_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015926613.1|2176827_2177283_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	3.9e-18
WP_012634672.1|2177908_2178955_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015925283.1|2179170_2179539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925284.1|2180918_2181212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925285.1|2181289_2182054_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095206808.1|2182979_2184123_+|transposase	IS3-like element ISCce4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.8	6.5e-62
WP_015925287.1|2184186_2184351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925288.1|2185188_2185785_+	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
2185983:2186042	attL	AATTGCTAGAGAATTGACTTCACTTGACAGTATCTGAATAATGTTGGGCAATATCTCCTC	NA	NA	NA	NA
WP_012634672.1|2186078_2187125_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015925289.1|2188301_2188640_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015925290.1|2188633_2188990_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.8	2.8e-19
WP_015925291.1|2189065_2190655_+|transposase	IS66-like element ISCce5 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.3e-65
WP_015925292.1|2191600_2192692_-	20S proteasome subunit alpha	NA	NA	NA	NA	NA
WP_012634672.1|2193207_2194254_-|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015925293.1|2194341_2194809_-|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_015925294.1|2194846_2195545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925295.1|2195626_2196319_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015925296.1|2196384_2196762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925297.1|2196791_2197046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925298.1|2197042_2197618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925299.1|2197595_2198342_-	helix-turn-helix domain-containing protein	NA	A0A2P1CD59	Lactobacillus_phage	36.5	2.5e-06
WP_015925300.1|2198354_2198597_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015925301.1|2198600_2198825_-	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	39.0	5.8e-07
WP_015925302.1|2198986_2199832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015925303.1|2199897_2201139_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	36.9	1.4e-70
WP_012634672.1|2201538_2202585_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015925304.1|2202758_2203583_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
2201443:2202739	attR	AATTGCTAGAGAATTGACTTCACTTGACAGTATCTGAATAATGTTGGGCAATATCTCCTCTGGACAATAATTAAATTGTAGGAGGAGATTTCAATTATGACAGCACAAGATCGTATAGTTAAAAACAAAATGAGCCTGATTGAGTTGGCCGAATATCTTCAAAACGTAAGTGAAGCATGTAAAATTCATGGAGTCAGCAGACAGCACTTCTATGATATTAAGAAAGCTTACGAGGAAAATGGTCTGGAAGGATTAAAGGACAAGACCAGAAGAAAGCCTTGTATGAAAAACAGGGTTGCTCCAGAAACTGAGGAAGCCGTATTAAGAATAGCATATGAAAAGCCGGCATACGGGCAGCTCAGGGCAAGTAACGAACTGAGAAAACAAGGAGTTCTTGTATCAGCCGGAGGGGTAAGATCAATCTGGCAGAGATATAATATAGAAACCTTTGACAAGAGACTCAAAAAGCTTGAAGAAAAGGCTGCCAAGGAAGGCATACTTTACACTGAAGATCAGCTCGCTGCTCTGGAAAAGGCACAGCAGGAAAAGAATATATCCATAGACGAGATAGATACCCAGCACCCGGGATATTTGCTGGCACAGGACACTTTCTATGTGGGCTATATCAAAGGTGTTGGACGTATATATCAGCAAACTGCCATAGATACTTATTCGGCAGTGGGATTCGCAAAATTATATACAGCCAAGGTACCAGTAACAGCAGCAGATATATTAAATGACAGAGTCTTACCGTTCTTTGAGAATCATATGATACCGATAATGAGAGTACTCACAGACAGAGGAACGGAGTACTGTGGAGCACCTGAGAAACACTTGTATGAGTTATTTCTGCAGATGAACGACATTGAGCACACAATGACAAAGGCTAAAAGCCCTCAAACAAACGGTATATGCGAGCGTTTTAACCAAACAATTCTGAATGAATTTTATAAACCCGCATTCCGAAGGACAATGTATAAATCAGTTGAACAAATGCAGGAGGATTTGGATTTTTATATGCTGGAATACAACGAAGAGCGAACACATCAGGGGAAAAGGTGTAAAGGCAAGACGCCGATGCAGACATTTCTTGACAGCTTGCCTCTTGCCCGAGAGAAGCTCCTGAATGATCCTGCGAGTTAATTTGTAGGGTCTAGCCCGCCCGGCGATGAGGGCAAAAAAGATATCAGACCAGGCGCCGGTTTGACATAGAAAGGCACCTCCATATTGGAAGTGCCGAATAAACAAAACTTAATATTTCCCAGAGGAGTGTCAACCCAAGTACCGTTCAGGACAG	NA	NA	NA	NA
WP_015925305.1|2203723_2204356_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_015925306.1|2204379_2204682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925307.1|2204857_2205937_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	29.2	8.6e-32
WP_015925308.1|2205967_2208757_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	27.2	2.1e-90
WP_015925309.1|2209221_2209725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015925310.1|2209725_2211132_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.8	6.0e-33
WP_015925311.1|2211366_2212245_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_015925312.1|2212265_2212835_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_015925313.1|2212904_2214464_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 7
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	2365965	2373047	4068724	transposase	Staphylococcus_phage(50.0%)	7	NA	NA
WP_015925454.1|2365965_2366433_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.7	1.0e-37
WP_015925455.1|2366422_2367685_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.8	7.6e-112
WP_015925456.1|2367712_2368369_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.9	3.7e-38
WP_015925457.1|2368389_2369493_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.6	2.1e-49
WP_015925458.1|2369949_2371191_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	25.6	1.7e-15
WP_015925459.1|2371201_2371435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095206808.1|2371903_2373047_+|transposase	IS3-like element ISCce4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.8	6.5e-62
>prophage 8
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	3154644	3233734	4068724	transposase	Leptospira_phage(14.29%)	56	NA	NA
WP_012634852.1|3154644_3155793_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	26.4	1.1e-16
WP_015926035.1|3155953_3158455_-	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_015926036.1|3158685_3159360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926037.1|3159410_3160088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015925289.1|3160326_3160665_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015925290.1|3160658_3161015_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.8	2.8e-19
WP_015926038.1|3161090_3162680_+|transposase	IS66-like element ISCce5 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	4.6e-66
WP_041707008.1|3162684_3163245_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.3	2.9e-31
WP_157668458.1|3163415_3163682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015926040.1|3164115_3164901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926041.1|3164893_3165781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926042.1|3165892_3166276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926043.1|3166551_3171762_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015926044.1|3171778_3173206_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_015926045.1|3173772_3174609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926046.1|3174598_3175111_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015926047.1|3175299_3176760_-	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.2	2.3e-11
WP_015926048.1|3177097_3177919_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157668460.1|3177989_3178157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926049.1|3179548_3180820_+	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	24.3	3.5e-08
WP_015926050.1|3181004_3183674_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015926051.1|3183811_3185200_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_015926052.1|3185259_3191796_-	InlB B-repeat-containing protein	NA	NA	NA	NA	NA
WP_015926053.1|3191909_3192248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926054.1|3192409_3193168_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015926055.1|3193164_3194445_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015926056.1|3194596_3195025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926057.1|3195005_3195896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926058.1|3196299_3197220_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_015926059.1|3197446_3197986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926060.1|3198101_3198431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926061.1|3198415_3199768_-	amidase	NA	NA	NA	NA	NA
WP_041707010.1|3199818_3200706_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_081436754.1|3200924_3202928_-	FUSC family protein	NA	NA	NA	NA	NA
WP_015926064.1|3203414_3204503_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.7	3.1e-37
WP_015926065.1|3204492_3205197_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	7.8e-34
WP_015926066.1|3205309_3207298_-	serine hydrolase	NA	NA	NA	NA	NA
WP_015926067.1|3207510_3208263_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_015926068.1|3208259_3209318_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_095206820.1|3209314_3210304_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.5	6.4e-58
WP_015926070.1|3210346_3211369_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015926071.1|3212312_3212501_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015926072.1|3213781_3214312_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.1	2.0e-13
WP_015926074.1|3215656_3215893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926076.1|3217783_3218656_-	radical SAM protein	NA	NA	NA	NA	NA
WP_015926077.1|3218786_3219245_-	glyoxalase	NA	NA	NA	NA	NA
WP_015926078.1|3219268_3220090_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015924200.1|3221864_3223148_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015926079.1|3223848_3225045_+|transposase	IS256-like element ISCce2 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.0	5.9e-58
WP_012634672.1|3225139_3226186_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_041706758.1|3226352_3226568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926080.1|3226840_3227695_-	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	43.4	1.6e-25
WP_015926081.1|3228458_3229121_-	VanZ family protein	NA	NA	NA	NA	NA
WP_015926082.1|3229138_3230383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756869.1|3231430_3232555_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012634672.1|3232687_3233734_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
>prophage 9
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	3239372	3281705	4068724	integrase,transposase	Escherichia_phage(30.0%)	29	3249223:3249241	3292958:3292976
WP_012634672.1|3239372_3240419_-|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_012634672.1|3242080_3243127_-|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015926088.1|3247496_3248258_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	26.9	1.2e-06
3249223:3249241	attL	GTAAATGTCTTTTGCATCA	NA	NA	NA	NA
WP_162010680.1|3250832_3252026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015924200.1|3252665_3253949_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041706763.1|3254050_3254677_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012634852.1|3254812_3255961_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	26.4	1.1e-16
WP_041706765.1|3256121_3256583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926091.1|3256575_3257343_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.9e-33
WP_081436756.1|3257516_3258170_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	2.4e-16
WP_015925289.1|3258259_3258598_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015925290.1|3258591_3258948_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.8	2.8e-19
WP_015926038.1|3259023_3260613_+|transposase	IS66-like element ISCce5 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	4.6e-66
WP_012634672.1|3260927_3261974_-|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015926092.1|3262295_3265406_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015926093.1|3265389_3265935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926094.1|3265924_3267241_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_015926095.1|3267237_3268287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926096.1|3268623_3268890_-	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_015926097.1|3269033_3269279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926098.1|3269289_3269457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926099.1|3269611_3272335_-	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_015926100.1|3272327_3275213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041706767.1|3275353_3275734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926102.1|3275711_3276905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926103.1|3276928_3277915_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_015926104.1|3278372_3279098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081436758.1|3279531_3280680_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_015926106.1|3280763_3281705_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	46.1	4.7e-74
3292958:3292976	attR	GTAAATGTCTTTTGCATCA	NA	NA	NA	NA
>prophage 10
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	3357742	3448198	4068724	portal,tail,transposase,capsid,terminase,head,protease,holin	Erysipelothrix_phage(66.67%)	85	NA	NA
WP_162010681.1|3357742_3357892_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015926169.1|3358476_3360060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926170.1|3360345_3361329_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_015926171.1|3361328_3362306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926172.1|3362307_3363261_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9KZK0	Tupanvirus	29.5	3.7e-26
WP_015926173.1|3363409_3364696_+	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	29.3	1.8e-36
WP_015926174.1|3365304_3366123_-	aminoglycoside nucleotidyltransferase ANT(9)	NA	NA	NA	NA	NA
WP_012620729.1|3366195_3367416_-	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	30.4	8.6e-12
WP_015926175.1|3367456_3368197_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	91.4	6.1e-130
WP_015926176.1|3368177_3369047_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	88.9	3.1e-149
WP_015926177.1|3369062_3370061_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_015926178.1|3370095_3370608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926179.1|3370766_3372338_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	60.3	2.8e-172
WP_015926180.1|3372341_3372755_-	recombinase	NA	NA	NA	NA	NA
WP_015926181.1|3372755_3374321_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	53.7	7.3e-157
WP_015926182.1|3374382_3374619_-	hypothetical protein	NA	A0A2K5B2B1	Erysipelothrix_phage	48.2	7.9e-07
WP_015926183.1|3374813_3375515_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	44.7	7.0e-51
WP_015926184.1|3375511_3375928_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	70.6	2.2e-52
WP_015926185.1|3376012_3378481_-	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	67.0	0.0e+00
WP_015926186.1|3378477_3379047_-	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	52.4	1.7e-47
WP_015926188.1|3379269_3381789_-|tail	phage tail protein	tail	A0A2K5B298	Erysipelothrix_phage	60.7	1.2e-307
WP_015926189.1|3381794_3382568_-|tail	phage tail family protein	tail	A0A2I4R672	Erysipelothrix_phage	53.1	1.8e-76
WP_015926190.1|3382583_3385040_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	52.0	5.5e-26
WP_015926192.1|3385249_3385633_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	71.4	3.1e-45
WP_015926193.1|3385635_3386235_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	73.7	1.4e-79
WP_015926194.1|3386237_3386582_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	52.3	2.4e-28
WP_015926195.1|3386578_3387010_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	61.5	2.7e-45
WP_041706780.1|3387002_3387338_-|head	phage head closure protein	head	A0A2K5B291	Erysipelothrix_phage	64.0	4.1e-33
WP_015926197.1|3387339_3387660_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	76.0	7.7e-37
WP_015926198.1|3387686_3387899_-	hypothetical protein	NA	A0A2K5B289	Erysipelothrix_phage	70.3	3.3e-20
WP_015926199.1|3387911_3389105_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	80.1	7.7e-183
WP_015926200.1|3389124_3389814_-|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	63.6	9.9e-74
WP_015926201.1|3389814_3391059_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	72.6	1.1e-179
WP_015926202.1|3391102_3392707_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	83.9	1.6e-268
WP_015926203.1|3392796_3392985_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_015926204.1|3393008_3393236_-	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	39.7	4.0e-08
WP_015926205.1|3393232_3393925_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	49.8	1.2e-50
WP_015926206.1|3394038_3396198_-	DNA cytosine methyltransferase	NA	A0A2K9V3X0	Faecalibacterium_phage	60.6	2.4e-33
WP_015926207.1|3396190_3397432_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	76.3	6.4e-188
WP_157668468.1|3397421_3398588_-	methionine adenosyltransferase	NA	A0A2K5B278	Erysipelothrix_phage	78.0	1.2e-177
WP_015926209.1|3398608_3399160_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	77.6	5.7e-80
WP_015926210.1|3399271_3399631_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	66.1	1.5e-41
WP_015926211.1|3399786_3400200_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	42.6	1.1e-24
WP_019155136.1|3400196_3400415_-	hypothetical protein	NA	A0A2K5B274	Erysipelothrix_phage	57.1	2.1e-14
WP_015926213.1|3400414_3401776_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	79.9	3.1e-188
WP_015926214.1|3401756_3402038_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	68.9	1.1e-26
WP_015926215.1|3402257_3404624_-	virulence-associated E family protein	NA	A0A1W6JQ82	Corynebacterium_phage	52.1	2.7e-243
WP_015926216.1|3404620_3405055_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	70.8	1.8e-57
WP_000344037.1|3405054_3405807_-	phage antirepressor Ant	NA	A0A2H4IZX7	uncultured_Caudovirales_phage	50.2	3.9e-63
WP_000658732.1|3406192_3406411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926217.1|3406436_3407150_-	GAP family protein	NA	NA	NA	NA	NA
WP_015926218.1|3407252_3407852_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081436774.1|3408135_3410070_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	73.8	1.4e-290
WP_015926220.1|3410066_3410594_-	HNH endonuclease	NA	S5YLC4	Mycobacterium_phage	40.2	1.5e-21
WP_015926221.1|3410667_3411216_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	89.0	1.2e-90
WP_015926222.1|3411220_3412357_-	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	80.4	1.8e-181
WP_015926223.1|3412349_3412673_-	rRNA biogenesis protein rrp5	NA	A0A2K5B2A7	Erysipelothrix_phage	60.7	9.2e-22
WP_015926224.1|3412647_3412866_-	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	63.4	5.8e-20
WP_041706786.1|3412912_3413578_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2K5B267	Erysipelothrix_phage	33.5	1.8e-16
WP_015926227.1|3413918_3415787_-	helix-turn-helix transcriptional regulator	NA	E4ZFJ9	Streptococcus_phage	30.2	8.1e-78
WP_012103012.1|3415988_3416192_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	75.4	3.7e-21
WP_015926228.1|3416248_3417448_+	MspI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_015926229.1|3417502_3418753_-	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	44.4	4.8e-66
WP_015926230.1|3419161_3420544_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	44.2	2.8e-104
WP_015926231.1|3420732_3420939_-	rubrerythrin	NA	NA	NA	NA	NA
WP_015926232.1|3420954_3421506_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
WP_041707037.1|3421668_3422211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015926234.1|3422195_3422645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015926235.1|3422736_3423096_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_015926236.1|3423277_3425593_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_015926237.1|3425822_3426671_+	M23 family metallopeptidase	NA	G9BW84	Planktothrix_phage	45.7	5.4e-21
WP_015926238.1|3426894_3429480_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_015926239.1|3429532_3430351_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.8	2.9e-48
WP_015926240.1|3430434_3431127_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_015926241.1|3431337_3433422_-	elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	25.5	1.0e-52
WP_015926242.1|3433864_3434890_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_015926243.1|3434879_3435980_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_015926244.1|3436028_3436667_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_015926245.1|3436908_3439146_+	polysaccharide pyruvyl transferase CsaB	NA	NA	NA	NA	NA
WP_015926246.1|3439327_3441232_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.1	3.4e-55
WP_015926247.1|3441390_3442389_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_015926248.1|3442649_3444134_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.2	1.0e-06
WP_015926249.1|3444202_3445201_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_015926250.1|3445527_3447012_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012634672.1|3447151_3448198_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
>prophage 11
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	3501367	3550131	4068724	portal,tail,transposase,terminase,integrase,head,protease,tRNA,holin	Clostridium_phage(23.08%)	51	3532418:3532434	3556573:3556589
WP_015926303.1|3501367_3502330_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_015926304.1|3502986_3503454_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_015926305.1|3503480_3504182_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_015926306.1|3504313_3504814_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_015926307.1|3504817_3505066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926308.1|3505394_3505511_-	XkdX family protein	NA	NA	NA	NA	NA
WP_015926309.1|3505515_3505911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095206808.1|3506176_3507321_-|transposase	IS3-like element ISCce4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.8	6.5e-62
WP_015926310.1|3507345_3507504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926311.1|3507508_3507967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926312.1|3507976_3508396_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_015926313.1|3508396_3508729_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_015926314.1|3508725_3509007_-|head,tail	phage gp6-like head-tail connector protein	head,tail	I2E8V5	Clostridium_phage	43.3	4.8e-11
WP_015926317.1|3510190_3510802_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	37.8	4.9e-24
WP_015926318.1|3510791_3512039_-|portal	phage portal protein	portal	I2E8V3	Clostridium_phage	49.5	2.1e-98
WP_015926319.1|3512257_3513925_-|terminase	terminase	terminase	I2E8V1	Clostridium_phage	54.3	2.2e-167
WP_012634672.1|3514082_3515129_-|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015926320.1|3515216_3517409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926321.1|3517495_3518893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926322.1|3519516_3520089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926323.1|3520763_3521372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926324.1|3521530_3521746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015926325.1|3521868_3523473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015925289.1|3523876_3524215_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015925290.1|3524208_3524565_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.8	2.8e-19
WP_015926038.1|3524640_3526230_+|transposase	IS66-like element ISCce5 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	4.6e-66
WP_012634672.1|3526663_3527710_-|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015926328.1|3527948_3528818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926329.1|3528944_3529757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668471.1|3529813_3530059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012634672.1|3530164_3531211_+|transposase	IS481-like element ISCce1 family transposase	transposase	A0A077SLK2	Escherichia_phage	59.2	8.2e-112
WP_015926331.1|3531424_3531718_-	YjcQ family protein	NA	NA	NA	NA	NA
WP_015926332.1|3531740_3532283_-	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_015926333.1|3532291_3532546_-	hypothetical protein	NA	NA	NA	NA	NA
3532418:3532434	attL	ATATTCATCATCACTTA	NA	NA	NA	NA
WP_015926334.1|3532673_3533597_-|integrase	site-specific integrase	integrase	A0A0U4IBS1	Pseudomonas_phage	24.6	4.1e-06
WP_015926336.1|3534120_3534924_-	lipid II flippase Amj family protein	NA	NA	NA	NA	NA
WP_015926337.1|3535082_3535724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926338.1|3535806_3536175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926339.1|3536244_3538659_-	stage II sporulation protein E	NA	NA	NA	NA	NA
WP_015926340.1|3538901_3540341_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	50.1	6.8e-125
WP_015926341.1|3541119_3541851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926342.1|3542088_3542319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015926343.1|3542541_3543828_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	34.4	2.1e-16
WP_015926344.1|3543872_3544487_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015926345.1|3544528_3544810_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_015926346.1|3544843_3545518_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_015926347.1|3545535_3545997_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_015926348.1|3546060_3546897_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015926349.1|3546896_3547784_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015926350.1|3547921_3549310_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015926351.1|3549660_3550131_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
3556573:3556589	attR	ATATTCATCATCACTTA	NA	NA	NA	NA
>prophage 12
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	3582719	3617500	4068724	capsid,terminase	Clostridium_phage(37.5%)	45	NA	NA
WP_015926384.1|3582719_3584711_-	hypothetical protein	NA	R9TMD0	Paenibacillus_phage	35.9	4.7e-76
WP_015926385.1|3584715_3585075_-	hypothetical protein	NA	R9TNE7	Paenibacillus_phage	42.0	1.9e-23
WP_015926386.1|3585088_3587614_-	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	41.8	5.1e-51
WP_157668497.1|3587606_3588002_-	hypothetical protein	NA	M9Q2I4	Clostridium_phage	49.6	1.2e-28
WP_015926388.1|3587958_3588264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926389.1|3588301_3588754_-	hypothetical protein	NA	M9Q1I1	Clostridium_phage	49.7	4.1e-36
WP_041707045.1|3588753_3589149_-	hypothetical protein	NA	M9Q2F6	Clostridium_phage	70.3	7.0e-48
WP_015926391.1|3589148_3589532_-	hypothetical protein	NA	M9Q249	Clostridium_phage	51.2	2.3e-32
WP_015926392.1|3589531_3589849_-	hypothetical protein	NA	M9Q2I3	Clostridium_phage	56.6	1.5e-29
WP_015926393.1|3589851_3590214_-	hypothetical protein	NA	M9Q2K9	Clostridium_phage	50.8	2.1e-30
WP_015926394.1|3590226_3590502_-	hypothetical protein	NA	M9Q1H8	Clostridium_phage	52.8	3.8e-08
WP_015926395.1|3590513_3591419_-	hypothetical protein	NA	M9Q2F4	Clostridium_phage	80.7	5.0e-142
WP_015926396.1|3591433_3592015_-	phage scaffolding protein	NA	A0A1Z1LZK8	Bacillus_phage	38.7	7.9e-16
WP_015926397.1|3592164_3592398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926398.1|3592455_3592674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926399.1|3592678_3594610_-	hypothetical protein	NA	M9Q2F2	Clostridium_phage	52.4	2.9e-107
WP_015926400.1|3594590_3596093_-|capsid	phage capsid protein	capsid	M9Q246	Clostridium_phage	62.9	5.5e-186
WP_015926401.1|3596096_3597449_-|terminase	terminase	terminase	M9Q2I1	Clostridium_phage	67.4	6.1e-184
WP_015926402.1|3597451_3597964_-|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	58.9	6.3e-33
WP_015926403.1|3598018_3598348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926404.1|3598546_3598981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926405.1|3598993_3599179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926406.1|3599178_3600552_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	74.4	1.3e-202
WP_015926407.1|3600541_3600802_-	VRR-NUC domain-containing protein	NA	A0A1W6JQA8	Corynebacterium_phage	45.3	2.3e-15
WP_015926408.1|3601091_3603461_-	virulence protein E	NA	S5M5Y2	Brevibacillus_phage	64.1	2.8e-309
WP_015926409.1|3603480_3603897_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_081436776.1|3603908_3604844_-	site-specific DNA-methyltransferase	NA	F4YCV3	Synechococcus_phage	58.6	7.6e-101
WP_015926411.1|3604869_3606252_-	helicase	NA	F4YCV3	Synechococcus_phage	53.0	9.1e-135
WP_015926413.1|3606408_3608367_-	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	62.6	5.4e-234
WP_015926414.1|3608380_3608614_-	DUF3072 domain-containing protein	NA	NA	NA	NA	NA
WP_015926415.1|3608652_3608928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926416.1|3609011_3609578_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	76.5	5.1e-76
WP_015926417.1|3609594_3610830_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	64.0	7.6e-141
WP_015926418.1|3610831_3611233_-	hypothetical protein	NA	S5M5X1	Brevibacillus_phage	42.6	3.3e-05
WP_041706800.1|3611257_3611845_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	41.5	7.0e-20
WP_015926420.1|3611891_3612179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926421.1|3612178_3612424_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.5	1.8e-17
WP_015926422.1|3612392_3612593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926423.1|3612597_3612852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926424.1|3612855_3613389_-	NUMOD4 domain-containing protein	NA	A0A1B1P7C2	Bacillus_phage	39.0	2.0e-21
WP_015926426.1|3613629_3613947_-	helix-turn-helix transcriptional regulator	NA	A0A1P8BMR9	Lactococcus_phage	38.5	7.1e-11
WP_015926427.1|3614179_3614530_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	39.5	1.2e-14
WP_015926428.1|3614534_3615125_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_015926429.1|3615121_3616570_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	33.1	1.1e-58
WP_015926430.1|3616873_3617500_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	42.7	3.5e-17
>prophage 13
NC_011898	Ruminiclostridium cellulolyticum H10, complete sequence	4068724	3831150	3862231	4068724	capsid,integrase,terminase	Clostridium_phage(40.0%)	39	3837197:3837211	3865049:3865063
WP_015926627.1|3831150_3833145_-	hypothetical protein	NA	R9TMD0	Paenibacillus_phage	34.9	7.6e-74
WP_015926385.1|3833149_3833509_-	hypothetical protein	NA	R9TNE7	Paenibacillus_phage	42.0	1.9e-23
WP_015926628.1|3833522_3836048_-	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	40.6	1.6e-49
WP_015926629.1|3836040_3836427_-	hypothetical protein	NA	M9Q2I4	Clostridium_phage	50.0	3.2e-29
WP_015926388.1|3836392_3836698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041707069.1|3836736_3837198_-	hypothetical protein	NA	NA	NA	NA	NA
3837197:3837211	attL	ATGTTAATATTTTTA	NA	NA	NA	NA
WP_041707070.1|3837208_3837616_-	hypothetical protein	NA	M9Q2F6	Clostridium_phage	69.8	4.7e-47
WP_015926632.1|3837615_3837999_-	hypothetical protein	NA	M9Q249	Clostridium_phage	52.0	1.6e-33
WP_015926633.1|3837998_3838316_-	hypothetical protein	NA	M9Q2I3	Clostridium_phage	59.4	1.1e-30
WP_015926634.1|3838318_3838681_-	hypothetical protein	NA	M9Q2K9	Clostridium_phage	49.2	3.0e-29
WP_015926635.1|3838693_3838927_-	hypothetical protein	NA	M9Q1H8	Clostridium_phage	52.8	1.2e-07
WP_015926636.1|3838938_3839844_-	hypothetical protein	NA	M9Q2F4	Clostridium_phage	80.0	1.1e-141
WP_015926637.1|3839858_3840440_-	phage scaffolding protein	NA	A0A1Z1LZK8	Bacillus_phage	38.7	2.7e-16
WP_015926397.1|3840589_3840823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926398.1|3840880_3841099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926638.1|3841103_3843035_-	hypothetical protein	NA	M9Q2F2	Clostridium_phage	52.7	1.0e-107
WP_015926639.1|3843015_3844518_-|capsid	phage capsid protein	capsid	M9Q246	Clostridium_phage	62.9	7.2e-186
WP_015926640.1|3844521_3845874_-|terminase	terminase	terminase	M9Q2I1	Clostridium_phage	67.9	9.4e-185
WP_015926641.1|3845876_3846389_-|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	58.2	1.1e-32
WP_041706816.1|3846442_3846709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926643.1|3846890_3847319_-	sigma-70 region 4 domain-containing protein	NA	NA	NA	NA	NA
WP_015926644.1|3847457_3847877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926645.1|3847917_3848328_-	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	73.1	1.3e-52
WP_015926646.1|3848417_3848687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926647.1|3849047_3851273_-	AAA family ATPase	NA	Q5YA88	Bacillus_phage	66.1	1.6e-298
WP_157668478.1|3851289_3852432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926649.1|3852438_3853788_-	ParB/RepB/Spo0J family partition protein	NA	A0A2K9V477	Faecalibacterium_phage	41.3	1.6e-83
WP_015926650.1|3853809_3855420_-	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	76.1	2.3e-238
WP_015926651.1|3855423_3855906_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	51.9	7.2e-39
WP_015926652.1|3855931_3857098_-	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	48.5	1.6e-95
WP_015926653.1|3857097_3858399_-	AAA family ATPase	NA	Q5YA97	Bacillus_phage	65.4	6.5e-151
WP_015926420.1|3858453_3858741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926421.1|3858740_3858986_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.5	1.8e-17
WP_015926654.1|3858954_3859155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926655.1|3859159_3859414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015926656.1|3859486_3859693_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015926657.1|3859715_3859898_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015926658.1|3860094_3860940_+	LexA family transcriptional regulator	NA	A0A2H4J2S9	uncultured_Caudovirales_phage	46.3	3.2e-26
WP_015926659.1|3860959_3862231_+|integrase	site-specific integrase	integrase	Q9T1Z2	Lactococcus_phage	25.7	1.5e-14
3865049:3865063	attR	TAAAAATATTAACAT	NA	NA	NA	NA
