The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	372751	459212	2341328	integrase,tRNA,capsid,head,plate,terminase,tail,portal	Acidithiobacillus_phage(20.59%)	85	370202:370219	458622:458639
370202:370219	attL	AGTATTAGTTTTTTTATT	NA	NA	NA	NA
WP_012754666.1|372751_375667_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	25.4	7.9e-64
WP_012754667.1|375844_376336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754668.1|376983_377430_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_012754669.1|377699_379100_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_012754670.1|379080_379647_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_012754671.1|380452_380902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754672.1|382602_383934_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_041581338.1|383920_384724_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_012754674.1|384770_385016_+	DUF4170 domain-containing protein	NA	NA	NA	NA	NA
WP_012754675.1|386463_387786_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_012754676.1|387775_388816_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_012754677.1|388835_389072_-	DUF2093 domain-containing protein	NA	NA	NA	NA	NA
WP_012754678.1|389180_391034_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	39.9	3.0e-109
WP_012754679.1|391273_392362_+	2'-deoxycytidine 5'-triphosphate deaminase	NA	NA	NA	NA	NA
WP_012754680.1|393517_394669_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_012754682.1|398669_399332_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	61.7	1.5e-42
WP_012754684.1|400383_400575_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012754685.1|401190_401394_+	SlyX family protein	NA	NA	NA	NA	NA
WP_114648008.1|402466_403897_+	amino acid permease	NA	NA	NA	NA	NA
WP_012754688.1|403937_404618_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.9	1.8e-14
WP_012754689.1|404614_405253_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_012754690.1|405268_405838_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_012754691.1|406095_406641_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_012754692.1|407875_408733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026500227.1|409896_410076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581342.1|412087_412420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754696.1|412571_413036_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_012754697.1|413144_413612_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_026500621.1|416283_416628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754699.1|416898_417369_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_026500622.1|417560_418040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754702.1|419149_419812_+	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	63.6	1.2e-44
WP_012754703.1|419808_420036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041581344.1|420152_420383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754706.1|420407_421193_+	DNA adenine methylase	NA	R9U1F2	Rhizobium_phage	36.8	3.7e-40
WP_012754707.1|421257_421632_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012754708.1|421936_423094_+|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	39.6	6.1e-76
WP_015856478.1|423318_423531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754710.1|423662_423890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754711.1|423886_424549_-	lysozyme	NA	A0A141GEY9	Brucella_phage	59.6	1.3e-46
WP_006589072.1|424708_425011_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	3.4e-18
WP_012754712.1|424997_425318_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	46.2	1.5e-16
WP_012754713.1|425402_426707_-	phage late control protein	NA	K4HZC6	Acidithiobacillus_phage	38.1	1.1e-70
WP_012754714.1|426703_426928_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_006589081.1|426924_427305_-|tail	phage tail protein	tail	D5LGY3	Escherichia_phage	43.1	1.3e-22
WP_012754715.1|427310_429443_-|tail	tail protein	tail	A0A2I5ARC1	Synechococcus_phage	34.5	8.8e-12
WP_114648101.1|429439_429553_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_015857123.1|429549_429837_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012754716.1|429839_430346_-|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.2	4.5e-31
WP_012754717.1|430345_431737_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	54.1	1.7e-133
WP_143711787.1|433253_433706_-|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	53.2	1.0e-34
WP_012754719.1|434380_437524_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	34.5	4.7e-155
WP_012754720.1|437525_438632_-	hypothetical protein	NA	K4I1F8	Acidithiobacillus_phage	37.0	1.1e-21
WP_015857124.1|438631_439459_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	33.1	1.1e-37
WP_041581347.1|439455_439797_-	GPW/gp25 family protein	NA	Q75QM0	Wolbachia_phage	58.7	1.1e-30
WP_012754721.1|439793_440483_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	33.2	1.2e-13
WP_012754722.1|440463_441012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754723.1|441088_441388_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_012754724.1|441374_441647_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_012754725.1|441685_442003_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_041581349.1|442082_442361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754727.1|442357_443095_-	phage antirepressor Ant	NA	A0A139ZPI9	Marinitoga_camini_virus	42.7	9.7e-43
WP_012754728.1|443432_443786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754729.1|443787_444864_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	34.9	1.1e-55
WP_041581350.1|444876_445245_-|head	head decoration protein	head	Q6VT10	Vibrio_phage	42.1	3.1e-05
WP_041581352.1|445241_445508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581525.1|445504_446587_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	48.8	4.5e-65
WP_012754732.1|446576_448121_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	41.3	2.3e-94
WP_015857126.1|448120_448369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754733.1|448372_450319_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	52.3	1.2e-164
WP_012754734.1|450308_450878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026500577.1|451245_451830_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	33.8	2.7e-11
WP_026500578.1|451833_452148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754737.1|452466_452862_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	34.3	2.7e-07
WP_007553727.1|452858_453059_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	48.2	1.4e-07
WP_012754738.1|453126_453663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026500580.1|453674_454127_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	59.1	3.3e-33
WP_004859817.1|454428_454620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006589119.1|454686_455115_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJC0	Moraxella_phage	36.3	3.9e-12
WP_026500581.1|455162_455441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754741.1|455437_456181_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	38.7	8.0e-45
WP_012754742.1|456559_457075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754743.1|457061_457409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172607525.1|457591_457939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754745.1|457961_459212_-	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	48.0	2.3e-12
458622:458639	attR	AGTATTAGTTTTTTTATT	NA	NA	NA	NA
>prophage 2
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	907699	981922	2341328	integrase,terminase,capsid,portal	Edwardsiella_phage(21.43%)	58	926065:926096	987039:987070
WP_081429735.1|907699_908062_+	hypothetical protein	NA	A0A141GEX6	Brucella_phage	43.8	7.4e-12
WP_012755081.1|908042_908363_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	43.8	6.3e-15
WP_012755082.1|909665_910709_-|integrase	tyrosine-type recombinase/integrase	integrase	I3UM24	Rhodobacter_phage	26.3	2.4e-18
WP_012755083.1|910715_910934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581371.1|911077_911566_-	DUF488 family protein	NA	A0A1B3AYW8	Gordonia_phage	30.8	1.0e-08
WP_012755085.1|911635_912259_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	44.9	3.5e-46
WP_012755086.1|912260_913088_-	recombinase RecT	NA	A0A0M3LR26	Mannheimia_phage	43.0	1.5e-39
WP_012755087.1|913161_913731_-	hypothetical protein	NA	K4PWT3	Edwardsiella_phage	55.0	5.4e-09
WP_012755088.1|913736_914126_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	52.7	3.7e-09
WP_012755089.1|914122_914668_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	61.8	2.3e-09
WP_012755090.1|914781_915162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012755091.1|915383_915716_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012755092.1|915829_916111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012755093.1|916121_916709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041581372.1|916719_916902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041581373.1|916931_917180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012755094.1|917169_917793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581374.1|917852_918326_+	phage related protein	NA	K4ICN3	Acidithiobacillus_phage	61.4	8.4e-48
WP_012755096.1|918315_918681_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012755097.1|918670_919813_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_012755098.1|920072_920402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012755100.1|921183_921693_+	antA/AntB antirepressor family protein	NA	A0A139ZPI9	Marinitoga_camini_virus	47.2	2.9e-30
WP_012755101.1|921774_922215_+	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	53.6	2.6e-11
WP_012755102.1|922492_923941_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	35.8	8.8e-72
WP_015857127.1|924029_924305_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	50.7	5.4e-15
WP_012755103.1|925788_926568_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	53.3	5.7e-09
926065:926096	attL	AGCCGAGCCAGAAACCTTGGCATGACCATAGA	NA	NA	NA	NA
WP_015856166.1|926659_927214_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	49.1	1.2e-08
WP_015856167.1|927299_928070_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	58.2	7.8e-11
WP_015856168.1|929569_934480_-	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	27.1	1.6e-48
WP_015856169.1|935295_937092_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_015856170.1|937117_945313_+	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_015856171.1|945309_945717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856172.1|945940_946141_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_081429736.1|946350_947517_-|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	39.0	6.2e-76
WP_041581379.1|947938_948277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856174.1|948263_948794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856175.1|948803_949427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856176.1|949631_949964_+	hypothetical protein	NA	A0A088FAU1	Sulfitobacter_phage	42.5	2.7e-08
WP_015856177.1|949944_951279_+|terminase	terminase	terminase	A0A088F6U9	Sulfitobacter_phage	56.0	4.3e-142
WP_015856178.1|951263_953273_+|portal	phage portal protein	portal	I6NV36	Burkholderia_virus	23.6	6.3e-36
WP_015856179.1|953286_954180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856180.1|954273_955401_+|capsid	N4-gp56 family major capsid protein	capsid	A0A248SKT9	Klebsiella_phage	33.2	5.1e-43
WP_015856181.1|955421_955802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856182.1|955813_956194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856185.1|957443_958223_-	hypothetical protein	NA	K4Q356	Edwardsiella_phage	52.4	5.7e-09
WP_015856186.1|958333_958858_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	51.7	6.9e-11
WP_015856187.1|958940_959774_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	56.6	9.4e-10
WP_015856188.1|961420_966385_-	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	28.3	2.7e-43
WP_015856189.1|967020_968817_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_049757440.1|976368_977475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041581383.1|977471_977879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041581385.1|977866_978088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856192.1|978071_978479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081429758.1|978749_979298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856193.1|979294_979699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856194.1|979881_980241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856195.1|980344_980545_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_015856196.1|980755_981922_-|integrase	site-specific integrase	integrase	A0A088F800	Sulfitobacter_phage	42.5	2.3e-75
987039:987070	attR	AGCCGAGCCAGAAACCTTGGCATGACCATAGA	NA	NA	NA	NA
>prophage 3
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	1005411	1037128	2341328	tail,integrase	Escherichia_phage(25.0%)	38	1005033:1005048	1031799:1031814
1005033:1005048	attL	AACGTTGCTGTTTTGC	NA	NA	NA	NA
WP_015856214.1|1005411_1006578_-|integrase	site-specific integrase	integrase	A0A088F800	Sulfitobacter_phage	41.7	9.8e-74
WP_015856215.1|1006802_1007228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856216.1|1007229_1008159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856217.1|1008192_1009593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856218.1|1009594_1011781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856219.1|1011797_1012463_+	transglycosylase SLT domain-containing protein	NA	L7TQZ1	Rhizobium_phage	48.6	2.5e-29
WP_015856220.1|1012475_1013477_+|tail	phage tail protein	tail	D5LGZ0	Escherichia_phage	35.8	1.6e-19
WP_015856221.1|1013485_1014499_+|tail	phage tail protein	tail	D5LGZ0	Escherichia_phage	43.0	3.4e-14
WP_015856222.1|1014506_1015634_+|tail	tail fiber protein	tail	D5LGZ0	Escherichia_phage	49.5	5.1e-19
WP_015856223.1|1015643_1015877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856224.1|1015898_1020011_+	hypothetical protein	NA	H7BUU8	unidentified_phage	28.6	2.1e-17
WP_015856225.1|1020020_1020350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856226.1|1020413_1021076_+	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	65.6	3.8e-46
WP_012754703.1|1021072_1021300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041581344.1|1021416_1021647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754703.1|1022483_1022711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041581344.1|1022827_1023058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754706.1|1023082_1023868_+	DNA adenine methylase	NA	R9U1F2	Rhizobium_phage	36.8	3.7e-40
WP_015856229.1|1024185_1025337_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1X9HVL9	Ruegeria_phage	39.3	6.7e-75
WP_015856478.1|1025511_1025724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856231.1|1025855_1026083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856232.1|1026079_1026742_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	60.2	1.5e-47
WP_015857128.1|1026924_1027248_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	53.2	1.5e-16
WP_015856233.1|1027260_1027572_+	addiction module antidote protein	NA	NA	NA	NA	NA
WP_015856234.1|1027617_1027896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856235.1|1027892_1028654_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	29.1	7.2e-17
WP_004859798.1|1028646_1028850_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_015856236.1|1028925_1029150_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_015856237.1|1029126_1029546_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	53.6	6.5e-28
WP_015856238.1|1029849_1031166_-	phage late control protein	NA	K4HZC6	Acidithiobacillus_phage	38.7	4.4e-70
WP_015856239.1|1031162_1031387_-|tail	tail protein X	tail	R9TR63	Vibrio_phage	50.0	4.1e-05
WP_015856240.1|1031383_1031764_-|tail	phage tail protein	tail	D5LGY3	Escherichia_phage	43.9	4.4e-23
WP_015856241.1|1031769_1034067_-|tail	tail protein	tail	A0A0E3U2N9	Fusobacterium_phage	25.4	1.7e-13
1031799:1031814	attR	AACGTTGCTGTTTTGC	NA	NA	NA	NA
WP_114648101.1|1034063_1034177_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_015857123.1|1034173_1034461_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012754716.1|1034463_1034970_-|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.2	4.5e-31
WP_015856242.1|1034969_1036181_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	52.7	2.9e-129
WP_015856243.1|1036537_1037128_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	48.8	4.4e-22
>prophage 4
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	1040309	1065911	2341328	capsid,head,plate,terminase,portal	Acidithiobacillus_phage(33.33%)	35	NA	NA
WP_015856248.1|1040309_1043453_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	34.4	5.2e-154
WP_012754720.1|1043454_1044561_-	hypothetical protein	NA	K4I1F8	Acidithiobacillus_phage	37.0	1.1e-21
WP_015857129.1|1044560_1045388_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	33.5	3.6e-38
WP_026500562.1|1045384_1045726_-	GPW/gp25 family protein	NA	Q75QM0	Wolbachia_phage	58.7	3.0e-31
WP_012754721.1|1045722_1046412_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	33.2	1.2e-13
WP_012754722.1|1046392_1046941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754723.1|1047017_1047317_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_012754724.1|1047303_1047576_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_012754725.1|1047614_1047932_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_041581349.1|1048010_1048289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856249.1|1048285_1049017_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	39.8	6.4e-47
WP_006589102.1|1049436_1050333_-	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	50.9	1.6e-07
WP_015856250.1|1050363_1050717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754729.1|1050718_1051795_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	34.9	1.1e-55
WP_041581564.1|1051807_1052176_-|head	head decoration protein	head	Q6VT10	Vibrio_phage	42.1	3.1e-05
WP_026500571.1|1052172_1052439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581566.1|1052435_1053509_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	49.1	1.2e-65
WP_012754732.1|1053498_1055043_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	41.3	2.3e-94
WP_015857126.1|1055042_1055291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754733.1|1055294_1057241_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	52.3	1.2e-164
WP_012754734.1|1057230_1057800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026500577.1|1058167_1058752_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	33.8	2.7e-11
WP_015856253.1|1058755_1059070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856254.1|1059419_1059602_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_015856255.1|1059622_1060045_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	35.7	3.7e-15
WP_015856256.1|1060048_1060591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856257.1|1060602_1061058_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	58.3	3.6e-32
WP_015856258.1|1061194_1061575_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015856259.1|1061607_1062474_-	DNA adenine methylase	NA	A0A2K9R7J9	Dishui_lake_phycodnavirus	24.6	2.2e-14
WP_012754742.1|1062586_1063102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581397.1|1063088_1063436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172607525.1|1063616_1063964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856261.1|1063986_1065114_-	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	44.0	9.7e-10
WP_041581398.1|1065103_1065439_-	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_015856263.1|1065428_1065911_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	65.2	3.1e-50
>prophage 5
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	1123116	1151153	2341328	integrase,capsid,terminase,tail,portal	Ochrobactrum_phage(13.64%)	37	1111736:1111752	1159172:1159188
1111736:1111752	attL	TATATTTATAAGGTGAA	NA	NA	NA	NA
WP_015856305.1|1123116_1123578_+|tail	phage tail protein	tail	A0A219VHA8	Ochrobactrum_phage	40.8	3.7e-24
WP_015856306.1|1123574_1123829_+|tail	tail protein X	tail	A0A219VHB0	Ochrobactrum_phage	49.4	5.5e-14
WP_041581568.1|1123828_1124851_+	phage late control protein	NA	A0A219VHA9	Ochrobactrum_phage	52.5	1.9e-89
WP_041581402.1|1124807_1126268_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	35.9	1.8e-72
WP_004854509.1|1126665_1126947_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.1	1.1e-15
WP_015856309.1|1126962_1127262_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	48.9	2.8e-17
WP_015856310.1|1127299_1128337_-|integrase	tyrosine-type recombinase/integrase	integrase	I3UM24	Rhodobacter_phage	26.8	8.9e-18
WP_015857131.1|1128339_1128588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856311.1|1128663_1129119_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	59.1	3.1e-07
WP_015856312.1|1129115_1129661_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	55.6	5.2e-09
WP_015856313.1|1129793_1130282_-	DUF488 family protein	NA	A0A1B3AYW8	Gordonia_phage	31.1	2.7e-09
WP_015856314.1|1130349_1130973_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	43.9	2.1e-46
WP_015856317.1|1131907_1132666_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	41.8	7.1e-41
WP_015856318.1|1132730_1133105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856319.1|1133263_1133881_-	helix-turn-helix domain-containing protein	NA	A0A1X9HW95	Ruegeria_phage	41.8	1.5e-17
WP_015856320.1|1133990_1134242_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015856321.1|1134369_1135500_+	YdaU family protein	NA	A0A076GD06	Sinorhizobium_phage	41.8	3.3e-18
WP_172607525.1|1135522_1135870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754743.1|1136052_1136400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004854238.1|1137031_1137337_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	40.0	7.4e-05
WP_015856322.1|1137314_1137614_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_041581404.1|1137807_1138251_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	61.7	8.4e-34
WP_015856324.1|1138304_1138799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007346764.1|1138895_1139123_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_015856325.1|1139106_1139376_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SB46	Streptococcus_phage	46.3	2.9e-13
WP_041581407.1|1139926_1140412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581409.1|1140481_1140859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856329.1|1141157_1141472_+	hypothetical protein	NA	A0A088FAU1	Sulfitobacter_phage	40.2	9.6e-08
WP_015856330.1|1141452_1142778_+|terminase	terminase	terminase	A0A088F6U9	Sulfitobacter_phage	57.4	2.4e-145
WP_015856331.1|1142762_1144817_+|portal	phage portal protein	portal	C5IHN8	Burkholderia_virus	23.6	1.2e-29
WP_015856332.1|1144828_1145740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856333.1|1145837_1146983_+|capsid	N4-gp56 family major capsid protein	capsid	A0A248SKT9	Klebsiella_phage	31.6	8.8e-35
WP_015856334.1|1147002_1147443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856335.1|1147515_1148214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856336.1|1148213_1149671_+	hypothetical protein	NA	D6PEY0	uncultured_phage	28.2	1.1e-42
WP_041581411.1|1149712_1150096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856338.1|1150097_1151153_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
1159172:1159188	attR	TATATTTATAAGGTGAA	NA	NA	NA	NA
>prophage 6
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	1390109	1398535	2341328		uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_015856522.1|1390109_1390622_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.2	8.5e-46
WP_015856523.1|1390640_1391234_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	53.9	1.1e-44
WP_015856524.1|1391236_1391743_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	35.2	5.8e-23
WP_015856525.1|1391767_1394551_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.2	9.2e-102
WP_015856526.1|1394779_1395286_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	67.3	2.0e-47
WP_015856527.1|1395619_1398535_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.4	0.0e+00
>prophage 7
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	1806254	1885850	2341328	tail,integrase	Ochrobactrum_phage(41.67%)	43	1797287:1797304	1880306:1880323
1797287:1797304	attL	ACATATTTTTCAATAAAA	NA	NA	NA	NA
WP_015856774.1|1806254_1807436_-|integrase	site-specific integrase	integrase	A0A088F800	Sulfitobacter_phage	42.8	1.5e-77
WP_015856775.1|1807662_1808043_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	47.0	2.2e-14
WP_015856776.1|1809314_1810346_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015856777.1|1810627_1811260_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_015856778.1|1811780_1812599_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015856779.1|1812626_1813661_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	2.1e-27
WP_015856780.1|1813653_1814313_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015856781.1|1815257_1815737_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_015856782.1|1815900_1817235_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_015856783.1|1818024_1818381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856784.1|1820677_1821421_+	creatininase family protein	NA	NA	NA	NA	NA
WP_015856785.1|1821442_1822465_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_015856786.1|1822475_1823447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856787.1|1823701_1827340_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_015856788.1|1827492_1830981_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_143711779.1|1833234_1833570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856789.1|1834054_1837480_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_015856790.1|1837923_1840764_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_026500773.1|1841925_1845060_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081429763.1|1845734_1851224_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_015856793.1|1852351_1853302_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015856794.1|1853404_1854361_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	43.8	1.2e-64
WP_015856795.1|1854353_1855304_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_015856796.1|1855300_1856059_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.1	1.0e-15
WP_041581402.1|1856350_1857811_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	35.9	1.8e-72
WP_041581595.1|1857767_1858790_-	phage late control protein	NA	A0A219VHA9	Ochrobactrum_phage	52.2	8.0e-88
WP_015856683.1|1858789_1859044_-|tail	tail protein X	tail	A0A219VHB0	Ochrobactrum_phage	49.4	9.4e-14
WP_015856305.1|1859040_1859502_-|tail	phage tail protein	tail	A0A219VHA8	Ochrobactrum_phage	40.8	3.7e-24
WP_015856798.1|1859588_1861925_-|tail	phage tail tape measure protein	tail	A0A219VHB3	Ochrobactrum_phage	50.1	3.9e-114
WP_015856799.1|1862056_1862470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856800.1|1862479_1862998_-|tail	phage major tail tube protein	tail	A0A219VHB2	Ochrobactrum_phage	64.1	2.9e-62
WP_015856802.1|1864290_1864500_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_143711780.1|1864514_1865756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856804.1|1865844_1867713_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_015856805.1|1867808_1868987_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_015856807.1|1870492_1870693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856810.1|1873452_1874673_+	MFS transporter	NA	NA	NA	NA	NA
WP_015856811.1|1876517_1877717_+	porin	NA	NA	NA	NA	NA
WP_015856812.1|1879018_1879825_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	33.5	3.1e-10
WP_015856813.1|1880684_1882859_-	isocitrate/isopropylmalate dehydrogenase family protein	NA	NA	NA	NA	NA
1880306:1880323	attR	ACATATTTTTCAATAAAA	NA	NA	NA	NA
WP_015856814.1|1882855_1883587_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015856815.1|1883848_1885045_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_015856816.1|1885676_1885850_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 8
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	1919152	1979166	2341328	integrase,capsid,head,terminase,tail,portal	Caulobacter_phage(31.25%)	31	1947625:1947659	1984423:1984457
WP_015857133.1|1919152_1920292_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_015856829.1|1920288_1920771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856830.1|1921050_1922514_-	hypothetical protein	NA	D6PEY0	uncultured_phage	27.8	7.8e-44
WP_015856831.1|1923018_1923714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015856832.1|1923796_1924915_-|capsid	N4-gp56 family major capsid protein	capsid	A0A248SKT9	Klebsiella_phage	33.2	1.1e-42
WP_015856833.1|1925208_1925982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581454.1|1926291_1928127_-|portal	phage portal protein	portal	I6NV36	Burkholderia_virus	23.9	1.6e-33
WP_015856835.1|1928126_1929488_-|terminase	terminase	terminase	A0A088F6U9	Sulfitobacter_phage	55.1	4.9e-141
WP_172607508.1|1930372_1930534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581600.1|1930691_1931015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041581456.1|1932213_1932585_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	57.7	1.8e-13
WP_081429746.1|1933395_1933698_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	56.1	1.9e-08
WP_015856838.1|1937376_1937748_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	52.8	2.9e-11
WP_041581461.1|1938506_1938878_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	55.1	2.0e-12
WP_041581463.1|1939626_1939998_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	52.8	2.2e-11
WP_015856841.1|1940322_1941393_-|head	phage head protein	head	NA	NA	NA	NA
WP_015856842.1|1942230_1944810_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.5	4.8e-121
WP_015856843.1|1945365_1946388_+	hypothetical protein	NA	NA	NA	NA	NA
1947625:1947659	attL	ATATACGTTTTCACGCTTTTACACATTCACAGAAT	NA	NA	NA	NA
WP_015856844.1|1948539_1948911_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	49.3	6.4e-11
WP_015856765.1|1950771_1951551_-	hypothetical protein	NA	K4Q356	Edwardsiella_phage	54.0	2.5e-09
WP_041581422.1|1951641_1952094_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	53.4	2.7e-11
WP_015856203.1|1952177_1953011_-	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	56.6	5.5e-10
WP_026500656.1|1954345_1954603_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_041581390.1|1955436_1955616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856846.1|1955608_1957369_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_026500596.1|1965649_1966003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856848.1|1966009_1968622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015856771.1|1974988_1976596_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_041581449.1|1976608_1977508_-	toprim domain-containing protein	NA	A0A2I6UGE7	Salinibacter_virus	55.0	2.0e-05
WP_015856773.1|1977607_1977808_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_015856774.1|1977984_1979166_-|integrase	site-specific integrase	integrase	A0A088F800	Sulfitobacter_phage	42.8	1.5e-77
1984423:1984457	attR	ATATACGTTTTCACGCTTTTACACATTCACAGAAT	NA	NA	NA	NA
>prophage 9
NC_012846	Bartonella grahamii as4aup, complete sequence	2341328	2237636	2245783	2341328	transposase	Rhizobium_phage(33.33%)	11	NA	NA
WP_015857042.1|2237636_2238605_+	tyrosine recombinase XerC	NA	A0A0B5GXV1	Mycobacterium_phage	29.5	3.3e-14
WP_015857043.1|2238625_2238898_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_015857044.1|2239022_2239643_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_015857045.1|2239844_2240825_+	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	34.6	6.0e-40
WP_015857046.1|2240839_2242735_+	cobaltochelatase subunit CobT	NA	L7TNG1	Rhizobium_phage	29.8	9.2e-21
WP_187147391.1|2242785_2243322_-	HaeIII family restriction endonuclease	NA	NA	NA	NA	NA
WP_026500177.1|2243290_2243638_-	HaeIII family restriction endonuclease	NA	NA	NA	NA	NA
WP_026500176.1|2243690_2244068_-	DNA adenine methylase	NA	A0A2K9R7J9	Dishui_lake_phycodnavirus	40.8	7.2e-18
WP_049757454.1|2244103_2244541_-	DNA adenine methylase	NA	A0A0E3HSH4	Synechococcus_phage	37.1	1.4e-09
WP_162147208.1|2244582_2244723_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015857047.1|2245099_2245783_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	33.3	1.3e-20
