The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	350356	418937	3812301	integrase,transposase,tRNA,protease	uncultured_virus(23.08%)	57	364251:364268	390722:390739
WP_015869797.1|350356_351568_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.2e-47
WP_015869798.1|351626_352835_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
WP_015869799.1|353101_355099_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_015869800.1|355277_355673_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_015869801.1|355669_356662_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_050977389.1|356673_358107_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_015869803.1|358120_358474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015869804.1|358480_360016_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_015869805.1|360061_360280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041730623.1|360438_360996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525679.1|361116_361818_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_035608635.1|362841_363765_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_015869809.1|363785_364208_+	hypothetical protein	NA	NA	NA	NA	NA
364251:364268	attL	AGGGCTGCGGCTTTTTTA	NA	NA	NA	NA
WP_071525680.1|364612_364951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035608665.1|365496_366459_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.1	1.1e-46
WP_015869812.1|366566_367502_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_015869813.1|367620_368304_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	40.6	1.3e-30
WP_015869814.1|368529_370116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015869815.1|370108_375070_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015869816.1|375658_377131_+	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	28.9	1.5e-42
WP_015869817.1|377124_378717_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_015869818.1|378777_379788_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	24.3	1.7e-05
WP_015869819.1|380655_381294_+	YfdX family protein	NA	NA	NA	NA	NA
WP_015869820.1|381357_381933_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015869821.1|381964_383692_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_049640710.1|383667_384036_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_015869823.1|384172_385474_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_015869824.1|385589_387026_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_015869825.1|387390_387867_+	FxsA family protein	NA	NA	NA	NA	NA
WP_015869826.1|388084_388378_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	8.6e-11
WP_015869827.1|388437_390081_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.6	4.3e-184
WP_015869828.1|390330_390678_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_015869829.1|390761_391457_-	lactate utilization protein C	NA	NA	NA	NA	NA
390722:390739	attR	AGGGCTGCGGCTTTTTTA	NA	NA	NA	NA
WP_015869830.1|391456_392878_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_015869831.1|392888_393608_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_015869832.1|393657_395211_-	L-lactate permease	NA	NA	NA	NA	NA
WP_015869833.1|395449_396478_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_015869834.1|396525_397092_+	elongation factor P	NA	NA	NA	NA	NA
WP_035608643.1|397282_397600_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_035608668.1|397670_398027_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_015869837.1|398043_398442_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_015869838.1|398458_399193_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_015869839.1|399185_400985_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	28.1	1.5e-17
WP_015869841.1|401457_402435_+	elongation factor P--(R)-beta-lysine ligase	NA	NA	NA	NA	NA
WP_015869844.1|403576_404476_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_015869845.1|404570_405614_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_015869846.1|405763_406309_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	3.9e-25
WP_015869847.1|407105_408245_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_035610004.1|408243_409740_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_015869849.1|409770_410235_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_172468374.1|410314_411883_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	U5PWK4	Bacillus_virus	26.9	6.0e-18
WP_015869851.1|411899_413819_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	38.2	1.5e-58
WP_015869852.1|413811_414765_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_014524170.1|414927_415236_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_015869853.1|415334_416615_+	GTPase HflX	NA	NA	NA	NA	NA
WP_015869854.1|416673_417933_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	29.1	6.2e-05
WP_015869855.1|417932_418937_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 2
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	899762	956883	3812301	transposase	Streptococcus_phage(20.0%)	59	NA	NA
WP_015870302.1|899762_900788_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_165798050.1|901870_902281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015870305.1|902408_903344_-	glutaminase A	NA	NA	NA	NA	NA
WP_015870306.1|903428_905003_-	amino acid permease	NA	NA	NA	NA	NA
WP_015870307.1|905039_906434_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_015870308.1|907194_908253_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_015870309.1|908352_909606_+	peptidase T	NA	NA	NA	NA	NA
WP_015870310.1|909602_910964_+	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_015870311.1|911096_911657_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	51.9	4.9e-47
WP_015870312.1|911704_913165_-	beta-Ala-His dipeptidase	NA	NA	NA	NA	NA
WP_015870313.1|913581_914040_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015870314.1|914224_915490_+	esterase FrsA	NA	NA	NA	NA	NA
WP_015870315.1|915551_915953_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_015870316.1|916145_917252_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.6	1.4e-58
WP_015870317.1|917261_918515_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.5	1.9e-86
WP_035609979.1|918583_919615_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107775293.1|920127_920514_+	hypothetical protein	NA	K7P7N0	Enterobacteria_phage	45.0	7.9e-20
WP_015870321.1|920879_922088_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	43.6	3.1e-46
WP_107775185.1|922787_923899_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	1.7e-06
WP_081167836.1|923872_924361_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_015869530.1|924724_925933_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
WP_015870325.1|926213_926813_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_015870326.1|926822_927611_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015870327.1|927655_927949_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
WP_015870330.1|929613_930639_-	type III secretion protein	NA	NA	NA	NA	NA
WP_015870331.1|930631_931285_-	type III secretion protein	NA	NA	NA	NA	NA
WP_015870332.1|931281_931836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870333.1|931832_932564_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_015870334.1|932560_932812_-	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_015870335.1|932808_933075_-	EscG/YscG/SsaH family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_015870336.1|933079_933301_-	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_035608757.1|933325_934018_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015870338.1|934103_934328_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_015870339.1|934338_935538_-	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_015870340.1|935545_937030_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_015870341.1|937026_937473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870342.1|937554_938457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870343.1|938475_938967_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015870345.1|939123_939507_-	type III secretion protein	NA	NA	NA	NA	NA
WP_015870346.1|939520_940102_-	type III secretion protein	NA	NA	NA	NA	NA
WP_015870347.1|940117_941560_-	type III secretion system translocon protein	NA	NA	NA	NA	NA
WP_015870348.1|941556_942024_-	SycD/LcrH family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_015870349.1|942034_942631_-	secretion protein EspA	NA	NA	NA	NA	NA
WP_015870350.1|942655_943003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870351.1|943306_944221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870352.1|944198_944678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870353.1|944674_945043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870354.1|945036_946353_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_015870355.1|946339_948397_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_015870356.1|948380_948761_-	type III secretion protein	NA	NA	NA	NA	NA
WP_015870357.1|948940_949588_+	type III secretion system export apparatus subunit SctR	NA	NA	NA	NA	NA
WP_015870358.1|949604_949874_+	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_015870359.1|949876_950656_+	type III secretion system export apparatus subunit SctT	NA	NA	NA	NA	NA
WP_015870360.1|950652_951708_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_015870361.1|951700_952357_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.8	1.6e-25
WP_015870362.1|952368_955104_+	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.1	1.6e-26
WP_015870363.1|955100_955745_-	two component system response regulator	NA	NA	NA	NA	NA
WP_107775292.1|956301_956466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015870365.1|956565_956883_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	66.3	6.4e-28
>prophage 3
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	1412189	1488491	3812301	transposase	Burkholderia_phage(25.0%)	59	NA	NA
WP_107775203.1|1412189_1412992_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	1.6e-27
WP_015870784.1|1413138_1413483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870786.1|1414069_1414339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015870787.1|1414708_1415641_+	DUF4396 domain-containing protein	NA	NA	NA	NA	NA
WP_015870788.1|1415742_1415979_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_158405943.1|1417393_1417570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870791.1|1417659_1418256_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_015870792.1|1418881_1420216_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_015870793.1|1420498_1421965_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_035609568.1|1422101_1422683_+	hydrolase	NA	NA	NA	NA	NA
WP_015870795.1|1422734_1424348_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_015870796.1|1424735_1426484_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_015870799.1|1427220_1427955_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015870801.1|1429506_1429854_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_015870803.1|1430588_1431494_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_035609578.1|1433239_1435378_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_015870808.1|1435447_1435942_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_015870810.1|1436120_1437788_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.1	1.3e-10
WP_015870811.1|1437933_1439532_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.3	3.3e-11
WP_035609580.1|1439588_1440464_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_015870813.1|1440460_1441513_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	34.6	1.4e-05
WP_015870814.1|1441609_1441999_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	5.9e-07
WP_015870815.1|1442008_1442650_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_015870818.1|1443015_1444122_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_015870820.1|1444338_1444902_+	DedA family protein	NA	NA	NA	NA	NA
WP_015870821.1|1445008_1445314_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_015870822.1|1445371_1446652_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015870823.1|1446670_1447948_-	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_015870824.1|1448087_1449014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015870825.1|1449723_1451193_-	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_015870826.1|1451197_1452346_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_015870827.1|1452617_1453517_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015870828.1|1453810_1454305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015870829.1|1454386_1455124_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_015870830.1|1455134_1455782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015870831.1|1456015_1457215_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.6	9.3e-35
WP_015870832.1|1457263_1458679_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	1.3e-104
WP_071525720.1|1458987_1459515_-	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	44.9	1.7e-28
WP_107775162.1|1461111_1461914_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015870837.1|1462850_1463327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870838.1|1463592_1464279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525716.1|1464580_1464658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870840.1|1464940_1465480_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_015870842.1|1465755_1467129_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.7	1.1e-52
WP_041730659.1|1467820_1468237_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	6.0e-42
WP_015870847.1|1469972_1470536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015870848.1|1470633_1471047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107775162.1|1471043_1471846_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015870849.1|1472004_1472205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015870850.1|1472282_1474853_+	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_015870851.1|1474845_1475451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148276972.1|1475486_1476641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169315015.1|1477627_1478367_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.6	2.9e-23
WP_015870859.1|1479770_1480964_-	adenylate cyclase	NA	NA	NA	NA	NA
WP_107775287.1|1481924_1482407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870865.1|1484269_1484710_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_050977385.1|1484777_1485608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870868.1|1486633_1487713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015870869.1|1488191_1488491_+|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	70.0	3.9e-19
>prophage 4
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	1663552	1717349	3812301	transposase,protease	uncultured_virus(21.43%)	49	NA	NA
WP_015871042.1|1663552_1664599_+|protease	protease SohB	protease	A0A2I6UG67	Salinibacter_virus	33.0	1.1e-12
WP_015871043.1|1664665_1664917_-	YciN family protein	NA	NA	NA	NA	NA
WP_015871044.1|1665316_1667917_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	35.6	6.6e-86
WP_071525669.1|1668088_1668472_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	33.0	1.2e-09
WP_015870371.1|1668563_1669772_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
WP_015871047.1|1670823_1671798_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_071525740.1|1672571_1672688_+	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
WP_004094893.1|1672729_1672939_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	76.6	3.5e-22
WP_015871049.1|1673125_1673929_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_015871050.1|1673961_1674432_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_015871051.1|1674497_1675361_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_012848409.1|1675378_1676179_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_015871052.1|1676235_1677201_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_015871053.1|1677837_1679394_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.2	8.1e-39
WP_015871056.1|1680808_1681186_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_015871057.1|1681655_1683029_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_015871058.1|1683296_1683932_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.7	5.1e-24
WP_015871059.1|1683942_1685322_-	MFS transporter	NA	NA	NA	NA	NA
WP_015871060.1|1685500_1686289_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_015871061.1|1686386_1687778_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_015871062.1|1688034_1688580_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.8	1.7e-07
WP_015871063.1|1688726_1689386_-	hexitol phosphatase HxpB	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	25.3	2.4e-08
WP_015871064.1|1689575_1690121_+	YniB family protein	NA	NA	NA	NA	NA
WP_015871065.1|1690161_1691034_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_015871066.1|1691127_1691451_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_015871067.1|1691614_1692271_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_015871069.1|1692619_1693903_+	septum site-determining protein	NA	NA	NA	NA	NA
WP_015871070.1|1693988_1694600_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_015871071.1|1694593_1695391_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.2	1.3e-05
WP_015871072.1|1695384_1696197_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015871073.1|1696186_1697161_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081490051.1|1697160_1698750_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015871076.1|1699081_1699441_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_015871077.1|1699668_1701582_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_172468362.1|1701588_1701762_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_015871080.1|1701981_1702416_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	50.0	1.2e-27
WP_015871081.1|1702704_1702899_+	DUF2767 family protein	NA	NA	NA	NA	NA
WP_015871082.1|1703013_1703835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871084.1|1704395_1705148_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_015871085.1|1705460_1706669_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
WP_158405945.1|1706659_1706878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081490024.1|1707128_1707308_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_015871088.1|1707358_1708354_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_015871089.1|1708346_1709225_-	ketose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_015871090.1|1709228_1709912_-	D-lyxose/D-mannose family sugar isomerase	NA	NA	NA	NA	NA
WP_015871091.1|1709922_1710891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871092.1|1710896_1712315_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_015870371.1|1712603_1713812_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
WP_107775286.1|1716651_1717349_-|transposase	IS1-like element ISEic1 family transposase	transposase	A0A077SLN4	Escherichia_phage	57.1	3.3e-77
>prophage 5
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	1815677	1825013	3812301	tRNA	Tupanvirus(16.67%)	11	NA	NA
WP_015871207.1|1815677_1817606_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	7.4e-127
WP_015871208.1|1817609_1818152_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.1	9.7e-16
WP_005293643.1|1818249_1818447_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_015871209.1|1818490_1818847_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_193352018.1|1819009_1819054_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_015871210.1|1819234_1820218_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	8.4e-34
WP_015871211.1|1820232_1822620_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.7	2.8e-06
WP_015871212.1|1822624_1822921_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	4.2e-13
WP_015871213.1|1823010_1823214_+	protein DsrB	NA	NA	NA	NA	NA
WP_035609110.1|1823194_1824229_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_015871215.1|1824218_1825013_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	2.1e-06
>prophage 6
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	1854180	1977141	3812301	capsid,holin,tail,terminase,protease,integrase,transposase,tRNA	Shigella_phage(19.05%)	106	1913736:1913795	1975095:1975861
WP_015871245.1|1854180_1855116_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	88.3	7.0e-131
WP_015871247.1|1855347_1855659_+	DoxX family protein	NA	NA	NA	NA	NA
WP_015871248.1|1855759_1857796_-	formate-dependent uric acid utilization protein AegA	NA	NA	NA	NA	NA
WP_015871250.1|1858159_1861690_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_015871252.1|1861887_1862220_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_015871253.1|1862259_1862913_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.4	1.7e-19
WP_015871254.1|1863102_1863360_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_015871255.1|1863374_1863794_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_035609101.1|1864084_1864291_+	glycogen synthase	NA	NA	NA	NA	NA
WP_015871258.1|1864363_1865356_-	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	40.6	1.6e-61
WP_015871259.1|1865559_1868163_+	YdbH family protein	NA	NA	NA	NA	NA
WP_012848609.1|1868155_1868350_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_012848608.1|1868359_1868686_+	YdbL family protein	NA	NA	NA	NA	NA
WP_015871260.1|1868833_1872718_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.2	3.4e-54
WP_015871261.1|1872735_1873548_-|protease	serine protease	protease	NA	NA	NA	NA
WP_107775280.1|1873989_1874673_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_015871264.1|1875008_1876247_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_107775159.1|1876510_1877208_-|transposase	IS1-like element ISEic1 family transposase	transposase	A0A077SLN4	Escherichia_phage	56.7	3.3e-77
WP_015871265.1|1877342_1878068_+	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_015871266.1|1878377_1879883_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_015871267.1|1879929_1881240_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	25.4	5.6e-17
WP_015871268.1|1881245_1881968_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_107775162.1|1882162_1882964_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015871270.1|1882961_1883573_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_172468363.1|1884330_1884615_+	transporter	NA	NA	NA	NA	NA
WP_015871274.1|1884868_1886260_-	amino acid permease	NA	NA	NA	NA	NA
WP_015871275.1|1886500_1887451_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_015871276.1|1887970_1889497_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_015871277.1|1889509_1890901_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_015871278.1|1890974_1891934_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_015871279.1|1892109_1892868_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_015871280.1|1893410_1895375_+	U32 family peptidase	NA	Q6DW11	Phage_TP	26.9	7.3e-21
WP_015871282.1|1897037_1897334_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_015871283.1|1897352_1897712_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015871284.1|1897931_1899722_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.9	2.1e-14
WP_015871285.1|1900060_1900645_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_035608226.1|1902150_1902462_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015871288.1|1902517_1903447_+	cation transporter	NA	NA	NA	NA	NA
WP_035608229.1|1903719_1904118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155961442.1|1904304_1904481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871294.1|1908161_1908581_+	universal stress protein	NA	NA	NA	NA	NA
WP_107775279.1|1909493_1909730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871296.1|1909885_1910635_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_015871297.1|1910738_1911104_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_015871298.1|1911120_1911393_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_015871299.1|1911422_1912901_-	MFS transporter	NA	NA	NA	NA	NA
WP_051142557.1|1913172_1913784_-	ammonium transporter	NA	NA	NA	NA	NA
1913736:1913795	attL	TAAGAGCCGCTAACAAAACCGAGTTGATTCGAATAACATCAATTCCCATATAGTAGGCAT	NA	NA	NA	NA
WP_107775277.1|1913793_1914601_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.2	8.2e-27
WP_015870371.1|1914598_1915807_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
WP_015871301.1|1916310_1924137_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	49.8	3.8e-230
WP_015869530.1|1924377_1925586_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
WP_015871302.1|1925634_1927011_-	hypothetical protein	NA	M4MHC7	Vibrio_phage	23.1	3.8e-16
WP_035609819.1|1927034_1927295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871304.1|1927294_1927675_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	48.4	7.2e-26
WP_015871305.1|1927762_1928338_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	50.3	8.1e-45
WP_015871306.1|1928348_1928720_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	39.0	1.7e-16
WP_015871307.1|1928716_1930255_-	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	45.0	2.8e-68
WP_015871308.1|1930251_1931880_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	53.6	4.3e-160
WP_015871310.1|1931866_1932046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051142558.1|1932060_1934301_-|tail	tail fiber protein	tail	F1BUP1	Erwinia_phage	52.5	1.6e-19
WP_015871312.1|1934297_1934960_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	55.0	1.4e-61
WP_015871313.1|1934959_1935541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871314.1|1935540_1935984_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	47.2	1.9e-25
WP_015871315.1|1936025_1936421_-	hypothetical protein	NA	A0A088CD63	Shigella_phage	37.7	1.1e-13
WP_015871316.1|1936578_1937835_-|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	72.2	5.1e-169
WP_015871317.1|1937852_1938854_-	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	33.3	6.8e-31
WP_015871318.1|1939141_1939393_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_015871319.1|1939382_1939664_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	1.4e-18
WP_015871320.1|1939735_1941850_-	hypothetical protein	NA	A0A088CE71	Shigella_phage	63.1	4.7e-223
WP_050977403.1|1941846_1943508_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	69.7	7.6e-229
WP_015871322.1|1943500_1944277_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	49.3	1.5e-06
WP_015871324.1|1945119_1945671_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	70.8	2.8e-71
WP_035608895.1|1945673_1946021_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	48.6	3.3e-25
WP_015871326.1|1946104_1946434_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015871327.1|1946408_1946639_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_015871329.1|1947120_1947939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034165088.1|1948027_1948543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871332.1|1949895_1950225_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	88.5	1.3e-39
WP_015871333.1|1950214_1950523_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	90.2	9.0e-43
WP_015871334.1|1950625_1951138_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_071525693.1|1951504_1952014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871335.1|1952014_1953055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871336.1|1953199_1953499_-	DUF1364 domain-containing protein	NA	A0A2I7R6Q3	Vibrio_phage	46.2	3.1e-16
WP_015871337.1|1953501_1954146_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	31.7	1.2e-15
WP_015871339.1|1954255_1954603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871340.1|1954632_1956015_-	AAA family ATPase	NA	I6R0N4	Salmonella_phage	66.0	2.1e-163
WP_015871341.1|1956011_1956950_-	helix-turn-helix domain-containing protein	NA	Q76H52	Enterobacteria_phage	66.3	1.1e-30
WP_071525694.1|1956953_1957142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871343.1|1957151_1957412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871344.1|1957443_1957674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871345.1|1957670_1958027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012848463.1|1958124_1958340_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	49.2	3.5e-09
WP_035608902.1|1958444_1959137_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	48.7	2.5e-56
WP_015871347.1|1959661_1962061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871348.1|1962087_1964946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158405946.1|1964962_1965133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871349.1|1965783_1966086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871350.1|1966193_1968674_+	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	53.2	1.4e-90
WP_015871351.1|1968684_1969755_+	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	61.6	1.8e-82
WP_015871352.1|1969773_1970079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871353.1|1970135_1970285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871354.1|1970313_1970781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871356.1|1971432_1972647_+	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_015871361.1|1973613_1973862_+	excisionase	NA	NA	NA	NA	NA
WP_015871362.1|1973848_1974943_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	41.1	1.4e-61
WP_015869530.1|1975932_1977141_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
1975095:1975861	attR	TAAGAGCCGCTAACAAAACCGAGTTGATTCGAATAACATCAATTCCCATATAGTAGGCATGACACGAAAAATCATCAGTAAGCAGCTCTGGAAATCCTTACAGCCACTTCTGCCGCCCCAACAGCCTTCGTCACGGGGTGGCCGCCCACGCCTTGATGACTATGCCGTTCTCAACGGTATTCTGTTTGTCCTTACGACTGGGATACCGTGGGAGGACTTGCCCCAGTCGCTGGGTTTTGGCAGCGGAATGACGTGCTGGCGTCGCCTACGCGACTGGCAAGCTCAAGGCATCTGGCTGCGACTTCACGTGGCTCTGCTGACCCAGCTACACCAAGCGGGTCACATCGACTGGAGCAGAGCAAGCCTCGATGGCGCGAGCGTAGCCAGCCCCCGGGGGGCCAGGAAACAGGACGTAACCCGACAGACAGAGGAAAGCTGGGCAGTAAACGACACATAGTGGTGGAACGCCAGGGCATACCACTCGCCGTGCTTGTCTCTGGAGCCAATCGCCATGACTCGATAATGTTTGAGCCATTGTTGGATGCCCTCCCGGCGTTAGCAGGCAAGAGAGGACGACCACGATATCGGCCTGACAAGCTACACGCAGACAAGGGGTATGATTTTCGCCGTTGCCGGGATTATCTGAGGCGGCGGGGAATCAAGGCTCGTATTGCCCGGCGAGGCATTGATAGCAATGACCGCTTGGGTCGTTATCGCTGGGTTGTAGAGCGAACTCATGGTTGGTTAGCGGGTTTTGGCAAGCTGCG	NA	NA	NA	NA
>prophage 7
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	2088307	2202624	3812301	capsid,holin,head,tail,plate,terminase,integrase,transposase,portal	Cronobacter_phage(21.15%)	123	2144561:2144620	2191610:2192924
WP_015870371.1|2088307_2089516_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
WP_015871461.1|2089919_2090183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871462.1|2090571_2091015_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050977398.1|2091476_2092106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035608820.1|2092625_2093045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871466.1|2093107_2093992_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012848801.1|2094166_2094292_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_015871467.1|2094748_2094898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871468.1|2094977_2095433_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_015871469.1|2095651_2096845_+	CoA transferase	NA	NA	NA	NA	NA
WP_050977401.1|2096885_2097812_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_015871471.1|2097860_2099126_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_015871472.1|2099134_2099638_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_015871473.1|2099627_2100803_+	proline racemase family protein	NA	NA	NA	NA	NA
WP_015871474.1|2100890_2102840_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_015871476.1|2103018_2104320_+	membrane protein	NA	NA	NA	NA	NA
WP_015871478.1|2104661_2104967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871479.1|2105372_2105777_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_015871480.1|2106036_2106582_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_015871481.1|2106578_2108108_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_015871483.1|2108367_2109081_-	cobalt-factor II C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_015871484.1|2109077_2109872_-	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_015871485.1|2109882_2110668_-	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
WP_015871486.1|2110664_2111390_-	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_015871487.1|2111383_2112445_-	cobalt-precorrin 5A hydrolase	NA	NA	NA	NA	NA
WP_015871488.1|2112425_2113199_-	cobalt-precorrin-4 methyltransferase	NA	NA	NA	NA	NA
WP_015871489.1|2113191_2113761_-	decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_015871490.1|2113750_2114356_-	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
WP_015871491.1|2114349_2115489_-	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_015871492.1|2115485_2116118_-	cobalt-precorrin-8 methylmutase	NA	NA	NA	NA	NA
WP_015871493.1|2116130_2117090_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_015871494.1|2117086_2118466_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_015871495.1|2119032_2119899_+	GHMP kinase ATP-binding protein	NA	NA	NA	NA	NA
WP_107775203.1|2120483_2121285_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	1.6e-27
WP_015871501.1|2121953_2122715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871502.1|2122789_2124616_+	two-component system sensor histidine kinase AtoS	NA	NA	NA	NA	NA
WP_015871503.1|2124612_2125989_+	acetoacetate metabolism transcriptional regulator AtoC	NA	NA	NA	NA	NA
WP_015871505.1|2126221_2126884_+	acetate CoA-transferase subunit alpha	NA	NA	NA	NA	NA
WP_015871506.1|2126883_2127534_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_015871507.1|2127530_2128853_+	TIGR00366 family protein	NA	NA	NA	NA	NA
WP_015871508.1|2128882_2130067_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_015871514.1|2132054_2132447_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	56.7	7.4e-34
WP_107775265.1|2132479_2133176_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	55.8	6.3e-76
WP_107775311.1|2133919_2134771_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	30.8	1.5e-10
WP_015871521.1|2135622_2136987_-	MFS transporter	NA	NA	NA	NA	NA
WP_015871522.1|2137243_2138134_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_015871523.1|2138151_2138490_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_015871524.1|2138486_2139104_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_015871525.1|2139093_2141085_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_015871526.1|2141088_2142039_-	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_081583022.1|2142330_2142489_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107775203.1|2142678_2143480_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	1.6e-27
WP_107775263.1|2143474_2144573_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.2	1.5e-44
2144561:2144620	attL	GAGCCTGTACATAAATTTGTGTAATTGCCTGATTTTGATATGTTCAATCCAACATCAAAA	NA	NA	NA	NA
WP_015870371.1|2144632_2145841_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
WP_015870885.1|2146179_2147205_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_051142559.1|2147272_2148667_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.6	2.7e-211
WP_015871529.1|2148663_2148930_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	53.2	3.3e-09
WP_015871530.1|2148929_2149940_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	60.1	1.3e-117
WP_015871531.1|2150194_2151232_-|integrase	tyrosine-type recombinase/integrase	integrase	P79671	Haemophilus_phage	54.6	3.3e-97
WP_015871532.1|2151269_2151863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050977446.1|2152359_2152689_+	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_071525729.1|2152729_2153119_-	hypothetical protein	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	51.6	3.1e-16
WP_015871535.1|2153203_2153395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871536.1|2153407_2153617_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	46.4	4.1e-07
WP_015871537.1|2153661_2153973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871538.1|2153991_2154273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871539.1|2154416_2154692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871540.1|2154855_2155098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871541.1|2155082_2155619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871542.1|2155615_2155921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107775310.1|2156033_2156618_+	ash family protein	NA	K7PLX4	Enterobacteria_phage	52.3	6.8e-15
WP_015871544.1|2156610_2157069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871545.1|2157072_2159679_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	57.7	1.1e-221
WP_015871546.1|2160017_2160674_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_015871547.1|2160676_2161786_-	ParA family protein	NA	Q7M293	Enterobacteria_phage	31.8	1.6e-25
WP_035609840.1|2162133_2162397_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	46.5	8.3e-13
WP_050977451.1|2162461_2163460_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	52.8	1.6e-85
WP_015871551.1|2163491_2165297_-	hypothetical protein	NA	A5X9H3	Aeromonas_virus	55.5	4.4e-190
WP_015871552.1|2165484_2166384_+|capsid	GPO family capsid scaffolding protein	capsid	R9TRS3	Vibrio_phage	36.4	1.5e-42
WP_015871553.1|2166398_2167484_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	56.9	1.0e-93
WP_015871554.1|2167440_2168142_+|terminase	phage small terminase subunit protein	terminase	A5X9H6	Aeromonas_virus	47.9	8.3e-52
WP_015871555.1|2168247_2168730_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	42.8	1.2e-28
WP_015871556.1|2168739_2169219_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	32.5	7.5e-20
WP_015871557.1|2169205_2169940_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	44.8	1.8e-41
WP_015871558.1|2169944_2171099_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	49.6	7.9e-100
WP_015871559.1|2171095_2171551_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	55.6	2.7e-43
WP_015871560.1|2171554_2171845_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	43.3	1.8e-13
WP_015871561.1|2171861_2172413_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	67.4	4.2e-67
WP_015871562.1|2172443_2172731_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	43.2	8.2e-14
WP_015871563.1|2172919_2175115_+|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	39.0	1.7e-106
WP_015871564.1|2175104_2175458_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	62.9	1.3e-24
WP_015871565.1|2175450_2176635_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	61.3	1.3e-137
WP_015871567.1|2177197_2178979_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.2	2.4e-71
WP_015871568.1|2178978_2179599_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	39.9	5.8e-33
WP_015871569.1|2179604_2180327_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	30.0	3.3e-27
WP_015871570.1|2180298_2180883_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	42.5	1.5e-25
WP_015871571.1|2180879_2182628_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.4	2.0e-102
WP_071525759.1|2183416_2183569_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_015871573.1|2184311_2184860_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_015871574.1|2184915_2186748_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_015871575.1|2186740_2187397_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_015871576.1|2187962_2188187_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_107775162.1|2189516_2190318_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015871582.1|2190583_2191162_-	antA/AntB antirepressor family protein	NA	A0A0N6WET9	Escherichia_phage	57.6	1.2e-43
WP_081583029.1|2191425_2191656_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	70.4	6.5e-14
WP_015870371.1|2191681_2192890_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
WP_015871584.1|2192880_2193441_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	64.9	1.6e-58
2191610:2192924	attR	GAGCCTGTACATAAATTTGTGTAATTGCCTGATTTTGATATGTTCAATCCAACATCAAAAGCAGGTTACTTTATGAACGAAAAACAGTTGCAGGCTCTGGCTAACGAACTGGCCAAAAATCTCAAAACCCCTGACGATCTCAGTCAGTTCGATCGCCTGCTGAAGAAAATCAGCGTTGAGGCGGCTCTCAACGCCGAAATGTCCCACCATCTGGGCTACGATAAAAATCAGCCTAAACCGGGTGCCAACTCCCGCAATGGCTATTCCACAAAGACCGTTACCACCGGTGATGGCCCTCTGGAACTACGCACGCCGCGTGATCGTGATGGCTCTTTCGAACCGCAACTGGTGAAGAAAAACCAGACCCGGATCACCGGTATGGATAACCAGATTTTATCGTTGTACGCCAAAGGGATGACCACCCGCGAGATAGCGGCCGCGTTCAAAGAGCTGTATGACGCTGATGTCTCACCGGCGCTGGTCTCGAAGGTCACCGACGCCGTAATGGAGCAGGTTACCGAATGGCAGAATCGTCCACTGGATGCAGTCTATCCCATTGTTTACCTTGACTGTATCGTCCTGAAGGTCCGGCAGGACAGTCGCGTCATTAATAAATCCGTGTTCCTTGCCCTGGGTATCAACCTCGAAGGCCAGAAAGAACTGCTGGGTATGTGGCTGGCCGAAAACGAAGGCGCGAAGTTCTGGCTCAATGTGCTGACAGAGCTGAAGAATCGCGGCCTGAACGATATCCTCATCGCCTGTGTCGATGGTCTGAAAGGCTTCCCGGACGCGATCAATACGGTGTATCCGGAAGCCCGCATCCAGCTGTGCATCGTGCATATGGTGCGTAACAGCCTGCGGTTCGTCTCCTGGAAGGACTACAAAGCCGTCACCCGCGACCTGAAAGCCATTTATCAGGCCCCCACGGAAGACGCAGGGCAGCAGGCGCTGGAAGCGTTCGCCAGCGCATGGGACAACCGCTACCCGCAGATAAGCCGTAGCTGGCAGACAAACTGGGCTAACCTGGCGACGTTCTTCGCTTACCCGGCAGACATCCGCAAGGTGATCTACACAACGAATGCTATCGAGTCGCTGAACAGCGTGATCCGGCATGCCATCAAAAAGCGTAAGGTGTTCCCGACGGACGAAGCAGTGAAAAAGGTGGTGTGGTTAGCGATCCAGGCGGCATCACAGAAATGGACCATGCCGCTGAGGGACTGGCGTATGGCAATGAGCCGCTTTATTATCGAGTTCGGTGATCGTCTGGACGGTCACTTCTGAGAAAAGGCATTTACACAGAATCGTGTACAGGGTC	NA	NA	NA	NA
WP_035608431.1|2193937_2194207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871585.1|2194280_2194832_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	70.8	8.2e-71
WP_015871586.1|2194834_2195182_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	53.3	4.6e-27
WP_015871587.1|2195257_2195473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015871588.1|2195790_2196234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871589.1|2196286_2196658_-	hypothetical protein	NA	K7PGW2	Enterobacterial_phage	86.7	9.4e-55
WP_081490016.1|2196674_2197064_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	60.4	2.5e-34
WP_035608428.1|2197053_2197302_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_015871591.1|2197298_2198033_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	38.2	2.0e-32
WP_015871592.1|2198029_2199028_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	55.9	2.5e-73
WP_107775259.1|2199020_2199869_-	ash family protein	NA	K7PLX4	Enterobacteria_phage	55.5	4.2e-74
WP_015871594.1|2199917_2200202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035608425.1|2200206_2200575_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071525665.1|2200660_2200840_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_035608421.1|2201033_2201576_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.4	3.9e-65
WP_177819729.1|2202003_2202624_+	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	74.3	2.4e-71
>prophage 8
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	2577211	2637970	3812301	plate,transposase,tRNA	Mollivirus(33.33%)	52	NA	NA
WP_107775162.1|2577211_2578013_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_035609315.1|2578600_2579248_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_015871955.1|2579418_2580711_+	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
WP_015871956.1|2580754_2581378_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_015871957.1|2581370_2581955_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_015871958.1|2582232_2583453_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_015871959.1|2583535_2584141_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_015871960.1|2584161_2586003_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_015871961.1|2586161_2586812_-	sugar phosphatase	NA	NA	NA	NA	NA
WP_015871962.1|2586842_2587337_-	YfbU family protein	NA	NA	NA	NA	NA
WP_015871963.1|2587551_2588007_-	DUF412 domain-containing protein	NA	NA	NA	NA	NA
WP_015871965.1|2588550_2589750_+	acetate kinase	NA	NA	NA	NA	NA
WP_015871966.1|2589883_2592022_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_015871969.1|2593214_2594231_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071525731.1|2594875_2595601_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015871972.1|2595623_2597006_-	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015871973.1|2597183_2598347_-	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_015871974.1|2598634_2599549_-	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_015871976.1|2600513_2601092_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_015871977.1|2601259_2601778_-	NUDIX hydrolase YfcD	NA	NA	NA	NA	NA
WP_015871978.1|2601876_2602440_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_015871979.1|2602548_2603190_-	glutathione transferase	NA	NA	NA	NA	NA
WP_015871980.1|2603400_2604027_+	GSH-dependent disulfide bond oxidoreductase	NA	NA	NA	NA	NA
WP_015871981.1|2604081_2604456_+	dihydroneopterin triphosphate 2'-epimerase	NA	NA	NA	NA	NA
WP_015871982.1|2604499_2605396_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_015871983.1|2605594_2606281_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015871984.1|2606277_2606856_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_015871985.1|2606974_2608492_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.6	5.7e-90
WP_015871986.1|2608513_2609023_-	colicin V production protein	NA	NA	NA	NA	NA
WP_015871987.1|2609212_2609980_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_015871988.1|2609969_2611241_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_015871989.1|2611385_2612294_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_015871990.1|2612555_2613221_-	DedA family protein	NA	NA	NA	NA	NA
WP_035609870.1|2613235_2614063_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_015871992.1|2614062_2615073_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015871993.1|2615181_2616309_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	30.0	1.6e-20
WP_015871996.1|2617021_2617519_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_015871997.1|2617600_2618347_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015871998.1|2618474_2619686_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_015871999.1|2619857_2621882_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_015872000.1|2622303_2622585_-	YfcL family protein	NA	NA	NA	NA	NA
WP_015872001.1|2622623_2623172_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_035608446.1|2623272_2624073_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_015872003.1|2625042_2627043_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_015870885.1|2627130_2628156_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015870371.1|2628967_2630176_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
WP_015872006.1|2631738_2632251_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_015872007.1|2632250_2633738_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_015872008.1|2633807_2634299_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_015872009.1|2634428_2635640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015872010.1|2635648_2636125_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_015872011.1|2636128_2637970_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 9
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	2860975	2902885	3812301	transposase,tRNA,protease	Mycobacterium_phage(30.0%)	32	NA	NA
WP_015872222.1|2860975_2862007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071525704.1|2862846_2863149_+	PabB family transcriptional regulator	NA	NA	NA	NA	NA
WP_015872224.1|2863533_2868828_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_107775307.1|2869234_2869777_-	ParB N-terminal domain-containing protein	NA	A0A068F3J9	Mycobacterium_phage	43.8	2.9e-28
WP_015872226.1|2869863_2871072_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	35.9	5.8e-61
WP_035610188.1|2872242_2872767_-	DUF2165 domain-containing protein	NA	NA	NA	NA	NA
WP_015872231.1|2873477_2874944_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_015872232.1|2875946_2876102_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015872233.1|2876258_2876531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015872234.1|2876538_2877168_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	46.8	2.6e-52
WP_015872235.1|2877169_2878381_-	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	32.6	1.9e-59
WP_015872237.1|2878729_2880610_+	KUP/HAK/KT family potassium transporter	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	29.5	2.5e-66
WP_015872238.1|2880844_2881264_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015872239.1|2881260_2881614_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_015872245.1|2884050_2885925_+	bifunctional glutathionylspermidine amidase/synthase	NA	NA	NA	NA	NA
WP_015872246.1|2886041_2886374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015872247.1|2886760_2888026_-	chloride channel protein	NA	NA	NA	NA	NA
WP_035610181.1|2888419_2888713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015872249.1|2889480_2890338_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.9	1.3e-30
WP_107775277.1|2890393_2891201_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.2	8.2e-27
WP_015869530.1|2891198_2892407_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
WP_015872250.1|2892661_2892874_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_015872251.1|2892937_2894323_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	33.0	6.5e-40
WP_015872252.1|2894511_2895006_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_015872253.1|2895014_2895794_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_128574067.1|2895875_2896142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107775162.1|2896393_2897195_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015872255.1|2897589_2898099_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_015872256.1|2898095_2899166_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015872257.1|2899169_2901572_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_015872258.1|2901568_2902255_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	7.9e-31
WP_162471035.1|2902225_2902885_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 10
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	2936597	3055499	3812301	capsid,holin,head,tail,plate,terminase,protease,integrase,transposase,tRNA,portal	Salmonella_phage(15.22%)	107	3023694:3023710	3039694:3039710
WP_107775240.1|2936597_2937696_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.9	1.1e-47
WP_071525751.1|2937840_2938341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015869530.1|2938615_2939824_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
WP_015872295.1|2939871_2940285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050977467.1|2940290_2940932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015872297.1|2941334_2952470_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	38.1	6.8e-47
WP_015872298.1|2952534_2954274_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	27.1	1.3e-34
WP_015872299.1|2955477_2955861_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	66.0	4.4e-31
WP_015872301.1|2956262_2956958_+	uracil-DNA glycosylase	NA	A0A1X9WHI9	Cercopithecine_herpesvirus	48.6	3.3e-53
WP_015872302.1|2957003_2957582_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_015872303.1|2957762_2958641_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015872304.1|2958752_2960414_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015872305.1|2960581_2960932_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_035610137.1|2960969_2961254_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071525746.1|2961246_2961720_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_015872308.1|2961834_2962317_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.5e-28
WP_015872310.1|2963786_2963957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081490054.1|2964252_2965452_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_015872313.1|2965465_2967286_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	25.9	7.2e-23
WP_015872314.1|2967374_2967536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015872315.1|2967591_2968902_-	radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_133175606.1|2968920_2969649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015872318.1|2970481_2970778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193352254.1|2970905_2971049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015872321.1|2971248_2972544_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_015872324.1|2973690_2974416_-	ribonuclease	NA	NA	NA	NA	NA
WP_015872325.1|2974857_2975718_+	alpha/beta fold hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	27.8	1.2e-12
WP_071525745.1|2975854_2976232_+|transposase	transposase	transposase	Q9MCT5	Escherichia_phage	50.0	1.6e-12
WP_015872327.1|2976531_2977524_-	TDT family transporter	NA	NA	NA	NA	NA
WP_015872328.1|2977631_2978510_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015872329.1|2978664_2979189_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_015872330.1|2979342_2979828_+	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
WP_015872331.1|2980430_2980949_+	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_015872332.1|2981294_2982473_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_015872333.1|2982490_2984026_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_015872334.1|2984224_2985271_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_015872335.1|2985254_2986934_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_015872336.1|2986930_2987608_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.8e-20
WP_015872337.1|2987726_2989142_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.4	4.6e-25
WP_015872338.1|2989364_2990894_-	dGTPase	NA	NA	NA	NA	NA
WP_015872339.1|2991052_2991751_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_015872340.1|2991754_2992618_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_015872341.1|2992895_2993507_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_015872342.1|2993584_2993929_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	46.4	1.1e-25
WP_015872343.1|2994020_2995460_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_015872344.1|2995694_2996978_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_107775234.1|2997340_2998037_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	56.3	8.2e-76
WP_015872349.1|2999712_3000417_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015872350.1|3000560_3001751_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_015872351.1|3001850_3002642_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015872355.1|3004204_3005191_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	62.7	2.9e-119
WP_015872356.1|3005187_3006975_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	63.5	6.7e-223
WP_015872357.1|3007129_3007957_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	58.3	1.7e-64
WP_015872358.1|3007967_3008987_+|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	57.4	7.5e-110
WP_015872359.1|3008983_3009637_+|terminase	terminase	terminase	A0A077K804	Ralstonia_phage	47.8	5.2e-48
WP_015872360.1|3009722_3010190_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	49.7	6.8e-34
WP_034168398.1|3010299_3010503_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	51.6	2.7e-11
WP_015872361.1|3010505_3010883_+|holin	phage holin family protein	holin	A0A1S5NRL1	Burkholderia_phage	45.8	8.5e-19
WP_015872362.1|3010879_3011191_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_015872363.1|3011168_3011759_+	N-acetylmuramidase family protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	52.6	4.5e-51
WP_015872364.1|3011860_3012319_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	50.4	6.9e-31
WP_015872366.1|3012981_3013278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015872367.1|3013353_3013671_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015872368.1|3013849_3014449_+|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	49.3	3.1e-47
WP_015872369.1|3014448_3014799_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	51.8	5.8e-22
WP_015872370.1|3014795_3015707_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	64.8	9.3e-104
WP_015872371.1|3015699_3016317_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	57.2	2.6e-65
WP_015872372.1|3016313_3017420_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	57.7	4.8e-62
WP_015872373.1|3017431_3017605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015872374.1|3017677_3018436_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	67.9	4.1e-105
WP_015872375.1|3018541_3019720_+|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	69.1	1.2e-156
WP_015872376.1|3019734_3020250_+|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	62.8	1.1e-53
WP_015872377.1|3020259_3020556_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	53.8	3.1e-16
WP_071525748.1|3020552_3020681_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_015872378.1|3020677_3023527_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	33.3	1.9e-118
WP_015872379.1|3023537_3023966_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	58.1	6.0e-37
3023694:3023710	attL	AACGGCGTACTGCTGCC	NA	NA	NA	NA
WP_015872380.1|3023962_3025012_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	50.7	5.7e-97
WP_015872381.1|3025014_3026319_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_015872382.1|3026309_3026984_-	hypothetical protein	NA	A0A2H4J954	uncultured_Caudovirales_phage	53.4	1.9e-08
WP_035610120.1|3026986_3027328_-	helix-turn-helix transcriptional regulator	NA	A0A0S4L3B5	Pseudomonas_phage	29.7	3.9e-07
WP_035610117.1|3027415_3027622_+	hypothetical protein	NA	A4JWR7	Burkholderia_virus	59.6	2.3e-10
WP_015872384.1|3027654_3027885_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	38.6	1.7e-06
WP_015872385.1|3027970_3030628_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	58.5	1.3e-307
WP_015872386.1|3030640_3031012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015872387.1|3031004_3031811_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.2	4.0e-66
WP_015872388.1|3031846_3032101_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	48.4	1.1e-06
WP_015872389.1|3032104_3033307_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	61.5	1.4e-136
WP_015872391.1|3033532_3035110_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_015872392.1|3035194_3036661_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.8	4.2e-90
WP_015872393.1|3036832_3038215_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.4	1.2e-38
WP_015872394.1|3038227_3038806_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015872395.1|3038802_3039186_-	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_015872396.1|3039182_3040877_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
3039694:3039710	attR	GGCAGCAGTACGCCGTT	NA	NA	NA	NA
WP_015872397.1|3040915_3041857_-	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_015872398.1|3041853_3042525_-	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_015872399.1|3042521_3043109_-	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_015872400.1|3043151_3044600_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_015872401.1|3045051_3045276_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015872402.1|3045285_3046242_-	AEC family transporter	NA	NA	NA	NA	NA
WP_015872403.1|3046500_3047985_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_015872404.1|3048119_3049298_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_015872405.1|3049309_3049930_-	YfgM family protein	NA	NA	NA	NA	NA
WP_015872406.1|3049943_3051218_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015872407.1|3051324_3052452_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_015872408.1|3052477_3053503_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_035610115.1|3053492_3054245_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_015872410.1|3054326_3055499_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
>prophage 11
NC_012779	Edwardsiella ictaluri 93-146, complete sequence	3812301	3122555	3137085	3812301	tRNA	uncultured_Mediterranean_phage(28.57%)	12	NA	NA
WP_015872468.1|3122555_3124136_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	8.8e-09
WP_015872469.1|3124627_3124945_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_015872472.1|3125814_3128373_+	DNA mismatch repair protein MutS	NA	A0A2I2L537	Orpheovirus	31.2	4.9e-25
WP_015872473.1|3128424_3129411_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	31.7	7.9e-32
WP_081490041.1|3129462_3130395_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	8.3e-07
WP_015872475.1|3130722_3131361_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.4	9.0e-37
WP_015872476.1|3131354_3132119_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.8	2.6e-67
WP_015872477.1|3132099_3133146_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_015872478.1|3133149_3133623_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_015872479.1|3133626_3134358_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015872480.1|3134411_3134756_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_015872481.1|3134838_3137085_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	7.1e-12
