The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012984	Lactobacillus plantarum JDM1, complete sequence	3197759	15166	53448	3197759	portal,terminase,tail,capsid,integrase,head,transposase	Staphylococcus_phage(28.57%)	32	9645:9659	55006:55020
9645:9659	attL	ATTTCCCGGGAAATA	NA	NA	NA	NA
WP_012778279.1|15166_16846_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003641639.1|17162_18386_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.6	2.4e-54
WP_003643611.1|18407_19205_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.2	1.0e-45
WP_012778280.1|19223_20462_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.9	6.3e-111
WP_003641642.1|20922_22539_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012778281.1|22869_24774_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_003641645.1|24763_25903_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_003641646.1|25899_27072_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_012778282.1|27064_28504_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_003643612.1|28523_30920_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.9	1.6e-09
WP_012778283.1|30937_32755_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_003641650.1|33087_33855_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012778284.1|34006_34678_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_011100855.1|34695_37416_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003641653.1|37803_38253_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003643615.1|38451_38652_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.6	2.8e-21
WP_012778285.1|38743_38974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778286.1|39442_40597_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	36.5	5.2e-59
WP_012778287.1|40675_41320_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015640734.1|41468_41648_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	87.9	4.3e-21
WP_012778290.1|41915_42146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778291.1|42159_42960_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_012778292.1|42959_44354_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.9	3.2e-71
WP_003645297.1|44497_44917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778293.1|44941_45124_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_012778294.1|45133_45472_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	36.6	1.4e-09
WP_012778295.1|45464_45854_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	43.5	3.3e-18
WP_012778296.1|46662_47661_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.4e-52
WP_012778297.1|47805_48279_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_012778300.1|50134_51235_+|portal	phage portal protein	portal	A0A2H4J8V4	uncultured_Caudovirales_phage	34.6	3.0e-48
WP_012778301.1|51231_52773_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.9	9.1e-43
WP_012778302.1|53181_53448_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
55006:55020	attR	ATTTCCCGGGAAATA	NA	NA	NA	NA
>prophage 2
NC_012984	Lactobacillus plantarum JDM1, complete sequence	3197759	331550	380042	3197759	protease,bacteriocin	Bacillus_virus(33.33%)	43	NA	NA
WP_003643762.1|331550_332114_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011100974.1|332307_332976_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003641930.1|333125_334631_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|334895_335264_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_015825106.1|335376_335886_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011100975.1|335916_337113_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641934.1|337222_337693_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|337711_338167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|338270_338843_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003646441.1|339008_339929_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_015825107.1|340065_340965_+	oxidoreductase	NA	NA	NA	NA	NA
WP_015825108.1|341404_343285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646442.1|343456_343903_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|344140_345667_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_015825109.1|345667_346639_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_015825110.1|346716_348048_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|348513_350031_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|350045_351875_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_015825111.1|351889_352612_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.5	9.2e-30
WP_015825112.1|353198_356882_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_015825113.1|356883_358758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825114.1|358763_359306_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015825115.1|359320_359584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641960.1|359695_359971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379760.1|360353_360971_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003646460.1|360974_362129_-	MFS transporter	NA	NA	NA	NA	NA
WP_015825116.1|362132_362924_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015379762.1|362994_363867_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015825117.1|364026_364842_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011100994.1|365367_366744_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_015825118.1|366788_367973_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_015825119.1|368360_368564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825120.1|368935_369604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154766382.1|370161_370335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825121.1|370347_371688_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_015825122.1|371688_372432_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015825123.1|372725_373499_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015825124.1|373597_373756_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|373780_373951_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_015825125.1|374217_376368_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_015825126.1|376383_377760_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015825127.1|377849_378539_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015825129.1|379361_380042_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NC_012984	Lactobacillus plantarum JDM1, complete sequence	3197759	482641	539885	3197759	portal,terminase,tail,protease,capsid,integrase,transposase	Lactobacillus_phage(87.23%)	67	499282:499301	532147:532166
WP_015825156.1|482641_484312_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003643855.1|490559_492032_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.3	2.1e-68
WP_003640888.1|492086_492929_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015825157.1|493490_493949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825158.1|494128_494653_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003640891.1|494683_495019_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011101053.1|495053_495896_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015825159.1|496054_497161_-	anion permease	NA	NA	NA	NA	NA
WP_015825160.1|497353_498175_-	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	2.6e-52
WP_003640895.1|498535_499327_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.1	3.5e-30
499282:499301	attL	GAAGGGAATTGATGCAACGA	NA	NA	NA	NA
WP_003644997.1|499405_500542_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003640897.1|500565_501267_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643865.1|501436_502174_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003640899.1|502330_503809_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	2.5e-106
WP_003640900.1|503808_504636_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_015825161.1|505091_507746_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.1	1.8e-70
WP_015825162.1|507800_508235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825163.1|508528_510700_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_015825164.1|510699_511146_+	SprT family protein	NA	NA	NA	NA	NA
WP_015825165.1|511211_512498_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003644991.1|512506_513382_+	homoserine kinase	NA	NA	NA	NA	NA
WP_003643870.1|513672_514830_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	97.7	1.0e-216
WP_003643871.1|514999_515668_-	GIY-YIG nuclease family protein	NA	A0A2P0ZL92	Lactobacillus_phage	99.1	2.0e-124
WP_003643872.1|515780_516212_-	universal stress protein	NA	A0A2P0ZL98	Lactobacillus_phage	98.6	1.2e-74
WP_003643873.1|516311_516569_-	hypothetical protein	NA	A0A2P0ZL96	Lactobacillus_phage	95.3	1.7e-39
WP_003643874.1|516692_516869_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	100.0	2.4e-24
WP_003643875.1|517036_517705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643876.1|517796_518228_-	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	100.0	7.6e-80
WP_003643877.1|518237_518615_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	69.4	5.3e-45
WP_003643878.1|518927_519137_+	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	100.0	7.0e-31
WP_003643879.1|519140_519356_+	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	100.0	6.9e-26
WP_099112459.1|519349_519535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643880.1|519606_519879_+	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	98.9	3.6e-43
WP_003643881.1|520017_520467_+	hypothetical protein	NA	A0A2P0ZLA2	Lactobacillus_phage	96.0	6.9e-76
WP_015825166.1|520622_520808_+	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	91.8	2.4e-27
WP_021730257.1|520779_520950_+	hypothetical protein	NA	A0A2P0ZLA6	Lactobacillus_phage	98.2	5.5e-26
WP_016511377.1|521022_521274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643883.1|521270_521522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643884.1|521518_521998_+	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	95.6	1.3e-80
WP_003643885.1|522149_523409_+	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	95.0	1.9e-227
WP_003643886.1|523405_524122_+	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	99.1	3.5e-114
WP_003643887.1|524124_524724_+	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.9	1.6e-96
WP_003643888.1|524737_525292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643889.1|525365_526160_+	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	97.0	2.5e-145
WP_003643890.1|526156_527431_+	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	98.8	7.1e-243
WP_003643891.1|527688_528021_+	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	96.4	8.2e-58
WP_003643892.1|528040_528265_+	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	87.8	1.1e-13
WP_162273788.1|528242_528677_+	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	57.4	4.7e-37
WP_003643894.1|528673_529135_+	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	47.5	1.9e-28
WP_003643895.1|529261_529573_+	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	97.1	2.6e-50
WP_003643896.1|529584_530016_+	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	97.1	2.7e-69
WP_003643897.1|530194_530902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643898.1|530970_531186_+	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	81.4	2.2e-27
WP_033615432.1|531169_531508_+	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	93.8	5.2e-60
WP_003643899.1|531507_531762_+	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	82.5	5.9e-32
WP_003643900.1|531795_532047_+	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	89.2	7.3e-35
WP_015825169.1|532157_532445_+|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	88.4	1.9e-39
532147:532166	attR	GAAGGGAATTGATGCAACGA	NA	NA	NA	NA
WP_015825170.1|532441_534124_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	99.1	0.0e+00
WP_003643903.1|534142_535285_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	96.3	6.4e-211
WP_015825171.1|535271_536015_+|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	97.6	1.4e-129
WP_003643905.1|536035_537214_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	98.7	1.6e-217
WP_003643906.1|537353_537659_+	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	91.1	1.6e-44
WP_003643907.1|537639_538029_+	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	89.1	3.4e-63
WP_003643908.1|538025_538433_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	97.8	3.3e-69
WP_003643909.1|538429_538852_+	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	98.6	7.4e-72
WP_003643910.1|538866_539478_+|tail	tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	97.0	1.1e-105
WP_003643911.1|539570_539885_+	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	4.2e-48
>prophage 4
NC_012984	Lactobacillus plantarum JDM1, complete sequence	3197759	1006653	1099963	3197759	portal,terminase,tail,tRNA,protease,capsid,integrase,head,transposase	Lactobacillus_phage(61.82%)	97	1078075:1078089	1103250:1103264
WP_015825317.1|1006653_1006974_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_015825318.1|1006973_1008437_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_015825319.1|1008436_1009861_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003641344.1|1009965_1010988_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
WP_015825320.1|1011321_1012695_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	3.2e-124
WP_003641346.1|1013148_1013727_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003646275.1|1013993_1016333_+	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	7.1e-39
WP_003644132.1|1016582_1017899_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641349.1|1017891_1018776_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644133.1|1018900_1019779_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641351.1|1019803_1020580_+	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_003641352.1|1020735_1021101_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003638174.1|1021444_1021645_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_003641353.1|1021831_1022839_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003641354.1|1022851_1024186_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	2.9e-37
WP_015825321.1|1024427_1025609_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	37.6	1.5e-58
WP_003641356.1|1025776_1026091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641358.1|1026424_1026625_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_041161662.1|1026636_1027452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641360.1|1027477_1027867_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_003641361.1|1027897_1028224_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	6.9e-17
WP_003641362.1|1028480_1028696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049821958.1|1028769_1029513_+	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	45.6	4.8e-50
WP_015825325.1|1029524_1029734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825327.1|1029746_1029962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825329.1|1030864_1031125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825330.1|1031267_1031447_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	100.0	1.4e-24
WP_015825331.1|1031480_1031735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825332.1|1031737_1031938_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	92.4	2.6e-27
WP_164878063.1|1031949_1032114_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	65.4	1.4e-10
WP_021732029.1|1032116_1032263_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	93.6	2.3e-17
WP_015825333.1|1032262_1033123_+	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	34.4	3.2e-37
WP_015825334.1|1033122_1033749_+	ERF family protein	NA	D7RWM8	Brochothrix_phage	37.4	6.1e-14
WP_015825335.1|1033745_1034207_+	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	57.5	1.4e-39
WP_015825336.1|1034222_1034789_+	HNH endonuclease	NA	A0A249XVQ5	Enterococcus_phage	34.1	4.0e-20
WP_015825337.1|1034794_1035487_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	91.3	2.2e-121
WP_015825338.1|1035536_1036343_+	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	37.2	6.0e-46
WP_015825339.1|1036342_1037128_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	98.9	1.2e-144
WP_013355641.1|1037263_1037572_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	94.1	3.2e-48
WP_015825340.1|1037846_1038278_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	93.7	3.4e-72
WP_041161663.1|1038500_1038767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825342.1|1038788_1039448_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	38.4	2.5e-21
WP_049821959.1|1039639_1040074_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	37.7	8.3e-18
WP_015825344.1|1040060_1041977_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	41.4	8.2e-134
WP_165274444.1|1041990_1042155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825345.1|1042196_1043315_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	39.5	3.6e-65
WP_015825346.1|1043286_1043892_+|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	49.1	8.2e-40
WP_015825347.1|1043898_1045281_+|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	60.1	4.9e-96
WP_015825348.1|1045371_1045650_+	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	73.6	2.2e-32
WP_041161664.1|1045650_1045998_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	92.2	1.4e-55
WP_015825350.1|1046000_1046408_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	90.9	1.1e-64
WP_015825351.1|1046407_1046788_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	90.5	8.5e-59
WP_015825352.1|1046802_1047444_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	92.0	3.4e-108
WP_015825353.1|1047520_1047895_+|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	93.5	2.0e-57
WP_015825354.1|1047939_1048125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825355.1|1048156_1053307_+	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	53.8	0.0e+00
WP_015825356.1|1053383_1055156_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.9	2.5e-310
WP_015825357.1|1055222_1057634_+|tail	phage tail protein	tail	A0A2P0ZLF8	Lactobacillus_phage	94.5	0.0e+00
WP_015825358.1|1057650_1060446_+|tail	tail fiber protein	tail	E9LUR4	Lactobacillus_phage	71.1	7.5e-221
WP_003641409.1|1060438_1060678_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.4	1.9e-32
WP_166485333.1|1060681_1060843_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	98.1	2.1e-19
WP_015825359.1|1060826_1061942_+	collagen-like protein	NA	A0A2P0ZLF6	Lactobacillus_phage	85.7	9.1e-61
WP_041161665.1|1061938_1062196_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	76.4	3.7e-18
WP_015825360.1|1062208_1063366_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	85.1	3.8e-187
WP_015825361.1|1063365_1063629_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	98.9	7.4e-38
WP_003643301.1|1064326_1064767_-	universal stress protein	NA	NA	NA	NA	NA
WP_015825363.1|1064900_1066208_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_076630458.1|1067217_1067418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643305.1|1067617_1068058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646269.1|1068490_1069054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825366.1|1069660_1070740_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	32.1	4.2e-18
WP_015825367.1|1070748_1072803_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_172436956.1|1073108_1074464_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_015825369.1|1074720_1075896_+	serine hydrolase	NA	NA	NA	NA	NA
WP_015825370.1|1076085_1077204_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.3	7.1e-21
WP_015825371.1|1077591_1078521_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
1078075:1078089	attL	GTGATCTTGAATTTA	NA	NA	NA	NA
WP_003643315.1|1078710_1079427_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_015825372.1|1079678_1080872_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_077727009.1|1081620_1081830_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015825374.1|1081826_1082375_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.3	3.1e-30
WP_099112445.1|1082443_1083490_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_015825376.1|1083926_1084709_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015825377.1|1084774_1085740_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_015825378.1|1085742_1086789_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015825379.1|1086829_1087747_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015825380.1|1087733_1088819_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015825381.1|1088879_1090040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015825382.1|1090269_1090932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825383.1|1090928_1091528_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015825384.1|1091530_1092667_+	serine hydrolase	NA	NA	NA	NA	NA
WP_015825385.1|1092710_1094249_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_015825386.1|1094264_1095134_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	61.2	9.2e-101
WP_015825387.1|1095137_1095719_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	2.5e-38
WP_015825388.1|1095728_1096757_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.1	3.8e-69
WP_015825389.1|1096826_1097669_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	1.4e-34
WP_049821960.1|1097750_1099277_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_015825391.1|1099366_1099963_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	43.0	9.6e-33
1103250:1103264	attR	GTGATCTTGAATTTA	NA	NA	NA	NA
>prophage 5
NC_012984	Lactobacillus plantarum JDM1, complete sequence	3197759	1280721	1290568	3197759		Lactobacillus_phage(87.5%)	9	NA	NA
WP_015825454.1|1280721_1281960_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.2	6.3e-220
WP_015825455.1|1282050_1283022_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
WP_003643099.1|1283207_1284155_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1284498_1285113_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_015825456.1|1285115_1287554_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_003643095.1|1287641_1288202_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_011101401.1|1288272_1288713_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_015380221.1|1288808_1288946_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645220.1|1289572_1290568_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 6
NC_012984	Lactobacillus plantarum JDM1, complete sequence	3197759	1820255	1878895	3197759	tRNA,protease,transposase,integrase	Lactobacillus_phage(14.29%)	60	1809913:1809932	1881827:1881846
1809913:1809932	attL	GTCTTCCCATGGTCAACGTG	NA	NA	NA	NA
WP_003640733.1|1820255_1821533_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1821570_1822356_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015825653.1|1822371_1823151_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1823270_1823834_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|1823835_1824558_-	UMP kinase	NA	NA	NA	NA	NA
WP_003644498.1|1824757_1825636_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003640739.1|1825738_1826542_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_015825654.1|1826766_1827489_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|1827777_1828776_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_015825656.1|1829148_1829907_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_025015626.1|1830018_1830654_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|1830711_1830948_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1831045_1831285_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1831436_1832069_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_079994873.1|1832133_1832319_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_015825658.1|1832624_1833254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825659.1|1833302_1834472_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_015825660.1|1834507_1834900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015825661.1|1835063_1835456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640752.1|1835901_1836843_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	2.4e-78
WP_003640755.1|1837677_1838061_+	SHOCT domain-containing protein	NA	O48432	Lactobacillus_phage	27.4	4.7e-09
WP_079994875.1|1838205_1839762_+	DUF4428 domain-containing protein	NA	NA	NA	NA	NA
WP_015825665.1|1840188_1840428_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_079994877.1|1840822_1841080_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.7	7.6e-11
WP_015825666.1|1841211_1841628_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	35.0	9.1e-06
WP_033608763.1|1841687_1842155_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077726998.1|1842402_1842792_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015825668.1|1843158_1844322_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	38.4	8.6e-62
WP_003640763.1|1844743_1844950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640765.1|1845997_1846345_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003640766.1|1846441_1847653_-	MFS transporter	NA	NA	NA	NA	NA
WP_013355655.1|1847768_1848353_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003640768.1|1848495_1849014_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.1	9.5e-29
WP_015825672.1|1849032_1851369_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	2.3e-74
WP_003644563.1|1851390_1851741_-	LapA family protein	NA	NA	NA	NA	NA
WP_015825673.1|1851753_1852545_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003640772.1|1852554_1853490_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_041161696.1|1853922_1854207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825675.1|1854353_1855649_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003644567.1|1855896_1856652_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.8	1.6e-21
WP_003640776.1|1856648_1857566_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003640777.1|1857587_1859555_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_015825676.1|1859694_1861017_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015825677.1|1861124_1862576_-	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015825678.1|1862655_1863624_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015825679.1|1863608_1864883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015825680.1|1864879_1865908_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015825681.1|1865923_1867015_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003640784.1|1867014_1867680_-	sugar transferase	NA	NA	NA	NA	NA
WP_003644575.1|1868621_1869401_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_015640554.1|1869381_1870089_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003640788.1|1870107_1870866_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003640789.1|1871288_1873103_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003640790.1|1873285_1874026_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	2.2e-31
WP_003640791.1|1874018_1875494_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003640792.1|1875699_1875870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644577.1|1875925_1876333_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003640794.1|1876579_1876876_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.6	2.9e-22
WP_003640795.1|1876877_1877471_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003640796.1|1877629_1878895_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	1.6e-141
1881827:1881846	attR	GTCTTCCCATGGTCAACGTG	NA	NA	NA	NA
>prophage 7
NC_012984	Lactobacillus plantarum JDM1, complete sequence	3197759	2329645	2338156	3197759		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2329645_2330224_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_015380733.1|2330216_2331242_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_003642591.1|2331238_2332693_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_015825820.1|2332677_2334897_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-143
WP_011101895.1|2334889_2335570_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2335569_2335824_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2335825_2336557_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2336559_2337690_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2337673_2338156_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
