The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	155157	298879	3464618	transposase,tRNA,protease	Synechococcus_phage(11.43%)	109	NA	NA
WP_012748908.1|155157_155904_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_012748909.1|156049_156487_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_012748910.1|156509_156902_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_012748911.1|157026_157467_+	YbaK family protein	NA	NA	NA	NA	NA
WP_012748912.1|157531_158239_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A067ZJB6	Vibrio_phage	30.5	1.1e-14
WP_012748913.1|158337_159354_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_041269773.1|159393_160023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012748915.1|162148_162754_+	KinB signaling pathway activation protein	NA	NA	NA	NA	NA
WP_012748916.1|162850_163612_-	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
WP_012748917.1|171556_172459_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	33.1	2.8e-28
WP_041269551.1|172618_173182_+	RNA polymerase sigma factor SigW	NA	NA	NA	NA	NA
WP_012748919.1|173195_173807_+	anti-sigma-W factor RsiW	NA	NA	NA	NA	NA
WP_012748920.1|173908_174730_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_012748921.1|174722_175958_+	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_012748922.1|175986_177333_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_012748923.1|177797_179600_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.2	7.7e-102
WP_003247648.1|179921_180401_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_012748924.1|180707_181874_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.1	2.2e-25
WP_012748925.1|182203_183286_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_083767422.1|185561_186284_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012748926.1|186280_187456_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	24.0	7.7e-18
WP_012748927.1|188054_188513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012748928.1|188619_190017_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	39.9	2.6e-49
WP_041269778.1|190009_190696_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.0	2.9e-49
WP_012748925.1|190786_191869_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_012748931.1|192820_193291_+	YjdJ family protein	NA	NA	NA	NA	NA
WP_141103830.1|193397_194045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012748933.1|194346_194679_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012748934.1|194675_195368_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_012748935.1|195509_196220_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_012748936.1|196281_196746_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_012748937.1|197388_198075_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.2	3.2e-48
WP_012748938.1|198583_200545_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.9	8.6e-139
WP_156779777.1|200943_201138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012748939.1|201560_202229_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_012748940.1|202332_203289_+	sporulation protein	NA	NA	NA	NA	NA
WP_012748941.1|203573_204395_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_012748942.1|204442_205042_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012748943.1|205013_207095_-	histidine kinase	NA	NA	NA	NA	NA
WP_012748944.1|207265_207664_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	1.0e-51
WP_012748945.1|207676_208786_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	9.0e-85
WP_012748948.1|210086_211535_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_012748950.1|212323_213763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012748951.1|214243_215311_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	23.7	1.4e-10
WP_012748952.1|216321_216915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012748953.1|217308_218382_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_012748954.1|218729_219452_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_012748955.1|219463_220060_+	DedA family protein	NA	NA	NA	NA	NA
WP_012748956.1|220072_221212_+	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_012748957.1|221361_222456_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_041269554.1|222473_223850_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_083767423.1|223930_224653_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012748960.1|224744_226145_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.7	8.5e-64
WP_012748961.1|226241_226859_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012748962.1|226918_227278_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_012748963.1|227359_228373_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_012748964.1|228597_229761_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.7	1.9e-32
WP_003253419.1|229889_230171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003253417.1|230175_230526_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	2.0e-14
WP_012748965.1|230836_233023_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_012748966.1|233017_233131_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_012748967.1|233219_233687_+	SprT family protein	NA	NA	NA	NA	NA
WP_012748968.1|241510_241969_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_012748969.1|241965_242706_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_012748970.1|242665_243118_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_012748971.1|243114_244128_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.9	7.0e-68
WP_012748948.1|244466_245915_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_012748972.1|246134_247382_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	4.2e-62
WP_012748973.1|247627_249562_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.3	4.2e-61
WP_012748974.1|249686_250208_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_012748975.1|250197_250845_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_012748853.1|250878_252066_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012748976.1|252228_252384_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_012748977.1|252404_253151_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012748978.1|253165_253348_-	YdiK family protein	NA	NA	NA	NA	NA
WP_012748979.1|253352_254087_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012748980.1|254366_254651_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	2.2e-19
WP_012748981.1|254733_256353_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.6	1.4e-163
WP_012748982.1|256613_257852_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_012748983.1|257861_258356_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_012748984.1|258786_259869_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	5.3e-82
WP_083767424.1|259915_260959_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012748985.1|260952_263139_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_012748986.1|263342_264881_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.3	5.0e-17
WP_012748987.1|265175_266501_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.2	4.6e-51
WP_012748988.1|266587_267130_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012748989.1|267236_267680_-	NisI/SpaI family lantibiotic immunity lipoprotein	NA	NA	NA	NA	NA
WP_012748990.1|267732_268521_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_012748991.1|268522_269269_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_012748992.1|269283_269982_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	49.3	8.0e-55
WP_003253340.1|270314_271016_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012748994.1|271441_272815_-|transposase	IS1380-like element ISGsp2 family transposase	transposase	NA	NA	NA	NA
WP_012748995.1|273364_275023_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_012748996.1|275491_276859_-|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_012748997.1|277354_278233_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_156779778.1|284571_284712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012748998.1|285272_285710_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012748853.1|285921_287109_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012748999.1|287453_287942_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.0	1.6e-22
WP_083767466.1|287928_289080_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_012749001.1|289076_290372_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.8	2.9e-18
WP_012749002.1|290449_291178_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.6	4.1e-46
WP_012749003.1|291165_291420_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	37.0	1.2e-05
WP_012749004.1|291416_292103_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012749005.1|292086_294315_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.1	1.6e-168
WP_012749006.1|294290_295703_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	8.6e-48
WP_012749007.1|295719_296760_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.4	5.3e-71
WP_012749008.1|296756_297341_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.8	5.3e-28
WP_012749009.1|297340_298879_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.3	3.9e-78
>prophage 2
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	310184	382835	3464618	transposase,tRNA,holin	Bacteriophage(25.0%)	52	NA	NA
WP_012749019.1|310184_311432_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.1	7.1e-62
WP_012749020.1|311567_313115_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012749021.1|313241_313565_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012749022.1|313561_315313_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	55.7	4.1e-156
WP_012749023.1|316865_318089_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_012749025.1|318543_318993_+	hut operon transcriptional regulator HutP	NA	NA	NA	NA	NA
WP_012749026.1|319106_320633_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.2	3.9e-94
WP_012749027.1|321472_322276_-	VOC family protein	NA	NA	NA	NA	NA
WP_012749028.1|322281_323364_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	5.3e-82
WP_012749029.1|323527_324109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012749030.1|324302_324593_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_012749031.1|324606_326067_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_041269560.1|326080_327511_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_012749033.1|327868_328882_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_012749034.1|329043_331032_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_012749035.1|331163_332546_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_012749036.1|332589_333438_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156779779.1|333634_333796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749037.1|333959_334274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749040.1|335349_335985_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749041.1|335999_337127_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	34.6	2.7e-28
WP_012749042.1|337157_338060_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012749043.1|338515_338956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012749044.1|339100_340597_+	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_012749045.1|340600_341767_+	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_012749046.1|341756_345887_+	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_012749047.1|345883_347161_+	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_012749048.1|347505_348543_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_041269791.1|350426_352145_+	TIGR02556 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_012749050.1|352146_353103_+	type I-B CRISPR-associated protein Cas7/Csh2	NA	NA	NA	NA	NA
WP_012749051.1|353118_353856_+	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_012749052.1|353860_356194_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_012749053.1|356215_356713_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_012749054.1|356715_357717_+	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_012749055.1|357726_357990_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_012749056.1|358004_358754_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_012749057.1|361724_362924_+	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_012749058.1|362929_364243_+	TIGR02221 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_012749059.1|364268_365174_+	type III-B CRISPR module RAMP protein Cmr1	NA	NA	NA	NA	NA
WP_012749060.1|365170_366817_+	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_012749061.1|366813_367941_+	type III-B CRISPR module-associated protein Cmr3	NA	NA	NA	NA	NA
WP_012749062.1|367940_368819_+	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_012749063.1|368837_369221_+	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_012749064.1|369241_370381_+	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_012749065.1|371794_372328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749067.1|373435_374509_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.5	2.0e-41
WP_012749068.1|374498_375290_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749069.1|375300_376107_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749070.1|376103_377177_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012749072.1|377528_378776_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.1	4.2e-62
WP_012748853.1|380062_381250_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012749074.1|381668_382835_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
>prophage 3
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	488519	553032	3464618	transposase,protease	Planktothrix_phage(28.57%)	54	NA	NA
WP_012748853.1|488519_489707_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_156779781.1|489740_490154_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012749164.1|491627_491816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749165.1|491880_493404_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_012749166.1|493710_494358_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012749167.1|494672_494990_+	DUF3870 domain-containing protein	NA	NA	NA	NA	NA
WP_041269573.1|495022_496231_-	butyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_012749169.1|496227_497391_-	CoA transferase	NA	NA	NA	NA	NA
WP_156779797.1|497695_499702_-	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012749171.1|500251_501688_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_012749172.1|501788_502046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749173.1|503051_503615_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_012749174.1|503627_505157_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	31.4	2.7e-39
WP_012749175.1|506782_507610_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_041269575.1|507639_507828_-	YfhD family protein	NA	NA	NA	NA	NA
WP_012749177.1|507916_508045_-	YfhE family protein	NA	NA	NA	NA	NA
WP_012749178.1|508145_508697_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012749179.1|509319_510402_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	2.0e-81
WP_012749180.1|511223_512039_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_012749181.1|512035_512365_+	YfhH family protein	NA	NA	NA	NA	NA
WP_012749182.1|512410_512572_-	YpzG family protein	NA	NA	NA	NA	NA
WP_012749183.1|512604_512766_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_041269804.1|512883_513153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749185.1|513190_514171_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_012749186.1|514362_514854_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_012749187.1|514846_517810_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_012749188.1|518084_518432_+	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_012749189.1|518711_519500_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_012749190.1|519516_520791_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_012749191.1|520935_522036_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_012749192.1|522046_522271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012749193.1|522339_523089_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_012749194.1|523147_523333_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_012749195.1|523757_525005_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.4	8.4e-63
WP_012749196.1|525195_525468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749197.1|525549_526083_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_012749198.1|526157_527912_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	8.2e-56
WP_012749199.1|528317_529691_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_012749200.1|529913_530939_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	2.0e-17
WP_012749201.1|530904_531870_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.0e-23
WP_041269806.1|531922_533527_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012749203.1|533594_534599_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749204.1|534618_535518_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749205.1|535555_536617_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_012749206.1|537806_539066_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_156779782.1|539139_543609_-	glutamate synthase	NA	NA	NA	NA	NA
WP_012749208.1|543861_545157_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_012749209.1|545269_546274_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	5.8e-22
WP_012749210.1|546266_547058_+	daunorubicin ABC transporter permease	NA	NA	NA	NA	NA
WP_012749211.1|547061_547847_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749212.1|548155_549115_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_012749213.1|549152_550778_+	L-lactate permease	NA	NA	NA	NA	NA
WP_041269576.1|550881_551505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012748845.1|551718_553032_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	577638	643780	3464618	transposase,integrase	Streptococcus_phage(33.33%)	59	582159:582176	625353:625370
WP_012748994.1|577638_579012_-|transposase	IS1380-like element ISGsp2 family transposase	transposase	NA	NA	NA	NA
WP_012749229.1|579258_580416_+	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	45.8	3.8e-25
WP_156482456.1|580584_580752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749230.1|581423_582212_-	hypothetical protein	NA	NA	NA	NA	NA
582159:582176	attL	AACAAGCGCGATCGCCAT	NA	NA	NA	NA
WP_012749232.1|582664_583642_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012749233.1|583652_584336_-	response regulator	NA	NA	NA	NA	NA
WP_041269809.1|584347_585925_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	5.7e-08
WP_012749235.1|586038_587070_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012749236.1|587228_588494_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012749237.1|588794_589409_+	NAD(P)H:quinone oxidoreductase	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	29.1	3.5e-06
WP_012749238.1|589516_590344_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	52.2	4.0e-77
WP_012749239.1|590538_591225_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_012749240.1|591285_592632_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012749241.1|592659_593574_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_012749242.1|593705_594104_+	YhcU family protein	NA	NA	NA	NA	NA
WP_012749243.1|594134_594611_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012749244.1|594607_595048_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_012749245.1|595194_596883_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_012749246.1|596987_597431_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	37.1	4.3e-14
WP_012749247.1|597530_599279_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	49.7	1.1e-164
WP_012749248.1|599653_600736_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	1.2e-81
WP_012749249.1|602608_603139_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012749250.1|603827_604079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097354921.1|604201_604747_-	DedA family protein	NA	NA	NA	NA	NA
WP_012749252.1|606628_608497_+	ATPase AAA	NA	NA	NA	NA	NA
WP_012749253.1|608835_610272_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	9.8e-07
WP_012749255.1|610813_611395_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011230081.1|611712_612186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749256.1|612322_613045_+	iron permease	NA	NA	NA	NA	NA
WP_011230084.1|613336_613645_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011230085.1|613659_614607_+	cation transporter	NA	NA	NA	NA	NA
WP_011230086.1|614632_615679_+	SidA/IucD/PvdA family monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.0	7.6e-17
WP_011230088.1|616865_617234_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	78.7	1.8e-50
WP_012749257.1|617226_619365_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	84.8	0.0e+00
WP_041269580.1|621136_622558_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_012749259.1|623109_624459_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012749260.1|624455_625469_+	cytochrome D ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
625353:625370	attR	ATGGCGATCGCGCTTGTT	NA	NA	NA	NA
WP_041269581.1|625733_626123_+	sulfur reduction protein DsrE	NA	NA	NA	NA	NA
WP_012749263.1|626136_626370_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_041269582.1|626468_626666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749264.1|626690_627257_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012749265.1|627391_627793_+	rhodanese	NA	NA	NA	NA	NA
WP_012749266.1|627759_628020_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_003252677.1|628111_628339_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_012749267.1|628395_628878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749268.1|628890_629256_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_012749269.1|629275_629572_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_012749270.1|629599_630169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749271.1|630216_631353_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012749272.1|631372_631600_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_012749273.1|631663_632458_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012749274.1|632562_632853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749275.1|633096_634137_+	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	24.7	3.9e-13
WP_012749276.1|634932_635235_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012749277.1|635572_636523_+	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_012749278.1|637062_638457_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_012749279.1|638762_640421_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_012749280.1|641782_642208_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012749281.1|642310_643780_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	867569	924252	3464618	transposase	Geobacillus_virus(22.22%)	47	NA	NA
WP_012749488.1|867569_868760_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	3.4e-29
WP_012749489.1|869557_871045_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_012749490.1|871041_871530_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_041269831.1|873370_873703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749492.1|874001_875462_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012749493.1|875808_876261_+	OsmC family protein	NA	NA	NA	NA	NA
WP_012749494.1|876286_877219_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_041269595.1|877335_878595_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_012749074.1|878915_880082_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
WP_012749496.1|880385_881327_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_012749497.1|881592_881937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012748853.1|882849_884037_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012749498.1|884168_885632_-|transposase	transposase	transposase	A0A0H3UZK2	Geobacillus_virus	75.2	2.2e-211
WP_041269597.1|886515_886914_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_012749500.1|886926_887286_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_012749501.1|887354_888107_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012749502.1|888125_888557_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_012749503.1|888743_889913_+	amidohydrolase	NA	NA	NA	NA	NA
WP_012749504.1|889887_890712_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012749505.1|890728_891844_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_012749506.1|892025_893567_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_012749507.1|893566_893908_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_012749498.1|894685_896149_+|transposase	transposase	transposase	A0A0H3UZK2	Geobacillus_virus	75.2	2.2e-211
WP_012749508.1|896393_897824_+	amino acid permease	NA	NA	NA	NA	NA
WP_012749509.1|897990_898728_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_012749510.1|898724_899774_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_012749511.1|900017_900227_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	65.6	2.9e-13
WP_012749512.1|900723_901068_-	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_012749516.1|901626_903399_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_012749517.1|903594_905829_+	PAS domain S-box protein	NA	Q6XLU9	Feldmannia_irregularis_virus	22.0	1.3e-05
WP_012749518.1|905803_906301_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	50.0	1.9e-18
WP_012749519.1|906478_907489_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749520.1|907433_908981_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	1.5e-16
WP_012749521.1|908977_910123_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012749522.1|910109_911180_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_012749523.1|911202_912405_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_012749524.1|912743_913559_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_012749525.1|913659_914832_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_012749526.1|915113_916355_+	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
WP_012749527.1|916351_917011_+	2-hydroxy-3-keto-5-methylthiopentenyl-1- phosphate phosphatase	NA	NA	NA	NA	NA
WP_012749528.1|917007_917649_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_012749529.1|917672_918215_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012749530.1|918257_918989_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_012749531.1|919273_919717_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041269833.1|919809_920373_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_012749533.1|920414_922427_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_012749534.1|923004_924252_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	38.1	5.3e-57
>prophage 6
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	930386	975575	3464618	transposase,protease	Yersinia_phage(16.67%)	38	NA	NA
WP_012749092.1|930386_931667_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_082798116.1|932454_932892_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749538.1|932903_933572_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012749541.1|935924_936677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749542.1|936707_936953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749543.1|937248_938616_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012749544.1|939001_940438_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_012749546.1|940867_941746_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012749547.1|941946_942837_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_012749548.1|943291_943639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083767429.1|945407_946463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749550.1|946881_947937_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012749551.1|948258_949680_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012749552.1|950071_950617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012749553.1|950860_953038_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	40.2	8.4e-127
WP_012749554.1|953251_953974_+	FixH family protein	NA	NA	NA	NA	NA
WP_012749555.1|954072_955116_+	membrane protein	NA	NA	NA	NA	NA
WP_012749556.1|955372_956887_+	spore germination protein	NA	NA	NA	NA	NA
WP_012749557.1|956901_958347_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_012749558.1|958541_959207_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.8	2.3e-67
WP_012749559.1|959203_959638_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_041269599.1|959640_960372_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	47.6	2.1e-61
WP_012749561.1|961330_961507_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_012749562.1|961639_962233_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	50.3	3.9e-42
WP_012749563.1|962412_962607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863249.1|962781_963390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863250.1|963757_964003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269602.1|964245_964536_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_015863251.1|964591_965230_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_156779784.1|965363_965609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863253.1|966124_966886_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015863254.1|966978_967785_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_015863255.1|967967_968825_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_012749415.1|969193_970474_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015863256.1|970872_972900_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	7.1e-11
WP_041269604.1|973000_973267_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_015863258.1|973266_974988_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_015863259.1|975017_975575_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.7	1.9e-19
>prophage 7
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	1292586	1352274	3464618	transposase	Bacillus_phage(27.27%)	53	NA	NA
WP_015863565.1|1292586_1293834_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.1	3.2e-62
WP_015863566.1|1293982_1295989_+	transketolase	NA	NA	NA	NA	NA
WP_015863567.1|1296145_1296583_+	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
WP_015863568.1|1296670_1296883_+	YneF family protein	NA	NA	NA	NA	NA
WP_015863569.1|1296996_1298766_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.4	1.2e-51
WP_015863570.1|1298747_1300532_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	2.8e-51
WP_015863571.1|1300548_1300725_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_015863572.1|1300895_1301603_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_015863573.1|1301635_1301992_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.8	1.6e-06
WP_015863574.1|1302068_1302551_+	cytochrome c biogenesis protein CcdC	NA	NA	NA	NA	NA
WP_015863575.1|1302600_1303035_-	DUF2621 family protein	NA	NA	NA	NA	NA
WP_015863576.1|1303296_1303965_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HRV8	Bacillus_phage	39.8	1.5e-26
WP_012748996.1|1304545_1305913_+|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_015863577.1|1305930_1306242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863578.1|1306333_1306480_-	small acid-soluble spore protein P	NA	NA	NA	NA	NA
WP_015863579.1|1306605_1306866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863580.1|1307233_1308316_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_015863581.1|1308582_1311309_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_015863582.1|1311350_1311488_-	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_015863583.1|1311552_1312491_-	DMT family transporter	NA	NA	NA	NA	NA
WP_041269622.1|1312783_1313449_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_015863585.1|1313457_1313676_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_015863586.1|1313713_1313974_-	DUF2564 family protein	NA	NA	NA	NA	NA
WP_015863587.1|1314104_1314305_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	58.7	2.1e-16
WP_015863588.1|1314637_1314889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863589.1|1315257_1315656_+	sporulation protein SpoOM	NA	NA	NA	NA	NA
WP_015863590.1|1315897_1316725_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	33.7	9.5e-31
WP_015863591.1|1316744_1318235_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_015863592.1|1318569_1319592_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	8.5e-21
WP_015863593.1|1319578_1320505_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	7.7e-21
WP_015863594.1|1320523_1321492_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015863595.1|1321508_1322411_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015863596.1|1322426_1324208_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015863597.1|1324497_1324830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863598.1|1324857_1325241_+	VOC family protein	NA	NA	NA	NA	NA
WP_015863599.1|1325258_1326326_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_041269624.1|1326441_1326924_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_015863601.1|1327850_1328828_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_015863602.1|1328834_1330313_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015863603.1|1330716_1331964_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	5.4e-62
WP_015863604.1|1332065_1333724_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_015863605.1|1333742_1335017_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_015863606.1|1335110_1336439_+	YjiH family protein	NA	NA	NA	NA	NA
WP_015863607.1|1336494_1336890_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_015863608.1|1337095_1338469_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_015863609.1|1338779_1340006_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_015863610.1|1340574_1341828_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015863611.1|1342700_1343915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863612.1|1344304_1345984_+	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_015863613.1|1345952_1348463_+	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_015863614.1|1348492_1348822_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_041269625.1|1349141_1350767_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015863615.1|1350825_1352274_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	1372096	1443789	3464618	transposase,tRNA	Bacteriophage(28.57%)	49	NA	NA
WP_015863625.1|1372096_1372948_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_015863626.1|1373032_1373542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863627.1|1374428_1375217_+	NERD nuclease	NA	A0A2R2ZH57	Clostridioides_phage	30.9	4.4e-25
WP_015863628.1|1375270_1375894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269627.1|1376110_1376848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863630.1|1376834_1377407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863631.1|1377461_1377716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269628.1|1378994_1379237_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015863634.1|1379408_1380806_-	GABA permease	NA	NA	NA	NA	NA
WP_015863635.1|1381250_1382864_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041269629.1|1383064_1384531_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015863637.1|1384660_1386013_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_041269630.1|1386975_1387452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269860.1|1387708_1388275_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015863640.1|1388383_1388749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012749092.1|1389728_1391009_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015863641.1|1392180_1393428_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.1	2.4e-62
WP_015863642.1|1393593_1395711_+	SEC-C motif domain-containing protein	NA	NA	NA	NA	NA
WP_015863643.1|1395940_1396111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863645.1|1396350_1399152_-	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	25.2	5.2e-28
WP_015863646.1|1399148_1400762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012749072.1|1400931_1402179_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.1	4.2e-62
WP_015863647.1|1402299_1402572_+	DUF3986 family protein	NA	NA	NA	NA	NA
WP_015863648.1|1402637_1403240_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015863640.1|1403348_1403714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863650.1|1405266_1406571_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_015863651.1|1406777_1406972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863652.1|1406952_1408365_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_015863653.1|1408768_1409761_+	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_041269631.1|1410227_1411223_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_015863655.1|1411242_1411857_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_015863656.1|1411871_1412267_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_015863657.1|1412707_1413610_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015863658.1|1413734_1418297_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_015863659.1|1418499_1419981_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_015863660.1|1420286_1420742_+	OsmC family protein	NA	NA	NA	NA	NA
WP_015863661.1|1421079_1421310_-	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_015863662.1|1421306_1421777_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_015863663.1|1422173_1423196_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_015863664.1|1424005_1424488_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_049756985.1|1424911_1426231_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	31.3	6.6e-50
WP_015863665.1|1428614_1428992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863666.1|1428999_1429428_+	hypothetical protein	NA	A0A1P8DJD6	Virus_Rctr71	42.1	1.0e-15
WP_015863668.1|1431772_1432411_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_015863669.1|1432713_1434825_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_015863670.1|1435253_1436978_+	serine hydrolase	NA	NA	NA	NA	NA
WP_015863671.1|1436997_1439094_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_015863673.1|1440425_1441616_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	1.8e-30
WP_012749092.1|1442508_1443789_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	1457380	1528593	3464618	transposase	Clostridium_phage(33.33%)	49	NA	NA
WP_015863684.1|1457380_1458247_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041269868.1|1458825_1459413_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_015863686.1|1459399_1460506_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.9e-30
WP_015863687.1|1460502_1461429_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015863688.1|1461425_1462238_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015863689.1|1462256_1463594_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015863690.1|1463737_1464466_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.6	7.6e-16
WP_015863691.1|1464676_1466008_-	amino acid permease	NA	NA	NA	NA	NA
WP_015863692.1|1466239_1467985_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_015863693.1|1468546_1469446_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_015863695.1|1469882_1470623_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.3e-15
WP_015863696.1|1470629_1471685_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_015863697.1|1471681_1472560_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_015863699.1|1472995_1474243_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	3.2e-62
WP_041269636.1|1474295_1475141_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012748845.1|1475232_1476546_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015863700.1|1476968_1477955_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_015863701.1|1478673_1480803_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_015863702.1|1480822_1481266_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_015863703.1|1481262_1481541_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_015863704.1|1481553_1482849_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_015863705.1|1482951_1483944_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_015863706.1|1483953_1484685_+	creatininase family protein	NA	NA	NA	NA	NA
WP_015863707.1|1484671_1485400_+	oxo-acid lyase	NA	NA	NA	NA	NA
WP_015863708.1|1485396_1486140_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_015863608.1|1486779_1488153_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_012749221.1|1489943_1491311_-|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_015863711.1|1492871_1493126_+	hypothetical protein	NA	A0A0A8WF72	Clostridium_phage	43.6	5.2e-12
WP_015863712.1|1493115_1493502_+	hypothetical protein	NA	A0A0A8WIU2	Clostridium_phage	37.9	9.9e-15
WP_015863713.1|1494510_1494960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863714.1|1495070_1496195_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012748845.1|1498928_1500242_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015863716.1|1500531_1501980_-|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
WP_083767432.1|1502289_1503828_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_015863673.1|1504267_1505458_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	1.8e-30
WP_015863719.1|1507444_1508857_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_015863720.1|1510335_1510626_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_082798132.1|1510652_1510817_+	DUF4937 domain-containing protein	NA	NA	NA	NA	NA
WP_015863721.1|1511152_1512313_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_015863722.1|1512823_1513621_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015863723.1|1513620_1514298_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015863724.1|1514701_1516027_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_012748925.1|1516428_1517511_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_041269642.1|1518337_1519108_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_015863727.1|1519552_1520383_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_083767433.1|1520542_1522096_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_049756987.1|1522116_1522737_+	EamA family transporter	NA	NA	NA	NA	NA
WP_049756988.1|1525029_1527024_-	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	27.7	3.8e-49
WP_015863729.1|1527144_1528593_-|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	1556167	1628332	3464618	transposase	Bacillus_virus(40.0%)	56	NA	NA
WP_012748996.1|1556167_1557535_+|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_015863752.1|1557800_1558814_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_015863753.1|1558835_1560380_+	gluconokinase	NA	NA	NA	NA	NA
WP_015863754.1|1560429_1561779_+	GntP family permease	NA	NA	NA	NA	NA
WP_015863755.1|1561816_1562302_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015863757.1|1562816_1564256_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015863758.1|1564368_1565133_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_015863759.1|1565362_1565926_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015863760.1|1567159_1568182_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_015863761.1|1568257_1569967_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_015863762.1|1570197_1571631_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015863763.1|1571650_1572499_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_015863764.1|1572514_1573696_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015863766.1|1573963_1574155_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_012748853.1|1574331_1575519_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015863767.1|1575716_1576016_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015863768.1|1577333_1578269_+	endonuclease I	NA	A0A2P0VMP9	Tetraselmis_virus	33.0	5.9e-13
WP_015863769.1|1578297_1579257_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_015863770.1|1579614_1579836_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_015863771.1|1579839_1581837_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_015863772.1|1581888_1582074_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_015863773.1|1582552_1583305_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_015863774.1|1583301_1584213_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_015863775.1|1584241_1586113_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_015863777.1|1586743_1588402_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_133066516.1|1589457_1590519_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_015863779.1|1590964_1591855_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_015863780.1|1592004_1592871_+	permease	NA	NA	NA	NA	NA
WP_015863781.1|1592885_1593731_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_015863782.1|1593767_1594694_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015863783.1|1594785_1595187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863784.1|1595390_1596140_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_015863785.1|1596393_1597707_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.1	2.4e-15
WP_015863786.1|1597907_1598183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863787.1|1598378_1598624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863788.1|1598741_1599542_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_015863789.1|1599672_1600206_+	hemerythrin	NA	NA	NA	NA	NA
WP_015863790.1|1600279_1600984_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_041269648.1|1600985_1601534_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_015863792.1|1603008_1606692_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_015863793.1|1606874_1607381_+	membrane protein	NA	NA	NA	NA	NA
WP_083767435.1|1608137_1609430_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015863795.1|1609857_1610616_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_015863796.1|1611518_1612070_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	43.1	2.5e-35
WP_015863797.1|1612128_1613604_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	48.1	4.8e-118
WP_083767436.1|1613901_1615773_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_015863799.1|1617428_1618709_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015863800.1|1620606_1621092_+	RraA family protein	NA	NA	NA	NA	NA
WP_015863801.1|1621468_1621867_+	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015863802.1|1621863_1622604_+	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_015863803.1|1622605_1622890_+	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015863804.1|1622886_1623603_+	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_015863805.1|1623620_1624463_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	35.2	3.1e-05
WP_015863806.1|1624531_1626094_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_015863807.1|1626109_1626943_+	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_015863799.1|1627051_1628332_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	1650810	1716764	3464618	transposase,integrase	Virus_Rctr71(23.08%)	54	1686623:1686637	1719803:1719817
WP_012748925.1|1650810_1651893_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_015863831.1|1652139_1652751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863832.1|1652896_1653604_+	toxin	NA	NA	NA	NA	NA
WP_015863833.1|1653665_1654460_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	91.7	4.5e-147
WP_015863834.1|1654472_1654961_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	48.5	7.3e-39
WP_015863835.1|1655064_1655505_+	YndM family protein	NA	NA	NA	NA	NA
WP_015863836.1|1655705_1656977_+	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_015863837.1|1657083_1657335_+	YpmP family protein	NA	NA	NA	NA	NA
WP_015863580.1|1657680_1658763_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_015863838.1|1658893_1659736_+	DegV family protein	NA	NA	NA	NA	NA
WP_015863839.1|1659770_1660337_+	SCO family protein	NA	NA	NA	NA	NA
WP_015863840.1|1660415_1661210_+	lipase	NA	NA	NA	NA	NA
WP_015863841.1|1661206_1661782_+	YpmS family protein	NA	NA	NA	NA	NA
WP_015863842.1|1661810_1663175_-	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_015863843.1|1663216_1663810_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_015863844.1|1664002_1664428_+	OsmC family protein	NA	NA	NA	NA	NA
WP_015863845.1|1665103_1666336_-	peptidase T	NA	NA	NA	NA	NA
WP_015863846.1|1666790_1667372_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_015863847.1|1667903_1668509_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_049757036.1|1669320_1669611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863850.1|1669752_1670181_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015863851.1|1670182_1670680_+	GNAT family N-acetyltransferase	NA	A0A1B2IAV9	Erwinia_phage	34.1	8.3e-06
WP_015863852.1|1670697_1671195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863854.1|1671425_1672508_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	1.6e-81
WP_015863855.1|1672757_1673516_-	uridine phosphorylase	NA	NA	NA	NA	NA
WP_015863856.1|1674237_1674963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863857.1|1675909_1677406_+	NADH dehydrogenase subunit 5	NA	NA	NA	NA	NA
WP_015863858.1|1677409_1680055_+	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
WP_015863859.1|1680306_1680609_+	ATP synthase subunit B	NA	NA	NA	NA	NA
WP_015863860.1|1680662_1682336_+	AarF/ABC1/UbiB kinase family protein	NA	A9YVW0	Ostreococcus_tauri_virus	32.7	8.9e-52
WP_012749221.1|1684458_1685826_+|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
1686623:1686637	attL	TGATGTGTATGATAT	NA	NA	NA	NA
WP_015863861.1|1687706_1688126_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_015863862.1|1688273_1690244_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	45.1	2.8e-137
WP_015863863.1|1690243_1692688_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.8	5.8e-108
WP_015863864.1|1692725_1693430_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015863865.1|1693697_1695113_+	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_015863866.1|1695230_1696922_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_041269658.1|1696945_1697659_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_015863868.1|1697800_1699213_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_015863869.1|1699418_1699850_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_015863870.1|1699948_1701448_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1V0SL42	Klosneuvirus	33.5	2.7e-60
WP_015863871.1|1701519_1702683_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_015863872.1|1702709_1703582_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_015863873.1|1703737_1704181_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_015863874.1|1705672_1706644_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_015863875.1|1706718_1707621_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_015863876.1|1707778_1708153_+	replication terminator protein	NA	A0A0K2CP62	Brevibacillus_phage	41.2	1.9e-15
WP_015863877.1|1708319_1709192_+	MoxR family ATPase	NA	R4TG24	Halovirus	27.8	1.5e-10
WP_015863878.1|1709202_1711119_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_015863879.1|1711138_1712377_+	oligoribonuclease	NA	NA	NA	NA	NA
WP_015863880.1|1713206_1713410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083767438.1|1713635_1713770_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015863881.1|1714361_1715267_+|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	30.5	3.9e-17
WP_041269884.1|1715306_1716764_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1719803:1719817	attR	ATATCATACACATCA	NA	NA	NA	NA
>prophage 12
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	1732448	1780821	3464618	transposase	Paenibacillus_phage(30.0%)	36	NA	NA
WP_012748951.1|1732448_1733516_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	23.7	1.4e-10
WP_012749074.1|1736290_1737457_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
WP_015863895.1|1738206_1738386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015863896.1|1738647_1739592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863897.1|1740213_1740375_-	DUF469 family protein	NA	NA	NA	NA	NA
WP_015863898.1|1740937_1742155_-	MFS transporter	NA	NA	NA	NA	NA
WP_083767440.1|1742898_1743126_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041269662.1|1743361_1743580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156779786.1|1743598_1743739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083767441.1|1743938_1747016_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.8	2.0e-57
WP_012749074.1|1747177_1748344_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
WP_015863900.1|1748540_1749242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863901.1|1749280_1750357_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	28.9	6.8e-21
WP_015863902.1|1750514_1751453_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	58.5	3.0e-105
WP_083767442.1|1751445_1751967_-	NAD-dependent epimerase/dehydratase family protein	NA	M4QRT5	Synechococcus_phage	55.8	4.2e-32
WP_049756993.1|1752250_1753477_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012748845.1|1753601_1754915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083767443.1|1755233_1755791_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3I0Y8	Synechococcus_phage	66.7	2.3e-57
WP_012748997.1|1755929_1756808_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015863779.1|1757091_1757982_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_015863904.1|1759327_1760071_-	uridine phosphorylase	NA	NA	NA	NA	NA
WP_015863906.1|1761231_1762068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756994.1|1763235_1763568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863907.1|1763765_1764323_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_015863908.1|1764463_1765717_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.4e-09
WP_015863909.1|1765709_1766510_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_156779787.1|1767233_1767854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041269664.1|1770648_1770840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863911.1|1771032_1771455_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015863912.1|1771828_1772092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863913.1|1772113_1773178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041269666.1|1773407_1773890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749074.1|1774824_1775991_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
WP_015863915.1|1776312_1777896_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_015863916.1|1777978_1778182_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_012749092.1|1779540_1780821_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	1808323	1932685	3464618	transposase	Virus_Rctr71(16.0%)	109	NA	NA
WP_015863934.1|1808323_1809499_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	24.3	2.7e-18
WP_015863935.1|1809698_1810238_-	MFS transporter	NA	NA	NA	NA	NA
WP_015863936.1|1810234_1811662_-	FAD-binding oxidoreductase	NA	A0A2K9L3G7	Tupanvirus	32.1	3.3e-55
WP_015863937.1|1811822_1812683_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015863938.1|1812731_1813115_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	54.6	5.8e-31
WP_015863940.1|1813807_1814623_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015863941.1|1815012_1815960_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015863942.1|1816308_1816983_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015863943.1|1817027_1817657_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.0	2.5e-23
WP_015863944.1|1818145_1819549_+	amino acid permease	NA	NA	NA	NA	NA
WP_015863945.1|1819952_1820156_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041269901.1|1820235_1820916_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015863947.1|1821463_1822291_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	5.1e-16
WP_015863948.1|1824530_1825520_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_015863949.1|1825807_1826890_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	47.9	2.7e-81
WP_015863950.1|1827544_1828720_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	24.0	5.9e-18
WP_041269672.1|1829391_1830528_-	KamA family radical SAM protein	NA	NA	NA	NA	NA
WP_041269673.1|1831197_1832685_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_015863954.1|1832671_1833151_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_015863955.1|1833800_1835972_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_015863956.1|1837792_1838278_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_015863957.1|1838650_1839886_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	63.0	3.1e-142
WP_015863958.1|1839857_1841102_-	DNA polymerase IV	NA	A0A1W6JNT0	Morganella_phage	31.0	1.1e-27
WP_015863580.1|1841265_1842348_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_015863959.1|1843266_1844601_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015863960.1|1844677_1845367_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_041269675.1|1845561_1846017_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015863962.1|1846429_1846624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269906.1|1846691_1847297_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015863965.1|1847617_1848019_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_015863966.1|1848015_1848465_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_015863967.1|1848487_1849252_-	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	1.5e-14
WP_015863969.1|1849728_1850481_-	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	29.1	7.1e-25
WP_015863970.1|1851072_1852494_+	amino acid permease	NA	NA	NA	NA	NA
WP_015863971.1|1852673_1853342_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015863972.1|1853419_1853881_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015863973.1|1853935_1854334_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_015863974.1|1854339_1855617_-	glutathionylspermidine synthase family protein	NA	NA	NA	NA	NA
WP_015863975.1|1855619_1855949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041269907.1|1855945_1856407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863977.1|1856545_1857094_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012749199.1|1857603_1858977_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_015863978.1|1859198_1859894_+	DUF3153 domain-containing protein	NA	NA	NA	NA	NA
WP_015863673.1|1860002_1861193_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	1.8e-30
WP_015863979.1|1861918_1862158_-	transporter suffix domain-containing protein	NA	NA	NA	NA	NA
WP_015863980.1|1862233_1862536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863982.1|1864916_1865261_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
WP_041269676.1|1865484_1865802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083767445.1|1865773_1866328_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015863983.1|1867021_1867225_-	copper chaperone CopZ	NA	A0A218MNH0	uncultured_virus	40.6	8.0e-08
WP_015863984.1|1867246_1869640_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.2	5.1e-125
WP_015863985.1|1869653_1869965_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_015863986.1|1870042_1870807_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_015863987.1|1870956_1871313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863989.1|1872460_1873909_-|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
WP_015863990.1|1874358_1875237_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_012749072.1|1875291_1876539_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.1	4.2e-62
WP_015863992.1|1877434_1878415_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015863993.1|1878407_1879325_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.8	7.6e-37
WP_015863994.1|1879321_1880116_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_041269677.1|1880298_1881252_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015863996.1|1881511_1882396_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015863997.1|1883133_1883520_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_015863998.1|1883752_1883953_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	59.1	7.2e-17
WP_015863999.1|1884153_1884711_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_015864000.1|1884975_1886223_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	5.4e-62
WP_015864001.1|1886694_1887060_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	53.1	1.1e-26
WP_015864002.1|1887187_1888903_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
WP_015864003.1|1888877_1889777_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.6e-23
WP_015864004.1|1889742_1890159_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015864005.1|1890279_1890957_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015864006.1|1891155_1892412_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_015864007.1|1892457_1893387_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015864008.1|1893367_1894300_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015864009.1|1894738_1896115_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_015864010.1|1896382_1897591_+	MFS transporter	NA	NA	NA	NA	NA
WP_015864011.1|1897698_1897914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864013.1|1898611_1900306_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_015864014.1|1900316_1900955_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015864015.1|1900959_1901400_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015864016.1|1901854_1903417_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_015864017.1|1903428_1904211_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_015864018.1|1904228_1905128_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.4	6.7e-38
WP_015864019.1|1905141_1905354_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_015864020.1|1905376_1906729_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_012749546.1|1908250_1909129_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015864021.1|1909510_1910653_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015864022.1|1910799_1911444_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015864023.1|1911602_1912061_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_015864024.1|1912258_1912507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864026.1|1912692_1913490_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012748845.1|1913759_1915073_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864027.1|1915346_1916429_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	47.9	1.6e-81
WP_015864028.1|1916777_1917986_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_015864029.1|1918339_1919503_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_012748925.1|1919677_1920760_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_015864030.1|1921000_1921657_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_015864031.1|1921752_1923120_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_015864032.1|1923427_1923580_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_073967981.1|1923615_1923714_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_015864034.1|1923844_1924777_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_108430348.1|1924879_1925014_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_015864036.1|1925166_1926045_-	cation transporter	NA	NA	NA	NA	NA
WP_015864037.1|1926251_1927097_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_015864038.1|1927261_1927969_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_015864039.1|1928365_1929646_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041269682.1|1930060_1930462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864043.1|1930989_1931148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864044.1|1931437_1932685_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.1	1.4e-62
>prophage 14
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	1961128	2021788	3464618	transposase,coat	Bacillus_phage(40.0%)	49	NA	NA
WP_015864080.1|1961128_1961362_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_015864081.1|1961706_1962972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864082.1|1962989_1965248_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	30.7	3.3e-09
WP_015864083.1|1965366_1966137_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015864084.1|1966403_1967612_-	NAD-dependent malic enzyme 4	NA	NA	NA	NA	NA
WP_015864085.1|1967801_1969985_-	malate synthase G	NA	NA	NA	NA	NA
WP_015864086.1|1970100_1971558_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_015864087.1|1971554_1972913_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_015864088.1|1972914_1974246_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_083767450.1|1974411_1975323_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015864090.1|1975360_1976143_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_015864091.1|1976490_1977864_+|transposase	IS1380-like element ISGsp2 family transposase	transposase	NA	NA	NA	NA
WP_015864092.1|1978038_1978671_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012749248.1|1978840_1979923_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	1.2e-81
WP_015864093.1|1980292_1981216_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	52.9	4.6e-82
WP_015864094.1|1981290_1982697_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.7	1.1e-39
WP_083767451.1|1982697_1983381_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.8	2.9e-49
WP_015864096.1|1983343_1984351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864097.1|1985548_1986943_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.5	2.6e-65
WP_015864098.1|1987028_1988387_+	peptidase S8	NA	A0A127AWU5	Bacillus_phage	35.9	3.3e-36
WP_015864100.1|1990259_1991627_+|transposase	ISLre2-like element ISGsp4 family transposase	transposase	NA	NA	NA	NA
WP_015864101.1|1992205_1993678_+	amino acid permease	NA	NA	NA	NA	NA
WP_015864102.1|1993703_1993871_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_081188853.1|1993946_1994132_-	H-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_015864104.1|1994125_1994308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864105.1|1994407_1995403_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_015864106.1|1995441_1996101_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_015864107.1|1996112_1996916_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_015864108.1|1996930_1997740_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_012748845.1|1998378_1999692_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864109.1|1999870_2000902_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	40.6	7.7e-54
WP_015864110.1|2000914_2002582_-	membrane protein	NA	NA	NA	NA	NA
WP_015864111.1|2002732_2004415_-	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_015864112.1|2004652_2005321_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_015864113.1|2005317_2006172_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015864114.1|2006794_2007445_+	amino acid transporter	NA	NA	NA	NA	NA
WP_015864115.1|2007434_2008190_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_015864116.1|2008179_2009166_-	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_015864117.1|2009140_2009842_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_015864118.1|2010126_2010675_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_015864119.1|2010779_2012177_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.5	4.4e-28
WP_041269915.1|2012393_2013854_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_041269916.1|2014170_2015697_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_015864122.1|2015952_2017134_+	MFS transporter	NA	NA	NA	NA	NA
WP_015864123.1|2017954_2018350_-	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_015864124.1|2018346_2019021_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	54.7	1.4e-35
WP_015864125.1|2019107_2019521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864126.1|2019725_2020094_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_012748845.1|2020474_2021788_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	2056273	2190527	3464618	tRNA,transposase,integrase,protease,coat	Streptococcus_phage(20.0%)	98	2107177:2107206	2166105:2166134
WP_015864164.1|2056273_2056819_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_015864165.1|2058215_2059016_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015864166.1|2062251_2062467_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_015864167.1|2062587_2063085_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_015864168.1|2063098_2065279_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_015864169.1|2065291_2065993_-	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_015864170.1|2065995_2066883_-	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_015864171.1|2066879_2068685_-	CRISPR-associated protein Cst1	NA	NA	NA	NA	NA
WP_015864172.1|2068681_2069410_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_012748997.1|2071754_2072633_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015864173.1|2072853_2074059_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_015864174.1|2074198_2075875_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_041269690.1|2076068_2076623_+	VanZ family protein	NA	NA	NA	NA	NA
WP_015864176.1|2076954_2078079_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.6	2.2e-70
WP_015864177.1|2078075_2079317_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.0	1.1e-102
WP_015864178.1|2079353_2079638_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_015864179.1|2079790_2080213_-	GtrA family protein	NA	NA	NA	NA	NA
WP_041269691.1|2080316_2080595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864180.1|2080661_2081042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269919.1|2081189_2081738_-	shikimate kinase	NA	NA	NA	NA	NA
WP_015864182.1|2081795_2082575_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	35.6	8.1e-24
WP_015864183.1|2083068_2083914_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_041269692.1|2084200_2084656_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_015864186.1|2084714_2086283_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	33.7	3.9e-17
WP_015864187.1|2086663_2087101_-	DUF4275 family protein	NA	NA	NA	NA	NA
WP_015864188.1|2087111_2088035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864189.1|2088119_2089439_+	M20/M25/M40 family metallo-hydrolase	NA	A0A0K2CPK3	Brevibacillus_phage	48.3	8.9e-55
WP_015864190.1|2089689_2092185_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015864191.1|2092204_2093899_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_015864192.1|2093923_2097229_-	helicase	NA	NA	NA	NA	NA
WP_015864193.1|2097356_2099798_-	DNA helicase	NA	Q5YA94	Bacillus_phage	27.1	1.0e-35
WP_015864194.1|2099790_2100117_-	nucleoside triphosphate pyrophosphohydrolase	NA	A0A2I7SAA6	Vibrio_phage	41.8	1.1e-06
WP_156779791.1|2100258_2100423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269693.1|2100658_2100841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012748944.1|2100949_2101348_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	1.0e-51
WP_012748945.1|2101360_2102470_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	9.0e-85
WP_015864195.1|2103138_2103471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864196.1|2103741_2104140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864197.1|2104161_2105085_-	glutaminase A	NA	NA	NA	NA	NA
WP_015864198.1|2105287_2106460_-	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	2.5e-45
2107177:2107206	attL	AAAGGAGCATTCCCGTTAGGAGCTTTTCCG	NA	NA	NA	NA
WP_012749092.1|2107287_2108568_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015864200.1|2108967_2110053_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015864201.1|2110174_2111383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749253.1|2111939_2113376_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	9.8e-07
WP_015864202.1|2113543_2114209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864203.1|2114556_2114925_-	glyoxalase	NA	NA	NA	NA	NA
WP_015864204.1|2114921_2115713_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_083767453.1|2115732_2116038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864206.1|2116094_2116973_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_015864207.1|2117248_2117761_-	DoxX family protein	NA	NA	NA	NA	NA
WP_015864208.1|2118019_2118361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015864209.1|2118412_2119291_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	33.0	2.9e-25
WP_156779799.1|2120551_2121856_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_015864206.1|2122035_2122914_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_015864212.1|2124396_2125638_+	aminopeptidase	NA	NA	NA	NA	NA
WP_015864213.1|2126253_2129400_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_015864214.1|2129414_2132414_-	site-specific DNA-methyltransferase	NA	B3RH19	Escherichia_phage	25.7	2.5e-20
WP_015864215.1|2132451_2135346_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	50.5	1.1e-275
WP_015864216.1|2135566_2136445_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041269694.1|2136544_2136856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864218.1|2149786_2150077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082805398.1|2150128_2150356_-|transposase	transposase	transposase	A0A0H3UZC2	Geobacillus_virus	70.6	7.6e-15
WP_015864219.1|2150914_2151358_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_015864220.1|2151375_2152401_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015864222.1|2152654_2153590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863799.1|2154533_2155814_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015864223.1|2156880_2157867_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	38.1	1.9e-49
WP_015864224.1|2157863_2159048_-	galactokinase	NA	NA	NA	NA	NA
WP_015864225.1|2159189_2159972_+	EcsC family protein	NA	NA	NA	NA	NA
WP_015864226.1|2161126_2162791_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_015864227.1|2163188_2164469_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015864228.1|2164826_2165963_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.7	4.2e-37
WP_012748845.1|2166480_2167794_-|transposase	transposase	transposase	NA	NA	NA	NA
2166105:2166134	attR	CGGAAAAGCTCCTAACGGGAATGCTCCTTT	NA	NA	NA	NA
WP_015864229.1|2167962_2168541_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_015864231.1|2168734_2169463_-	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	35.2	1.6e-13
WP_015863580.1|2169499_2170582_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_015864232.1|2170946_2171414_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_015864234.1|2171729_2171918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864235.1|2171917_2172172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864236.1|2172207_2172546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864237.1|2172716_2172917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864239.1|2173213_2173582_-	YppE family protein	NA	NA	NA	NA	NA
WP_015864240.1|2173645_2173894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864241.1|2174160_2174766_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	36.4	2.3e-26
WP_015864242.1|2174802_2177541_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_015864243.1|2177567_2178071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864244.1|2178054_2178726_-	endonuclease III	NA	NA	NA	NA	NA
WP_015864245.1|2178785_2179493_-	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	50.0	3.3e-24
WP_015864246.1|2179558_2180851_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.8	4.2e-57
WP_015864247.1|2180998_2182189_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_015864248.1|2182210_2182693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864249.1|2182699_2182870_-	YpmA family protein	NA	NA	NA	NA	NA
WP_015864250.1|2183155_2185921_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	29.9	2.7e-69
WP_015864251.1|2185991_2186375_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_015864252.1|2186417_2187266_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_015864253.1|2187262_2188102_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	40.1	2.2e-51
WP_015864254.1|2188365_2189355_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_015864255.1|2189312_2190527_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	49.3	9.4e-43
>prophage 16
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	2208305	2219344	3464618		Pandoravirus(25.0%)	13	NA	NA
WP_015864277.1|2208305_2209325_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	41.4	1.5e-65
WP_015864278.1|2209317_2210844_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	35.9	2.1e-31
WP_015864279.1|2211039_2211420_-	chorismate mutase	NA	NA	NA	NA	NA
WP_015864280.1|2211385_2212513_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	26.2	7.6e-23
WP_015864281.1|2212515_2213682_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.7	4.8e-44
WP_015864282.1|2213800_2214574_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_041269929.1|2214702_2215149_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	4.1e-28
WP_015864284.1|2215250_2216213_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.4	2.0e-08
WP_015864285.1|2216230_2216935_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_041269930.1|2216939_2217755_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_015864287.1|2217845_2218070_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_015864288.1|2218103_2218670_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.4	8.2e-50
WP_015864289.1|2219071_2219344_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	77.8	1.0e-29
>prophage 17
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	2238854	2249407	3464618	transposase,protease,coat	Enterococcus_phage(50.0%)	12	NA	NA
WP_015864311.1|2238854_2239529_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_012748945.1|2240017_2241127_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	9.0e-85
WP_012748944.1|2241139_2241538_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	1.0e-51
WP_012748853.1|2241884_2243072_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015864312.1|2243170_2244154_-	asparaginase	NA	NA	NA	NA	NA
WP_015864313.1|2244317_2245298_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_015864314.1|2245382_2246669_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_015864315.1|2246924_2247515_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_041269701.1|2247621_2248407_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_049757038.1|2248415_2248760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864318.1|2248919_2249150_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_015864319.1|2249146_2249407_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
>prophage 18
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	2283615	2295244	3464618	transposase	Staphylococcus_phage(44.44%)	14	NA	NA
WP_015864357.1|2283615_2284662_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.6	1.6e-38
WP_012748925.1|2284813_2285896_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	9.1e-82
WP_041269703.1|2286020_2286299_+	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_041269933.1|2286341_2286821_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_015864359.1|2286857_2287277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864360.1|2287340_2287931_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.6	8.1e-16
WP_041269704.1|2287917_2288688_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.0	9.6e-09
WP_015864362.1|2288814_2289330_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_015864363.1|2289345_2289693_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015864364.1|2289816_2290281_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	64.2	1.7e-45
WP_015864365.1|2290354_2291548_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.6	2.3e-118
WP_015864366.1|2291569_2292217_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.8	1.7e-43
WP_015864367.1|2292232_2293318_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.2	9.2e-58
WP_015864368.1|2294161_2295244_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	47.9	2.0e-81
>prophage 19
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	2548401	2605244	3464618	transposase,tRNA,protease,coat	uncultured_Mediterranean_phage(14.29%)	56	NA	NA
WP_015864626.1|2548401_2549544_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	9.3e-85
WP_015864627.1|2549561_2550590_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015864628.1|2550613_2550820_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_015864629.1|2550816_2551818_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	28.7	8.1e-08
WP_015864630.1|2551831_2552437_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_015864631.1|2552560_2553046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864632.1|2553221_2553962_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015864633.1|2554152_2554881_-	sporulation protein	NA	NA	NA	NA	NA
WP_015864634.1|2554995_2555736_-	NAD(+) synthase	NA	E3SLH5	Synechococcus_phage	36.6	7.7e-32
WP_015864635.1|2555777_2556722_-	phosphotransferase	NA	NA	NA	NA	NA
WP_015864636.1|2556715_2558014_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_015864637.1|2558183_2559287_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_015864638.1|2559286_2560138_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_015864639.1|2560166_2561717_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_015864640.1|2561822_2562962_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_015864641.1|2562963_2563503_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_015864642.1|2563551_2564013_+	NUDIX hydrolase	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	41.9	5.0e-05
WP_015864643.1|2564076_2564925_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_015864644.1|2564946_2565390_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_015864645.1|2565419_2566706_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_012748972.1|2566947_2568195_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	4.2e-62
WP_015864646.1|2568402_2568942_-	sporulation protein	NA	NA	NA	NA	NA
WP_015864647.1|2569134_2569425_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_015864648.1|2569440_2569773_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_015864649.1|2569784_2570093_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_015864650.1|2570364_2571228_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_015864651.1|2571220_2571982_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_015864652.1|2572084_2572888_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_015864653.1|2572890_2573607_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_015864654.1|2573620_2574139_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_015864655.1|2574135_2575002_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_015864656.1|2575023_2576043_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_015864657.1|2576204_2576885_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_015864658.1|2576932_2577493_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_041269717.1|2577609_2578551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864660.1|2578658_2579117_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_015864661.1|2579136_2579859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864662.1|2579855_2580452_-	fimbrial protein	NA	NA	NA	NA	NA
WP_015864663.1|2580441_2581395_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_015864664.1|2581409_2582156_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_015864665.1|2582166_2582646_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_015864666.1|2582909_2584583_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_015864667.1|2584915_2586127_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_015864668.1|2586113_2587172_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_015864669.1|2587184_2588852_-	type II secretion system protein E	NA	NA	NA	NA	NA
WP_015864670.1|2588855_2590223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864671.1|2590244_2591069_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
WP_041269718.1|2591089_2592562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864673.1|2592639_2593248_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_015864674.1|2593231_2593807_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_012748951.1|2594128_2595196_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	23.7	1.4e-10
WP_015864677.1|2596698_2599527_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_041269950.1|2599610_2600903_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_015864679.1|2600998_2603641_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	1.1e-165
WP_015864680.1|2604079_2604268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269951.1|2604233_2605244_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
>prophage 20
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	2799000	2899178	3464618	tRNA,holin,transposase,integrase,portal	Staphylococcus_phage(33.33%)	95	2857312:2857371	2873249:2873312
WP_015864859.1|2799000_2801418_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	74.5	0.0e+00
WP_015864860.1|2801941_2803135_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	47.7	2.5e-101
WP_015864861.1|2803237_2803405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864862.1|2803420_2803684_-	YtzC family protein	NA	NA	NA	NA	NA
WP_015863990.1|2803919_2804798_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_015864863.1|2804846_2805809_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	77.9	1.5e-59
WP_015864864.1|2805805_2806381_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	53.9	2.2e-50
WP_015864865.1|2806410_2807490_-	tetraprenyl-beta-curcumene synthase family protein	NA	NA	NA	NA	NA
WP_015864866.1|2807519_2808311_-	alpha/beta hydrolase	NA	A0A220T682	Eptesipox_virus	24.3	3.6e-11
WP_015864867.1|2808398_2808917_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_015864868.1|2810330_2811173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864869.1|2811169_2813068_-	asparagine synthase (glutamine-hydrolyzing)	NA	E5EQ62	Micromonas_sp._RCC1109_virus	31.1	1.2e-33
WP_015864870.1|2813268_2814480_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	77.2	2.1e-167
WP_012748845.1|2814952_2816266_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041269730.1|2816590_2818177_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	63.6	2.9e-193
WP_015864872.1|2818207_2818450_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_041269963.1|2818479_2819268_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	38.1	3.3e-33
WP_015864874.1|2819372_2820371_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015864875.1|2820388_2821162_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	9.2e-36
WP_015864876.1|2821145_2821955_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015864877.1|2821969_2822431_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	36.7	1.4e-18
WP_015864878.1|2822517_2822853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864880.1|2823435_2823876_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	74.0	3.2e-57
WP_073967992.1|2824085_2824223_+	YtzI protein	NA	NA	NA	NA	NA
WP_015864881.1|2824256_2824730_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_041269731.1|2824849_2825086_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	62.3	7.9e-23
WP_015864883.1|2825400_2826345_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015864884.1|2826475_2827024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864885.1|2827039_2827330_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_015864886.1|2827503_2827665_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_015864887.1|2827751_2827952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864888.1|2827966_2829445_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.3	5.4e-69
WP_015864889.1|2829661_2830480_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_015864890.1|2830479_2831292_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	A0A0B5A484	Mycobacterium_phage	25.9	5.0e-08
WP_015864891.1|2831288_2833043_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_015864892.1|2833035_2834418_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_012749074.1|2834675_2835842_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
WP_015864893.1|2836034_2836973_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_015864894.1|2837058_2837820_+	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_012749414.1|2839036_2840284_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	1.2e-61
WP_015864895.1|2840655_2841609_+	cation transporter	NA	NA	NA	NA	NA
WP_015864896.1|2841727_2842213_-	processed acidic surface protein	NA	NA	NA	NA	NA
WP_015864898.1|2842646_2843057_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_015864899.1|2843053_2843512_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015864901.1|2844153_2844798_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015374306.1|2844860_2845805_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_015864902.1|2846029_2847142_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015374305.1|2847257_2847668_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_015864164.1|2849141_2849687_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_015864903.1|2849839_2851093_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_015864165.1|2851085_2851886_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012749074.1|2852520_2853687_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
WP_015864904.1|2855154_2856342_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
2857312:2857371	attL	TTTTCGATGCCGATGGTGGGAGTCGAACCCACACGGGCAAAGCCCACACGATTTTGAGTC	NA	NA	NA	NA
WP_015864906.1|2857528_2858107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864907.1|2858216_2858558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864908.1|2859238_2860603_-|portal	phage portal protein	portal	A0A097BY86	Enterococcus_phage	20.5	2.4e-07
WP_015864909.1|2860726_2862331_-	hypothetical protein	NA	A0A088CBQ3	Shigella_phage	26.9	1.0e-28
WP_015864910.1|2862576_2862984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864911.1|2863318_2864284_-	hypothetical protein	NA	A0A0H3V0V6	Geobacillus_virus	65.3	3.0e-116
WP_015864913.1|2864571_2865375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864914.1|2865593_2865773_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015864915.1|2865870_2866722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156779800.1|2866777_2867233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864917.1|2867238_2867517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864918.1|2867516_2867963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864919.1|2867976_2868384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864920.1|2868376_2868598_-|holin	holin	holin	NA	NA	NA	NA
WP_156779793.1|2869540_2870194_-	hypothetical protein	NA	A0A1C8EA76	Bacillus_phage	26.5	7.6e-07
WP_012749074.1|2870272_2871439_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
WP_041269736.1|2871559_2871790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864921.1|2871951_2872137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864922.1|2872138_2873128_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	42.6	1.5e-70
WP_083767457.1|2881139_2881814_+	protein-glutamine gamma-glutamyltransferase	NA	NA	NA	NA	NA
2873249:2873312	attR	TTTTCGATGCCGATGGTGGGAGTCGAACCCACACGGGCAAAGCCCACACGATTTTGAGTCGTGC	NA	NA	NA	NA
WP_012748945.1|2881897_2883007_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	9.0e-85
WP_012748944.1|2883019_2883418_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	1.0e-51
WP_015864923.1|2883713_2884616_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015864924.1|2884682_2885360_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.0	1.3e-14
WP_015864925.1|2885765_2886701_+	nuclease	NA	A0A1P8CWK6	Bacillus_phage	37.7	2.4e-14
WP_015864926.1|2886792_2887053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864927.1|2887111_2887600_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015864928.1|2887768_2887954_-	H-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_015864929.1|2888080_2889076_+	potassium channel protein	NA	NA	NA	NA	NA
WP_015864930.1|2889072_2889477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864931.1|2889784_2890099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864932.1|2890357_2891707_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_015864933.1|2891867_2893031_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015864934.1|2893180_2893414_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_015864935.1|2893451_2893817_-	general stress protein 13	NA	NA	NA	NA	NA
WP_015864936.1|2893933_2895106_-	aminotransferase	NA	NA	NA	NA	NA
WP_015864937.1|2895102_2895603_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015864938.1|2895708_2895867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015864939.1|2895906_2897067_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_015864940.1|2897146_2897665_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_015864941.1|2897727_2897940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864942.1|2898095_2899178_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	48.2	5.3e-82
>prophage 21
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	2915416	2970866	3464618	transposase,coat	Paenibacillus_phage(15.38%)	58	NA	NA
WP_012749074.1|2915416_2916583_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.7	3.1e-35
WP_015864960.1|2916858_2917221_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	3.3e-20
WP_015864961.1|2917275_2918130_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_015864962.1|2918373_2918613_-	YuzB family protein	NA	NA	NA	NA	NA
WP_012748845.1|2918831_2920145_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864963.1|2920437_2921508_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015864964.1|2921548_2921872_-	YuzD family protein	NA	NA	NA	NA	NA
WP_015864965.1|2921967_2922204_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	43.8	3.8e-09
WP_015864966.1|2922254_2923169_-	homoserine kinase	NA	NA	NA	NA	NA
WP_015864967.1|2923165_2924227_-	threonine synthase	NA	NA	NA	NA	NA
WP_015864968.1|2924226_2925525_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_015864969.1|2925714_2926698_-	D-glycerate dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	27.5	5.1e-23
WP_015864970.1|2926788_2927799_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_015864971.1|2927959_2928457_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.0	2.7e-41
WP_041269973.1|2928509_2929280_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_015864973.1|2929510_2929948_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_015864974.1|2930066_2930336_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_015864975.1|2930983_2931259_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
WP_015864976.1|2931371_2932058_+	sporulation protein	NA	NA	NA	NA	NA
WP_015864977.1|2932122_2933019_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_156779801.1|2933209_2934175_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_015864979.1|2934219_2934327_-	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_015864980.1|2934327_2935848_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_015864981.1|2936144_2936894_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_015864982.1|2936967_2937270_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_015864983.1|2937326_2938718_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_015864984.1|2938731_2939550_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015864985.1|2939567_2940416_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_156779794.1|2940803_2941052_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_015864988.1|2942308_2943475_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.2	2.5e-24
WP_015864989.1|2944828_2946226_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_015864990.1|2946257_2946695_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LS29	Mycobacterium_phage	37.1	1.3e-15
WP_015864991.1|2946684_2947905_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	49.3	3.5e-122
WP_015864992.1|2947901_2949215_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_015864993.1|2949237_2950017_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.7	2.3e-10
WP_015864994.1|2950221_2951061_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015864995.1|2951077_2951746_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015864996.1|2951735_2952764_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.6e-30
WP_012748972.1|2953760_2955008_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	4.2e-62
WP_081189151.1|2955384_2955726_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_015864998.1|2955954_2956266_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_015864999.1|2956274_2956625_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_108430411.1|2956651_2956849_-	DUF2553 family protein	NA	NA	NA	NA	NA
WP_015865000.1|2957010_2957394_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_015865001.1|2957467_2957830_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.4	3.5e-22
WP_015865002.1|2957886_2959671_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015865003.1|2959725_2960898_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_015865004.1|2960926_2963311_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015865005.1|2963496_2963646_+	YuzL family protein	NA	NA	NA	NA	NA
WP_015865006.1|2963829_2964747_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	44.8	8.3e-68
WP_015865007.1|2964908_2965172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865008.1|2965190_2965523_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_108430412.1|2965601_2965691_-	DUF2573 family protein	NA	NA	NA	NA	NA
WP_015865010.1|2966054_2966273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865011.1|2966406_2967774_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_015865012.1|2967763_2968483_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_015865013.1|2968482_2969046_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_015863990.1|2969987_2970866_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	3019496	3082673	3464618	transposase	Streptococcus_phage(27.27%)	58	NA	NA
WP_012748945.1|3019496_3020606_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	9.0e-85
WP_012748944.1|3020618_3021017_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	1.0e-51
WP_015865059.1|3021163_3022510_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D6QWN5	uncultured_phage	45.6	6.3e-16
WP_015865060.1|3022551_3023445_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015865061.1|3023434_3024121_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-28
WP_015865062.1|3024308_3024641_-	cytochrome c	NA	NA	NA	NA	NA
WP_015865063.1|3024702_3025563_-	YitT family protein	NA	NA	NA	NA	NA
WP_097354901.1|3025700_3026802_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	42.4	8.3e-06
WP_015865065.1|3026906_3029420_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_041269742.1|3029543_3029954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865067.1|3030017_3030566_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_015865068.1|3030987_3031374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865069.1|3031386_3031740_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_015865070.1|3031739_3032141_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_015865071.1|3032168_3033755_-	flagellar hook-associated protein 2	NA	NA	NA	NA	NA
WP_041269743.1|3033770_3034130_-	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_015865073.1|3034416_3034803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865074.1|3034799_3035060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865075.1|3035441_3035981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865076.1|3035977_3036511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865077.1|3037183_3038791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865078.1|3039756_3040776_-	flagellin	NA	NA	NA	NA	NA
WP_015865079.1|3040932_3041118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865080.1|3041114_3041363_-	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	60.8	2.6e-08
WP_015865081.1|3041377_3041812_-	flagellar assembly protein FliW	NA	NA	NA	NA	NA
WP_015865082.1|3041834_3042389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083767474.1|3042614_3043472_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_083767458.1|3043621_3044185_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015865083.1|3044473_3045379_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_015865084.1|3045389_3047015_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_015865085.1|3047026_3047503_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_015865086.1|3047520_3047784_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_015865087.1|3047855_3048263_-	membrane protein	NA	NA	NA	NA	NA
WP_015865088.1|3048286_3048724_-	YaaR family protein	NA	NA	NA	NA	NA
WP_015865089.1|3048806_3051206_-	flagellar protein	NA	NA	NA	NA	NA
WP_015865090.1|3051225_3051654_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_015865091.1|3051709_3052006_-	flagellar biosynthesis FlhS	NA	NA	NA	NA	NA
WP_156779795.1|3052002_3057684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865093.1|3057753_3058461_-	ComF family protein	NA	NA	NA	NA	NA
WP_015865094.1|3058457_3059957_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	39.9	1.0e-70
WP_015865095.1|3060027_3060873_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.6	6.8e-16
WP_015865096.1|3060981_3061659_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	30.2	5.6e-05
WP_015865097.1|3061690_3062836_-	histidine kinase	NA	NA	NA	NA	NA
WP_015865098.1|3063058_3063694_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.7	8.1e-38
WP_015865099.1|3063733_3064702_+	LCP family protein	NA	NA	NA	NA	NA
WP_015865100.1|3064744_3065809_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_015865101.1|3066457_3067336_-	accessory Sec system S-layer assembly protein	NA	NA	NA	NA	NA
WP_015865102.1|3067348_3069712_-	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_015865103.1|3070874_3071558_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015865104.1|3071579_3071948_+	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_015865105.1|3071934_3072303_+	EamA family transporter	NA	NA	NA	NA	NA
WP_015865106.1|3072334_3073594_+	membrane protein	NA	NA	NA	NA	NA
WP_012748995.1|3074129_3075788_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015865107.1|3076783_3077989_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_015865108.1|3078306_3078966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865109.1|3078983_3080165_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015865110.1|3080554_3081229_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_015863641.1|3081425_3082673_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	37.1	2.4e-62
>prophage 23
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	3089850	3159238	3464618	transposase,integrase,protease	Bacillus_phage(28.57%)	51	3103100:3103138	3130152:3130190
WP_097353884.1|3089850_3089991_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_015865119.1|3091379_3092753_+|transposase	IS1380-like element ISGsp2 family transposase	transposase	NA	NA	NA	NA
WP_041269746.1|3092891_3093323_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_083767459.1|3093316_3093937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865122.1|3093961_3095692_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_015865123.1|3097186_3098458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865124.1|3098687_3099260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015865125.1|3099265_3100795_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_015865126.1|3101080_3102394_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015865127.1|3102538_3103030_+	hypothetical protein	NA	NA	NA	NA	NA
3103100:3103138	attL	AAAAAGAAAAGCCCCGCAGAGATTTCTCTCCGCAGAGCT	NA	NA	NA	NA
WP_015865128.1|3103169_3104789_-	peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_015865129.1|3105086_3106178_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
WP_015865130.1|3106852_3107230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865131.1|3107938_3109375_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_015865132.1|3109996_3110701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865133.1|3111052_3111430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865134.1|3111681_3112725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865136.1|3113528_3114497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013399921.1|3116007_3117207_+	DUF2726 domain-containing protein	NA	A0A286QRE8	Streptococcus_phage	34.8	4.0e-54
WP_013399920.1|3117458_3117830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865138.1|3117831_3118221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015863673.1|3118689_3119880_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	1.8e-30
WP_015865140.1|3120283_3120712_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015865141.1|3120865_3121159_-	helix-turn-helix transcriptional regulator	NA	A0A0A0RNR0	Bacillus_phage	45.8	1.9e-05
WP_015865142.1|3121179_3121620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865143.1|3121693_3122599_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJP1	Virus_Rctr41k	28.5	2.6e-13
WP_015865144.1|3122791_3124450_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_049757025.1|3124545_3124737_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015865145.1|3125186_3125765_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015865146.1|3125770_3127300_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_049757042.1|3127616_3128528_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	31.1	6.8e-14
WP_015865149.1|3128936_3129188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865150.1|3129209_3129512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865151.1|3129526_3130036_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_015865152.1|3130226_3133025_-	S-layer protein	NA	NA	NA	NA	NA
3130152:3130190	attR	AAAAAGAAAAGCCCCGCAGAGATTTCTCTCCGCAGAGCT	NA	NA	NA	NA
WP_015865153.1|3133417_3134821_-	polymerase	NA	NA	NA	NA	NA
WP_015865154.1|3134850_3135960_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015865155.1|3136033_3136759_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_015865156.1|3136783_3138058_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	24.6	2.8e-29
WP_143420558.1|3138279_3139398_+	polysaccharide pyruvyl transferase CsaB	NA	NA	NA	NA	NA
WP_015865158.1|3139421_3140594_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015865159.1|3140660_3142184_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_015865160.1|3142216_3144100_-	S-layer protein	NA	G3MAW8	Bacillus_virus	40.1	5.4e-21
WP_156779802.1|3144349_3145345_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	40.0	1.0e-18
WP_015865162.1|3145550_3149168_+	S8 family peptidase	NA	U5J9E4	Bacillus_phage	38.6	3.0e-28
WP_041269983.1|3149208_3151128_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	37.5	2.0e-47
WP_015865164.1|3151203_3152619_-	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	42.4	1.5e-28
WP_015865165.1|3153041_3154232_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.7	7.5e-29
WP_015374612.1|3154440_3154869_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_015865166.1|3155300_3156521_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	33.2	1.1e-54
WP_015865169.1|3158101_3159238_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.9	2.6e-34
>prophage 24
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	3164664	3229365	3464618	transposase	Virus_Rctr71(12.5%)	55	NA	NA
WP_015865175.1|3164664_3165747_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	47.9	5.9e-81
WP_015865176.1|3165957_3166302_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	64.8	1.1e-33
WP_015865177.1|3166636_3167083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865178.1|3167093_3167696_-	class D sortase	NA	NA	NA	NA	NA
WP_015865179.1|3167701_3168667_-	processed acidic surface protein	NA	NA	NA	NA	NA
WP_015865180.1|3168799_3170176_-	aspartate kinase	NA	NA	NA	NA	NA
WP_015865181.1|3170306_3170741_-	DUF1284 domain-containing protein	NA	NA	NA	NA	NA
WP_015865182.1|3171029_3172208_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	40.7	1.5e-74
WP_041269750.1|3172363_3172933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865184.1|3173088_3174609_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015865185.1|3174680_3175019_+	DUF779 domain-containing protein	NA	NA	NA	NA	NA
WP_015865186.1|3175149_3176775_-	MFS transporter	NA	NA	NA	NA	NA
WP_015865187.1|3176762_3177695_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015865189.1|3178102_3178657_+	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_015865190.1|3178647_3178896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865191.1|3178971_3179847_-	ROK family protein	NA	NA	NA	NA	NA
WP_041269751.1|3180087_3180909_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015865193.1|3180908_3181880_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015865194.1|3181943_3183248_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015865195.1|3183392_3184940_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015865196.1|3186386_3187400_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015865197.1|3187547_3188912_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_015865198.1|3188933_3189911_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_015865199.1|3189912_3190995_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_015865200.1|3191013_3192210_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_015865201.1|3192553_3192940_+	VOC family protein	NA	NA	NA	NA	NA
WP_015865202.1|3192975_3193959_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015865204.1|3194599_3195043_-	VanZ family protein	NA	NA	NA	NA	NA
WP_015865205.1|3195113_3196001_-	ribokinase	NA	NA	NA	NA	NA
WP_012748845.1|3196445_3197759_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015865206.1|3198093_3198441_+	DUF3870 domain-containing protein	NA	NA	NA	NA	NA
WP_015865207.1|3198516_3199680_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_015865208.1|3199698_3200769_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_015865209.1|3200797_3201805_+	C40 family peptidase	NA	X5JAJ3	Clostridium_phage	32.2	1.2e-16
WP_015865210.1|3201931_3203404_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_015865211.1|3203400_3203601_-	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_015865212.1|3203642_3204827_-	amidohydrolase	NA	NA	NA	NA	NA
WP_015865213.1|3204851_3206081_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_015865214.1|3206348_3207617_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_015865215.1|3207738_3208722_-	DUF1861 family protein	NA	NA	NA	NA	NA
WP_015865216.1|3209066_3212138_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	29.6	4.0e-106
WP_015865217.1|3212305_3213655_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	45.0	4.5e-94
WP_015865218.1|3213995_3214658_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015865219.1|3214641_3215232_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_041269986.1|3215566_3215854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865221.1|3217294_3217666_-	glyoxalase	NA	NA	NA	NA	NA
WP_012748948.1|3218126_3219575_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_041269752.1|3219633_3219921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156779796.1|3220572_3222012_-	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	32.6	4.0e-16
WP_015865223.1|3222268_3223579_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_015865224.1|3223860_3224739_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_015864164.1|3225040_3225586_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_015864903.1|3225738_3226992_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_015864165.1|3226984_3227785_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012748845.1|3228051_3229365_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	3238802	3295187	3464618	transposase	Tupanvirus(25.0%)	47	NA	NA
WP_011888356.1|3238802_3239657_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_015865236.1|3240765_3240975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865237.1|3241095_3241806_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	35.4	6.1e-26
WP_015865238.1|3241892_3243227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865239.1|3243726_3245922_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011231306.1|3246152_3247331_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	38.9	1.3e-70
WP_015865241.1|3247873_3249160_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_015865242.1|3249368_3250976_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_015865243.1|3250972_3253750_+	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	26.2	1.5e-32
WP_041269757.1|3254186_3254414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865245.1|3254443_3255415_-	DUF1861 family protein	NA	NA	NA	NA	NA
WP_011232748.1|3256135_3256609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232749.1|3256652_3256853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865247.1|3257086_3257584_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_015865248.1|3257754_3258777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015865249.1|3259601_3261368_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_015865250.1|3262755_3264003_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	4.2e-62
WP_015865251.1|3265527_3266085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083767461.1|3266068_3267427_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015865253.1|3268198_3269059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108430480.1|3269700_3270099_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_108430481.1|3270117_3270420_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041269758.1|3270645_3270894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865256.1|3271642_3271942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269759.1|3272116_3272353_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015865257.1|3272574_3272994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865258.1|3273015_3273237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865259.1|3273252_3273768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865260.1|3274083_3274341_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_015865261.1|3274309_3274705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041269989.1|3274707_3274983_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_015865263.1|3275199_3275745_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015865264.1|3275750_3277277_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_015865265.1|3277691_3279311_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_015865267.1|3280160_3281315_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	27.6	4.9e-17
WP_015865268.1|3281307_3282021_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015865269.1|3282017_3283001_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_041269990.1|3282987_3283602_-	sugar transferase	NA	NA	NA	NA	NA
WP_083767463.1|3283709_3284141_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L5H6	Tupanvirus	47.6	1.4e-28
WP_015865271.1|3284184_3285324_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015865272.1|3285339_3286620_-	nucleotide sugar dehydrogenase	NA	A0A218MKK1	uncultured_virus	23.5	2.5e-09
WP_015865273.1|3286616_3287630_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	30.2	1.6e-35
WP_083767464.1|3287626_3288829_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015865275.1|3289858_3291298_-	O-antigen polysaccharide polymerase Wzy family protein	NA	NA	NA	NA	NA
WP_015865276.1|3291317_3292451_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_015865277.1|3292454_3293690_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_012749546.1|3294308_3295187_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NC_012793	Geobacillus sp. WCH70, complete genome	3464618	3345989	3453368	3464618	transposase,tRNA,protease,coat	Bacillus_phage(17.39%)	95	NA	NA
WP_012748845.1|3345989_3347303_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015865329.1|3347540_3348593_-	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_015863990.1|3348659_3349538_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_015865330.1|3349924_3350542_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	3.0e-37
WP_015865331.1|3350675_3351923_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	2.4e-62
WP_015865332.1|3352514_3352715_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_015865333.1|3352875_3354150_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_015865334.1|3354413_3355376_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_015865335.1|3355403_3356690_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_015865336.1|3356726_3357368_-	fructose-6-phosphate aldolase	NA	A0A1D7SNI1	Cyanophage	50.2	3.9e-48
WP_015865337.1|3357475_3358339_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_015865338.1|3358507_3358870_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	1.1e-12
WP_015864206.1|3359092_3359971_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_015865339.1|3360027_3360558_+	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_015865340.1|3360614_3362210_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.0	7.7e-154
WP_015865341.1|3362379_3362940_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_015865342.1|3363168_3366426_-	methylmalonyl-CoA mutase family protein	NA	NA	NA	NA	NA
WP_015865343.1|3366442_3367075_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015865344.1|3367102_3368242_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015865345.1|3368262_3369402_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015865346.1|3369423_3370275_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015865347.1|3370898_3372077_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_015865348.1|3372256_3374356_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015865349.1|3374557_3375745_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_015865350.1|3375792_3375960_-	DUF1427 family protein	NA	R4TMJ4	Halovirus	61.7	5.1e-08
WP_015865351.1|3376121_3377792_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015865352.1|3377796_3378228_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_015865353.1|3378492_3379377_-	agmatinase	NA	NA	NA	NA	NA
WP_015865354.1|3379392_3380220_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_015865355.1|3380416_3382468_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_015865356.1|3382642_3383155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865357.1|3383170_3383848_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_015865358.1|3383978_3384164_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_015865359.1|3384277_3385579_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	1.7e-45
WP_015865360.1|3385603_3386122_-	YwgA family protein	NA	NA	NA	NA	NA
WP_015865361.1|3386135_3387437_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	3.6e-24
WP_015865362.1|3387583_3387811_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_012749221.1|3388056_3389424_-|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_012748994.1|3389832_3391206_-|transposase	IS1380-like element ISGsp2 family transposase	transposase	NA	NA	NA	NA
WP_015865363.1|3391481_3392141_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	48.5	8.5e-06
WP_015865364.1|3392173_3393010_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_015865365.1|3393093_3394068_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_015865366.1|3394270_3395017_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_015865367.1|3395199_3395631_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_015865368.1|3395655_3396219_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_015865369.1|3396328_3396700_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015865370.1|3396790_3397072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049757046.1|3397140_3397365_-	YwdI family protein	NA	NA	NA	NA	NA
WP_015865372.1|3397524_3398199_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	49.8	6.5e-54
WP_015865373.1|3398431_3399814_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	30.2	5.1e-53
WP_015865374.1|3400120_3400942_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015865375.1|3401031_3402228_-	MFS transporter	NA	NA	NA	NA	NA
WP_015865376.1|3402297_3402639_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_015865377.1|3402626_3403052_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015865378.1|3403152_3404772_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015865379.1|3404966_3405470_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_015865380.1|3405887_3407126_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015865381.1|3407245_3408379_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_015865382.1|3408511_3409324_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_011231214.1|3409402_3410281_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_012748972.1|3410562_3411810_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	4.2e-62
WP_015865383.1|3412663_3414118_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_015865385.1|3414907_3415621_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_015865386.1|3415979_3417374_+	amino acid permease	NA	NA	NA	NA	NA
WP_015865387.1|3417630_3419880_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	46.8	6.3e-194
WP_015865388.1|3419935_3420685_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	30.9	6.6e-31
WP_015865389.1|3420932_3422315_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015865390.1|3422531_3424055_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015865391.1|3424198_3425602_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_015865392.1|3425698_3427684_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_015865393.1|3427674_3428127_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_015865394.1|3428193_3429150_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_015865395.1|3429297_3430440_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.2	3.7e-49
WP_041269770.1|3430470_3431727_-	GntP family permease	NA	NA	NA	NA	NA
WP_015865397.1|3432080_3433199_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_015865398.1|3433849_3434329_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_015865399.1|3434413_3434569_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_015865400.1|3434645_3435860_-|protease	serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	30.2	2.5e-11
WP_015865401.1|3436021_3436816_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.2	8.5e-45
WP_015865402.1|3436821_3437604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865403.1|3437590_3438940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015865404.1|3438932_3440759_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.1	2.2e-35
WP_041269997.1|3440768_3441476_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.0	2.6e-45
WP_015865406.1|3441652_3442939_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.4	2.3e-71
WP_015865407.1|3443226_3444591_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	51.9	1.8e-122
WP_015865408.1|3444713_3445163_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_015865409.1|3445159_3447136_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_015865410.1|3447183_3448110_-	YybS family protein	NA	NA	NA	NA	NA
WP_013401907.1|3448204_3448441_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_015865411.1|3448498_3448993_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	63.1	7.6e-52
WP_015865412.1|3449022_3449310_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_015865413.1|3449414_3450515_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_015865414.1|3451477_3451675_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_015865415.1|3451696_3452596_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_041269771.1|3452744_3453368_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	40.1	2.7e-22
