The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012917	Pectobacterium carotovorum subsp. carotovorum PC1, complete genome	4862913	1529390	1538284	4862913		Synechococcus_phage(42.86%)	8	NA	NA
WP_015839587.1|1529390_1530500_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.3e-128
WP_015839588.1|1530502_1531465_+	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	50.8	6.6e-84
WP_015839589.1|1531466_1531925_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_015839590.1|1531934_1533338_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.5	1.1e-55
WP_015839591.1|1533339_1534086_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.6	7.8e-08
WP_015839592.1|1534092_1535466_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.9	8.1e-35
WP_015839594.1|1535750_1536647_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	41.0	4.2e-48
WP_010281382.1|1536877_1538284_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.5	4.3e-31
>prophage 2
NC_012917	Pectobacterium carotovorum subsp. carotovorum PC1, complete genome	4862913	1787872	1879434	4862913	tRNA,plate,integrase,protease,tail	Burkholderia_virus(21.43%)	93	1804945:1804960	1888320:1888335
WP_015839801.1|1787872_1788805_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_015839802.1|1788977_1790390_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_015839803.1|1790382_1791330_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_015839804.1|1791346_1791895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839805.1|1792293_1792836_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_015839806.1|1792896_1793253_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_015839807.1|1793301_1793811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839808.1|1793961_1794909_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_015839809.1|1794979_1795666_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_015839810.1|1795800_1796571_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_015839811.1|1796602_1798255_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015839812.1|1798251_1799262_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	5.8e-30
WP_015839813.1|1799339_1800359_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015839814.1|1800772_1802119_+	aspartate aminotransferase family protein	NA	M9MUV3	Rhodococcus_phage	29.8	1.3e-08
WP_015839815.1|1802471_1804778_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_015839816.1|1804882_1805422_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
1804945:1804960	attL	GCAGGAAGCGCATGTA	NA	NA	NA	NA
WP_015839817.1|1805695_1806373_-	LysE family translocator	NA	NA	NA	NA	NA
WP_015839818.1|1806425_1807271_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015839819.1|1807485_1809585_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.4	3.3e-43
WP_015839820.1|1810107_1811538_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_015839821.1|1811642_1811954_+|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_015839822.1|1811971_1813699_+	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	30.6	1.5e-17
WP_015839823.1|1813726_1815055_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015839824.1|1815057_1816425_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_015839825.1|1816635_1816965_+	membrane protein	NA	A4JWP3	Burkholderia_virus	59.3	1.5e-24
WP_015839826.1|1816966_1817608_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	58.7	4.3e-55
WP_015839827.1|1817597_1818272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839828.1|1818261_1818591_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	45.2	5.1e-20
WP_015839829.1|1818583_1818895_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	47.5	5.7e-21
WP_015839830.1|1819155_1819623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010281040.1|1819619_1819817_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	58.5	2.4e-09
WP_015839831.1|1819806_1821234_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	73.6	1.2e-203
WP_005972713.1|1821233_1821758_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	66.7	9.5e-69
WP_015839832.1|1821814_1822111_+	ferredoxin	NA	C7BUZ5	Synechococcus_phage	63.0	1.8e-19
WP_015839833.1|1822250_1822571_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_108723452.1|1822539_1822659_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_015839834.1|1822881_1825359_+|tail	phage tail tape measure protein	tail	A0A077K8S2	Ralstonia_phage	27.3	5.1e-19
WP_015839835.1|1825358_1826288_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	43.3	3.1e-46
WP_015839836.1|1826277_1826490_+	membrane protein	NA	A4JWL2	Burkholderia_virus	58.6	2.0e-17
WP_015839837.1|1826477_1827638_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	50.3	1.0e-86
WP_015839838.1|1827634_1828216_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	45.6	1.0e-23
WP_015839839.1|1828275_1828623_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.0	1.1e-33
WP_015839840.1|1828613_1829717_+|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	53.3	4.3e-103
WP_015839841.1|1829709_1830291_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	62.8	3.3e-62
WP_015839842.1|1830293_1832342_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	60.4	3.6e-47
WP_015839843.1|1832341_1832962_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	35.6	6.1e-22
WP_080516293.1|1833029_1833146_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015839844.1|1833255_1834224_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_015839845.1|1834310_1836179_+	peptidase M3	NA	NA	NA	NA	NA
WP_015839846.1|1836229_1836952_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.3	9.5e-35
WP_015839847.1|1836948_1837608_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_010294862.1|1837634_1838381_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_015839848.1|1838780_1839284_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.9	1.8e-08
WP_015839849.1|1839632_1840184_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	35.1	1.7e-15
WP_015839850.1|1840171_1841059_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_015839851.1|1841435_1841951_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.5	5.4e-16
WP_015839852.1|1842294_1843464_+	MFS transporter	NA	NA	NA	NA	NA
WP_043881744.1|1843502_1844909_-	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_015839854.1|1845315_1845852_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_010294841.1|1845917_1846247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839855.1|1846481_1846946_+	DNA gyrase inhibitor	NA	NA	NA	NA	NA
WP_015839856.1|1847105_1847984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839858.1|1849111_1849981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839859.1|1850059_1850278_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_015839860.1|1850684_1851875_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155116501.1|1852093_1853176_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015839862.1|1853168_1854854_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_015839863.1|1854898_1855315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839864.1|1855414_1855825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839865.1|1856127_1857123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839866.1|1857415_1857925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839867.1|1858713_1859169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839868.1|1859519_1859843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839869.1|1859872_1860247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839870.1|1860282_1861080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839871.1|1861398_1862733_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_155116502.1|1862701_1863052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839873.1|1863347_1863668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839874.1|1863856_1864945_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_015839875.1|1865352_1865628_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_015839876.1|1865624_1867019_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.2	2.6e-49
WP_015839877.1|1867011_1868124_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_015839878.1|1868120_1868777_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_015839879.1|1868798_1870418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839880.1|1870517_1870697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839882.1|1870940_1871135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839884.1|1871924_1872821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839885.1|1872976_1873969_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_015839887.1|1874405_1874891_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_015839888.1|1875252_1876137_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_015839889.1|1876357_1876912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015839891.1|1877279_1877921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015839892.1|1878204_1879434_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	48.5	3.5e-106
1888320:1888335	attR	TACATGCGCTTCCTGC	NA	NA	NA	NA
>prophage 3
NC_012917	Pectobacterium carotovorum subsp. carotovorum PC1, complete genome	4862913	2180458	2190011	4862913	tRNA	Tupanvirus(33.33%)	10	NA	NA
WP_015840131.1|2180458_2182387_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-128
WP_015840132.1|2182390_2182933_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.1	1.3e-15
WP_004263702.1|2183046_2183244_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005968887.1|2183287_2183644_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_106120997.1|2183749_2183794_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_015840133.1|2183975_2184959_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	4.5e-35
WP_015840134.1|2184973_2187361_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	1.7e-08
WP_009112984.1|2187365_2187662_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.1e-13
WP_015840135.1|2187723_2188155_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_015840136.1|2188292_2190011_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	8.6e-58
>prophage 4
NC_012917	Pectobacterium carotovorum subsp. carotovorum PC1, complete genome	4862913	2989227	3022218	4862913	plate,holin,capsid,terminase,head,portal,integrase,tail	Salmonella_phage(75.0%)	44	2989037:2989096	3022684:3022747
2989037:2989096	attL	TTAAATCAATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTT	NA	NA	NA	NA
WP_015840823.1|2989227_2990235_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	57.1	3.9e-103
WP_015840824.1|2990255_2991086_-	DUF4393 domain-containing protein	NA	Q6R840	Staphylococcus_virus	30.4	1.2e-09
WP_015840825.1|2991134_2991737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015840826.1|2991752_2992097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043881793.1|2992080_2992344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015840827.1|2992388_2992802_-	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	36.4	2.7e-10
WP_015840828.1|2992862_2993138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116478.1|2993109_2993634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015840830.1|2993690_2993882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015840831.1|2993893_2994106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116512.1|2994138_2994339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015840833.1|2994335_2994536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015840834.1|2994541_2994904_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	50.0	1.3e-19
WP_015840835.1|2994973_2995213_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
WP_015840836.1|2995209_2995788_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	51.6	2.6e-43
WP_015840837.1|2995784_2996627_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	58.2	4.0e-85
WP_043881945.1|2996733_2996913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015840839.1|2996912_2999423_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	39.4	8.2e-126
WP_015840840.1|2999556_2999769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015840841.1|3000174_3001242_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	71.8	1.7e-152
WP_015840842.1|3001244_3002957_-|terminase	terminase	terminase	A0A0M4S6K7	Salmonella_phage	68.5	1.3e-231
WP_015840843.1|3003103_3003949_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	57.8	3.8e-83
WP_015840844.1|3003983_3005033_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	69.5	7.1e-140
WP_015840845.1|3005084_3005906_+|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	60.5	1.1e-68
WP_015840846.1|3006002_3006509_+|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	64.3	1.0e-51
WP_015840847.1|3006508_3006712_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	67.2	5.4e-20
WP_015840848.1|3006702_3007005_+|holin	phage-holin analog protein	holin	NA	NA	NA	NA
WP_015840849.1|3006994_3007471_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	54.4	5.8e-41
WP_015840850.1|3007452_3007878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015840851.1|3007994_3008483_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	66.4	1.4e-50
WP_015840852.1|3008485_3009127_+	phage morphogeneis protein	NA	A0A0M4RCU1	Salmonella_phage	46.4	3.5e-41
WP_015840853.1|3009225_3009810_+|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	50.5	5.1e-47
WP_015840854.1|3009806_3010166_+|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	62.7	1.2e-33
WP_015840855.1|3010162_3011074_+|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	70.6	2.3e-110
WP_015840856.1|3011066_3011675_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	67.3	2.1e-75
WP_015840858.1|3013665_3013815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015840859.1|3013858_3014905_-	acyltransferase	NA	G9L6E5	Escherichia_phage	28.6	6.4e-16
WP_015840860.1|3015204_3015627_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	69.9	6.7e-49
WP_015840861.1|3015637_3018736_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	54.2	1.4e-111
WP_015840862.1|3018732_3018849_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_039490576.1|3018881_3019202_-|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	62.4	1.4e-25
WP_015840864.1|3019208_3019724_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	86.0	1.2e-84
WP_015840865.1|3019734_3020928_-|tail	phage tail sheath protein	tail	A0A0M4S6M1	Salmonella_phage	74.6	5.7e-170
WP_043881948.1|3021093_3022218_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	70.1	4.9e-139
3022684:3022747	attR	TTAAATCAATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 5
NC_012917	Pectobacterium carotovorum subsp. carotovorum PC1, complete genome	4862913	3545465	3550884	4862913		Mycobacterium_phage(33.33%)	6	NA	NA
WP_015841296.1|3545465_3545705_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	59.5	9.1e-19
WP_010280810.1|3545714_3546122_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A220BYR7	Staphylococcus_phage	26.5	1.1e-06
WP_043881817.1|3546118_3548266_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.2	3.8e-204
WP_015841298.1|3548290_3549253_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.9	1.6e-138
WP_015841299.1|3549626_3550364_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.4	1.1e-38
WP_015841300.1|3550419_3550884_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.7	6.3e-48
>prophage 6
NC_012917	Pectobacterium carotovorum subsp. carotovorum PC1, complete genome	4862913	3573373	3631379	4862913	tRNA,lysis,plate,capsid,terminase,head,portal,integrase,bacteriocin,tail	Escherichia_phage(24.39%)	70	3573089:3573113	3601295:3601319
3573089:3573113	attL	GATCTGTATAAACGTTTATAAAATA	NA	NA	NA	NA
WP_015841315.1|3573373_3574432_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	76.1	2.4e-159
WP_043881818.1|3574526_3574841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116520.1|3575061_3575955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015841317.1|3575974_3576832_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	50.9	3.5e-76
WP_015841318.1|3576954_3577290_+	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	45.0	3.2e-17
WP_015841319.1|3577328_3577838_+	phage regulatory CII family protein	NA	A0A218M4I4	Erwinia_phage	58.3	2.7e-52
WP_155116483.1|3578057_3578279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015841320.1|3578312_3578507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015841322.1|3578814_3579315_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	57.8	3.7e-54
WP_015841323.1|3579377_3579626_+	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	59.3	2.2e-07
WP_005967852.1|3579625_3579934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015841324.1|3579933_3580158_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	58.1	2.8e-17
WP_155116521.1|3580244_3580436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015841326.1|3580432_3582736_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	61.4	1.3e-266
WP_015841327.1|3582732_3583041_+	hypothetical protein	NA	A0A1R3Y5T1	Salmonella_virus	36.7	2.7e-07
WP_015841328.1|3583040_3583232_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	50.0	2.0e-08
WP_015841329.1|3583231_3583570_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	63.8	1.5e-35
WP_043881822.1|3583730_3583952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015841330.1|3584259_3584778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015841331.1|3584777_3585137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015841332.1|3585616_3586636_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	74.7	1.3e-151
WP_015841333.1|3586632_3588402_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.2	1.2e-283
WP_015841334.1|3588541_3589396_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	69.1	5.9e-100
WP_015841335.1|3589443_3590571_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	71.2	2.7e-145
WP_015841336.1|3590574_3591234_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	64.3	2.9e-70
WP_015841337.1|3591325_3591829_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	59.2	8.6e-51
WP_015841338.1|3591828_3592032_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	73.1	1.3e-21
WP_043881823.1|3592022_3592244_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	49.3	2.2e-14
WP_015841340.1|3592227_3592737_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	69.5	4.6e-60
WP_015841341.1|3592733_3593180_+|lysis	LysB family phage lysis regulatory protein	lysis	NA	NA	NA	NA
WP_015841343.1|3593269_3593725_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	65.8	6.6e-50
WP_015841344.1|3593717_3594167_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	61.7	1.7e-45
WP_015841345.1|3594195_3594537_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	8.4e-42
WP_015841346.1|3594791_3595106_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	66.0	4.3e-32
WP_015841347.1|3595443_3596073_+	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	68.1	7.2e-39
WP_015841348.1|3596134_3596509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015841349.1|3596662_3597304_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	72.8	3.4e-84
WP_015841350.1|3597300_3597645_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.8	1.2e-35
WP_015841351.1|3597649_3598558_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	76.8	8.6e-126
WP_015841352.1|3598550_3599162_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.5	5.5e-76
WP_015841354.1|3601540_3602710_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	84.4	4.4e-191
3601295:3601319	attR	GATCTGTATAAACGTTTATAAAATA	NA	NA	NA	NA
WP_015841355.1|3602724_3603246_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	78.5	1.8e-75
WP_015841356.1|3603313_3603610_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	67.4	2.3e-27
WP_010310409.1|3603624_3603747_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	81.6	4.2e-12
WP_015841358.1|3606620_3607106_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	60.2	7.0e-50
WP_015841359.1|3607102_3608251_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	66.8	3.1e-144
WP_015841360.1|3608338_3608557_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	68.1	9.2e-26
WP_010285987.1|3608718_3609066_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_015841361.1|3609128_3609884_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015841362.1|3609922_3610471_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_015841363.1|3610489_3610738_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_015841364.1|3610895_3612257_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015841365.1|3612426_3613221_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_015841366.1|3613290_3613806_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_015841367.1|3613959_3615513_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_015841368.1|3615595_3616024_-	DedA family protein	NA	NA	NA	NA	NA
WP_015841369.1|3616020_3616587_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_005972168.1|3617982_3618168_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_015841370.1|3618493_3621121_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.5	1.1e-77
WP_015841371.1|3621259_3621754_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_015841372.1|3621799_3622873_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_015841373.1|3622980_3623475_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	46.8	8.5e-27
WP_015841374.1|3623701_3624037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015841375.1|3624527_3625016_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_015841376.1|3625099_3625774_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_015841377.1|3625952_3627551_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	9.5e-19
WP_080516301.1|3627809_3629006_-	MFS transporter	NA	NA	NA	NA	NA
WP_015841379.1|3629121_3630003_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015841380.1|3630218_3630854_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_015841381.1|3630956_3631379_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 7
NC_012917	Pectobacterium carotovorum subsp. carotovorum PC1, complete genome	4862913	4339464	4348313	4862913		Dickeya_phage(42.86%)	7	NA	NA
WP_015841957.1|4339464_4340589_+	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	71.0	3.8e-54
WP_015841958.1|4341249_4342374_+	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	73.2	1.4e-56
WP_015841959.1|4342994_4344119_+	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	76.8	8.6e-59
WP_015841960.1|4344287_4345583_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	33.1	1.7e-34
WP_015841961.1|4345888_4346461_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.9	2.3e-07
WP_015841962.1|4346667_4347477_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.9e-28
WP_039362817.1|4347488_4348313_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.1e-13
