The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013170	Cryptobacterium curtum DSM 15641, complete sequence	1617804	315653	358915	1617804	tail,portal,terminase,holin,integrase	Streptococcus_phage(15.0%)	54	357941:357966	358931:358956
WP_012802675.1|315653_315905_-|holin	phage holin	holin	Q38613	Lactococcus_phage	63.4	5.8e-24
WP_012802676.1|315901_316303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802677.1|316312_317131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802678.1|317127_317358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802679.1|317376_318357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802680.1|318347_319175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802681.1|319167_322455_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	41.4	1.4e-77
WP_012802682.1|322457_323063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802683.1|323043_323469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802684.1|323517_324213_-	Ig-like domain-containing protein	NA	O03972	Lactobacillus_phage	40.0	1.3e-20
WP_012802685.1|324215_324605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802686.1|324601_324937_-	hypothetical protein	NA	A0A2H4JD78	uncultured_Caudovirales_phage	31.5	8.1e-05
WP_012802687.1|324933_325257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802688.1|325253_325565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802689.1|325564_326374_-	hypothetical protein	NA	A0A1S5SA37	Streptococcus_phage	27.5	3.9e-13
WP_012802690.1|326383_326893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802691.1|327073_327412_-	VRR-NUC domain-containing protein	NA	H7BUL6	unidentified_phage	51.7	5.3e-20
WP_012802692.1|327572_327932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802693.1|327939_328140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802694.1|328130_329948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802695.1|329951_331346_-|portal	phage portal protein	portal	A0A1Z1LZJ4	Bacillus_phage	25.0	2.3e-29
WP_012802696.1|331348_332629_-|terminase	terminase	terminase	B6CXD2	Clostridium_phage	40.8	2.8e-82
WP_012802697.1|332621_333071_-	hypothetical protein	NA	A0A1P8BLX2	Lactococcus_phage	38.2	8.0e-16
WP_012802698.1|333057_334290_-	ParB N-terminal domain-containing protein	NA	A0A2H4JBH5	uncultured_Caudovirales_phage	49.1	2.1e-21
WP_012802699.1|334415_334799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143711794.1|334947_335451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041225418.1|336203_336488_-	hypothetical protein	NA	G8IR46	Mycobacterium_virus	45.0	5.8e-12
WP_169302060.1|336552_336723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802706.1|337090_337447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802707.1|337443_338010_-	ATP-binding protein	NA	Q9MCM6	Streptococcus_virus	31.3	3.7e-10
WP_012802708.1|337984_338665_-	hypothetical protein	NA	A0A0F7L7L4	uncultured_marine_virus	43.7	3.4e-10
WP_012802709.1|338657_338885_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012802710.1|338894_339392_-	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	39.4	5.8e-15
WP_012802711.1|339394_340069_-	phage recombination protein Bet	NA	A0A141E1C2	Streptococcus_phage	40.9	9.2e-32
WP_012802712.1|340053_340323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802713.1|340323_341277_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_012802715.1|341852_342059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802716.1|342067_342436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012802717.1|342447_342669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169302075.1|342968_343568_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012802719.1|343585_344125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012802720.1|344212_344776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012802721.1|344896_345889_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_012802722.1|345981_346290_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_012802723.1|346330_347476_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	25.4	2.3e-19
WP_012802724.1|347916_348600_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012802725.1|348796_349006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012802726.1|349011_349845_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012802727.1|349848_352419_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.2	8.2e-89
WP_143711843.1|352489_353035_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012802729.1|353044_354040_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	30.8	3.0e-07
WP_012802730.1|354042_354591_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012802731.1|354631_357865_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.2	6.0e-20
357941:357966	attL	CTCATCACCCTTCATCAGCGTAAGCG	NA	NA	NA	NA
WP_012802732.1|357991_358915_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.5	3.6e-79
WP_012802732.1|357991_358915_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.5	3.6e-79
358931:358956	attR	CGCTTACGCTGATGAAGGGTGATGAG	NA	NA	NA	NA
