The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013131	Catenulispora acidiphila DSM 44928, complete sequence	10467782	565425	640312	10467782	integrase,transposase,tRNA	Stenotrophomonas_phage(25.0%)	58	553590:553632	641106:641148
553590:553632	attL	GTGCGCACGAAGGGATTCGAACCCCTAACCTTCTGATCCGTAG	NA	NA	NA	NA
WP_190276713.1|565425_566070_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041540001.1|566975_567587_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012784737.1|568222_569434_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_012784738.1|569439_572580_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_012784739.1|572570_573023_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_041540003.1|573547_574060_-	DUF4429 domain-containing protein	NA	NA	NA	NA	NA
WP_041540004.1|574705_575116_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A142EZY1	Stenotrophomonas_phage	45.3	8.1e-23
WP_012784742.1|575176_576604_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A219YC72	Aeromonas_phage	27.8	5.3e-05
WP_012784743.1|576657_578310_+	adenylosuccinate synthetase	NA	G3FFN6	Vibrio_phage	35.5	6.1e-29
WP_143765124.1|578405_579032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041540005.1|579522_580659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190276714.1|582088_586276_-	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_012784748.1|586578_587925_+	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_012784749.1|587951_589754_+	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_083795482.1|590520_591039_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012784750.1|591311_593135_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_012784751.1|593158_593641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012784752.1|593866_594040_+	FXSXX-COOH protein	NA	NA	NA	NA	NA
WP_012784753.1|594068_596516_+	FxsB family radical SAM/SPASM domain protein	NA	NA	NA	NA	NA
WP_012784754.1|596508_597360_+	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012784755.1|597480_598845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012784756.1|598867_602812_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012784757.1|602878_603754_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049871439.1|604611_604959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143765680.1|604945_605929_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012784761.1|608149_608386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049871441.1|608675_608903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049871442.1|608899_609166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049871443.1|609424_609691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143765126.1|610166_610766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012784763.1|611023_611197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012784764.1|611374_612217_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_190276715.1|612221_612917_-	thioesterase	NA	NA	NA	NA	NA
WP_012784766.1|613034_613835_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012784767.1|613831_614464_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012784768.1|614460_615936_-	tryptophan 7-halogenase	NA	NA	NA	NA	NA
WP_049871445.1|615935_616670_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_012784770.1|616735_617584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012784771.1|617573_617858_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_143765681.1|617854_618682_-	diiron oxygenase	NA	NA	NA	NA	NA
WP_012784773.1|618792_619875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012784774.1|619871_620138_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_012784775.1|620304_621366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190276716.1|621365_623081_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_190276717.1|623266_624481_-	MFS transporter	NA	NA	NA	NA	NA
WP_012784778.1|624617_625493_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083795486.1|625517_625838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190276718.1|629212_629365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012784779.1|630101_631304_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	26.6	4.2e-27
WP_012784780.1|631694_633119_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012784781.1|633146_634406_+	MFS transporter	NA	NA	NA	NA	NA
WP_041541025.1|634428_635424_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_012784783.1|635460_636594_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_012784784.1|636590_637448_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_143765682.1|637428_638598_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_012784786.1|638630_638957_+|tRNA	L-selenocysteinyl-tRNA(Sec) synthase	tRNA	NA	NA	NA	NA
WP_012784787.1|638978_640052_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_083795488.1|640048_640312_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
641106:641148	attR	GTGCGCACGAAGGGATTCGAACCCCTAACCTTCTGATCCGTAG	NA	NA	NA	NA
>prophage 2
NC_013131	Catenulispora acidiphila DSM 44928, complete sequence	10467782	3351115	3359650	10467782		Gordonia_phage(37.5%)	13	NA	NA
WP_012787238.1|3351115_3351922_-	hypothetical protein	NA	A0A2P1A0S7	Gordonia_phage	38.3	2.5e-23
WP_012787239.1|3351918_3353370_-	DNA cytosine methyltransferase	NA	A0A142KB94	Gordonia_phage	42.0	3.2e-90
WP_012787240.1|3353366_3353765_-	hypothetical protein	NA	A0A2L0HJX4	Mycobacterium_phage	43.6	9.3e-16
WP_012787241.1|3353764_3354100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012787242.1|3354096_3354333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012787243.1|3354329_3355265_-	phage Gp37/Gp68 family protein	NA	A0A0A7RVQ8	Mycobacterium_phage	52.9	3.9e-73
WP_012787244.1|3355267_3355678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012787245.1|3355674_3356496_-	DNA adenine methylase	NA	A0A068CCE6	Rhizobium_phage	40.0	2.2e-35
WP_012787246.1|3356495_3356909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012787247.1|3357049_3357445_-	HNH endonuclease	NA	A0A076YKQ7	Mycobacterium_phage	45.1	3.9e-22
WP_012787248.1|3357549_3357777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012787249.1|3357773_3358715_-	recombinase RecT	NA	A0A173G9I3	Propionibacterium_phage	50.2	1.0e-60
WP_012787250.1|3358711_3359650_-	YqaJ viral recombinase family protein	NA	A0A160DEY0	Gordonia_phage	32.9	4.0e-33
>prophage 3
NC_013131	Catenulispora acidiphila DSM 44928, complete sequence	10467782	4345040	4401727	10467782	integrase,transposase	Staphylococcus_phage(33.33%)	45	4373790:4373809	4405355:4405374
WP_143765868.1|4345040_4345235_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143765298.1|4345927_4346185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041540330.1|4346475_4347936_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_015792467.1|4348033_4348669_+	GAP family protein	NA	NA	NA	NA	NA
WP_049871624.1|4348727_4350341_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_015792469.1|4350744_4351092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792470.1|4351189_4354330_+	NHL repeat containing protein	NA	NA	NA	NA	NA
WP_015792471.1|4354359_4355928_+	phospholipase C	NA	NA	NA	NA	NA
WP_015792472.1|4356246_4359210_-	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_190276775.1|4359757_4360249_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_015792473.1|4360182_4360485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792474.1|4360590_4361568_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015792475.1|4361669_4362473_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015792476.1|4362856_4363648_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_015792477.1|4363644_4364325_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.3	1.3e-30
WP_049871626.1|4364622_4365288_+	Lsr2 family protein	NA	NA	NA	NA	NA
WP_015792478.1|4365499_4366129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143765300.1|4366263_4366830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143765301.1|4366880_4367549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015792481.1|4367896_4369939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792482.1|4370235_4370460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015792483.1|4370610_4371486_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_190276776.1|4371642_4372767_+	recombinase family protein	NA	NA	NA	NA	NA
4373790:4373809	attL	CTGCTCGTTCAGCCAGATGA	NA	NA	NA	NA
WP_015792486.1|4373972_4374704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792487.1|4374785_4375121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792488.1|4375436_4375808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143765303.1|4376259_4376568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015792489.1|4376564_4377143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015792490.1|4377170_4382381_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_143765304.1|4382605_4382887_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_190276777.1|4382895_4383045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015792491.1|4383046_4383550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792492.1|4383627_4384419_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	30.1	9.4e-28
WP_015792493.1|4384415_4386011_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.7	1.2e-13
WP_041540333.1|4387269_4387560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143765305.1|4387731_4387965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792495.1|4388397_4389387_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_041540335.1|4389569_4389767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792496.1|4390636_4391656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792497.1|4391652_4392567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143765306.1|4392572_4395761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792499.1|4396168_4397287_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015792500.1|4397318_4399385_-	caspase family protein	NA	NA	NA	NA	NA
WP_015792501.1|4399375_4400575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015792502.1|4401151_4401727_-|transposase	transposase	transposase	NA	NA	NA	NA
4405355:4405374	attR	CTGCTCGTTCAGCCAGATGA	NA	NA	NA	NA
