The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013171	Anaerococcus prevotii DSM 20548, complete sequence	1883067	896801	933002	1883067	capsid,tail,portal,integrase,plate,terminase	Deep-sea_thermophilic_phage(15.38%)	62	896714:896733	937804:937823
896714:896733	attL	ATGGTGGAGGTGAAGGGATT	NA	NA	NA	NA
WP_015777726.1|896801_897890_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A172LN96	Lactococcus_phage	35.1	2.2e-51
WP_015777727.1|898010_898385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015777728.1|898430_899051_-	LexA family transcriptional regulator	NA	A0A2K9V3G4	Faecalibacterium_phage	29.7	2.2e-16
WP_049756235.1|899236_899440_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	45.5	8.3e-05
WP_015777730.1|899506_899704_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015777731.1|899713_899896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777732.1|899914_900127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777733.1|900116_900389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777734.1|900398_900683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777735.1|900679_901147_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	44.0	3.4e-25
WP_015777736.1|901143_901764_+	ERF family protein	NA	A0A090D840	Clostridium_phage	57.3	3.2e-39
WP_015777737.1|901763_902060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777738.1|902066_902468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777739.1|902460_903405_+	hypothetical protein	NA	D2XR43	Bacillus_phage	53.1	2.1e-26
WP_015777740.1|903409_904192_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015777741.1|904181_904409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777742.1|904409_904874_+	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	42.9	5.4e-23
WP_169302044.1|904923_905085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777744.1|905084_905462_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_015777745.1|905494_905728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777747.1|905907_906378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143713845.1|906596_906779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777750.1|906771_906975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777751.1|906971_907400_+	hypothetical protein	NA	U6E9D1	Streptococcus_phage	50.0	2.1e-29
WP_015777752.1|907396_907567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777754.1|907668_908637_+	Fe-S-cluster redox enzyme-like protein	NA	NA	NA	NA	NA
WP_015777755.1|908652_908886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777756.1|908898_909087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777757.1|909083_909458_+	MazG-like family protein	NA	X2KMA0	Enterococcus_phage	45.2	1.1e-13
WP_015777758.1|909473_909770_+	hypothetical protein	NA	A0A1P8BM61	Lactococcus_phage	31.4	8.4e-06
WP_015777759.1|909813_910005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115597363.1|910074_910578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041449752.1|910879_911455_+	ParB N-terminal domain-containing protein	NA	B5SP22	Lactococcus_phage	51.4	1.2e-37
WP_015777762.1|911447_912473_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015777763.1|912473_913259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777764.1|913267_913735_+	hypothetical protein	NA	A0A0A7RTH0	Clostridium_phage	55.4	4.7e-35
WP_015777765.1|913727_914966_+|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	57.5	2.1e-127
WP_015777766.1|914973_916443_+|portal	phage portal protein	portal	D2J002	Enterococcus_phage	29.2	4.5e-39
WP_169302045.1|916573_917173_+	hypothetical protein	NA	A0A1Q1PVS5	Bacillus_phage	32.2	1.7e-13
WP_015777769.1|917362_917629_+	hypothetical protein	NA	G9J3G8	Clostridium_phage	53.8	1.6e-16
WP_015777770.1|917781_918381_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_015777771.1|918392_919334_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	52.0	9.4e-83
WP_015777772.1|919344_919557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777773.1|919574_919967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777774.1|919950_920463_+	hypothetical protein	NA	E5DV55	Deep-sea_thermophilic_phage	38.9	1.2e-28
WP_041449699.1|920462_920846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777776.1|920835_921342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777777.1|921345_922359_+	DUF3383 family protein	NA	E5DV56	Deep-sea_thermophilic_phage	33.3	8.6e-42
WP_015777778.1|922358_922766_+	hypothetical protein	NA	E5DV57	Deep-sea_thermophilic_phage	40.8	1.5e-16
WP_015777779.1|922782_923070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169302046.1|923120_923261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777780.1|923265_925482_+|tail	phage tail tape measure protein	tail	A0A0A7RVT5	Clostridium_phage	34.6	2.1e-40
WP_015777781.1|925484_926123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115597364.1|926119_926428_+	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	35.0	9.1e-11
WP_015777783.1|926414_927263_+	hypothetical protein	NA	A0A1L2JY62	Aeribacillus_phage	31.5	1.4e-32
WP_115597388.1|927313_927856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115597365.1|927876_928221_+	DUF2634 domain-containing protein	NA	A0A1L2JY67	Aeribacillus_phage	29.1	4.0e-07
WP_115597389.1|928249_929446_+|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	38.0	2.1e-63
WP_015777787.1|929438_930203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777788.1|930195_930537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777789.1|930529_931003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015777790.1|930995_933002_+	hypothetical protein	NA	H7BVN1	unidentified_phage	33.2	3.6e-31
937804:937823	attR	ATGGTGGAGGTGAAGGGATT	NA	NA	NA	NA
>prophage 2
NC_013171	Anaerococcus prevotii DSM 20548, complete sequence	1883067	1181132	1192377	1883067		Synechococcus_phage(28.57%)	7	NA	NA
WP_015778034.1|1181132_1182152_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	40.8	8.4e-61
WP_015778035.1|1182151_1182628_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	55.8	5.1e-37
WP_015778036.1|1182636_1184088_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.6	8.4e-99
WP_015778037.1|1184084_1188980_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.3	9.4e-25
WP_015778038.1|1188989_1190495_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.4	7.2e-61
WP_015778039.1|1190491_1191037_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.0	4.7e-18
WP_015778040.1|1191033_1192377_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	28.3	4.8e-40
