The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	151801	209130	4545624	transposase	Wolbachia_phage(25.0%)	47	NA	NA
WP_042316429.1|151801_153043_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	31.8	8.4e-39
WP_012813549.1|153331_154465_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012813550.1|154872_155742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315197.1|156027_156216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042315201.1|156360_156696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813551.1|156835_157414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813552.1|157430_157619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052292887.1|157823_158117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315206.1|158260_158785_+	DUF2380 domain-containing protein	NA	NA	NA	NA	NA
WP_012813554.1|158795_159383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315207.1|159782_160148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042316435.1|161800_161986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813556.1|162764_163019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012813557.1|163361_164495_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012813561.1|168491_169361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157863039.1|169727_170726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813563.1|170738_171242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157862815.1|171683_171866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813564.1|172016_172919_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_012813565.1|173892_174144_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012813566.1|174145_174511_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	47.4	2.7e-22
WP_083773334.1|175407_175554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169306032.1|178614_183984_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	31.9	6.0e-09
WP_012813568.1|183995_184577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813570.1|185858_186284_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813571.1|186581_187214_-	peptidase M56 BlaR1	NA	NA	NA	NA	NA
WP_012813572.1|187219_187579_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813573.1|188007_188238_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_042316441.1|188277_189042_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012813575.1|189115_190657_+	iron hydrogenase small subunit	NA	NA	NA	NA	NA
WP_012813576.1|190678_191467_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	32.3	1.1e-15
WP_012813577.1|191491_192628_+	Ni/Fe-hydrogenase cytochrome b subunit	NA	NA	NA	NA	NA
WP_012813578.1|192769_193687_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813579.1|193918_195640_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_012813580.1|195663_197457_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_012813581.1|197470_197830_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_012813582.1|197826_198381_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012813583.1|198387_198885_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_012813584.1|198992_199343_-	iron-sulfur-binding hydrogenase	NA	NA	NA	NA	NA
WP_012813585.1|199342_200674_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_042316443.1|200673_201075_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_042316445.1|201128_201470_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015755857.1|201869_202919_+	[FeFe] hydrogenase H-cluster radical SAM maturase HydE	NA	NA	NA	NA	NA
WP_015755858.1|202966_204376_+	[FeFe] hydrogenase H-cluster radical SAM maturase HydG	NA	NA	NA	NA	NA
WP_015755859.1|204451_205678_-	[FeFe] hydrogenase H-cluster maturation GTPase HydF	NA	NA	NA	NA	NA
WP_015755860.1|205661_207128_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_015755861.1|207897_209130_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 2
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	429284	491206	4545624	transposase	Streptococcus_phage(25.0%)	49	NA	NA
WP_015756076.1|429284_429689_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	5.3e-51
WP_015756077.1|429694_430786_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	37.2	1.6e-57
WP_083773345.1|430966_431197_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_015756078.1|431602_431776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052292898.1|432577_432820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157862824.1|433133_433343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756080.1|433749_438939_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_015756081.1|439140_440076_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157862825.1|440203_440734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756083.1|440844_441048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756084.1|441123_441651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756086.1|445800_445977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174260358.1|446379_447819_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015756088.1|448276_451957_+	S-layer homology domain-containing protein	NA	K4FB16	Cronobacter_phage	49.4	4.9e-10
WP_015756089.1|452127_452685_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_015756090.1|453099_453486_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015756091.1|453732_455799_+	adenylyltransferase/cytidyltransferase family protein	NA	NA	NA	NA	NA
WP_015756092.1|455969_456515_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015756093.1|456507_457824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756094.1|458002_458779_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_015756095.1|458780_459584_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015756096.1|459580_460555_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.1e-20
WP_015756097.1|460840_461854_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_015756098.1|462392_463187_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	2.1e-19
WP_015756099.1|463170_464178_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	8.1e-08
WP_015756100.1|464201_465065_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015756101.1|465066_466017_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015756102.1|466022_467582_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042316518.1|467917_468607_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015756104.1|468992_469412_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015756105.1|469429_471322_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.8	4.0e-101
WP_015756106.1|471724_473068_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015756076.1|473208_473613_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	5.3e-51
WP_015756107.1|473618_474710_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	37.5	1.6e-57
WP_083773346.1|474966_475242_-	HNH endonuclease	NA	Q2NPD2	Xanthomonas_virus	50.8	9.3e-07
WP_015756108.1|475312_476317_-	DUF4065 domain-containing protein	NA	Q9AZD6	Lactococcus_phage	28.0	1.2e-06
WP_015756109.1|476344_476755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083773347.1|477371_477620_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015756110.1|477621_478041_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_015756111.1|478037_478385_+	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
WP_015756112.1|478495_478798_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042315293.1|480196_480526_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_015756115.1|480599_482414_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015756116.1|482523_482871_+	toxin RelE	NA	NA	NA	NA	NA
WP_015756120.1|486209_487163_+	DMT family transporter	NA	NA	NA	NA	NA
WP_015756121.1|487820_488018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756122.1|488038_488851_+	tetrapyrrole methylase	NA	NA	NA	NA	NA
WP_042315294.1|489357_489792_+	recombinase family protein	NA	A0A1S5RFV4	Helicobacter_phage	35.7	2.4e-09
WP_015756124.1|489748_491206_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 3
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	732837	745880	4545624		Hokovirus(20.0%)	12	NA	NA
WP_015756355.1|732837_733374_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	30.0	6.6e-09
WP_174260373.1|733418_734957_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	1.7e-20
WP_015756357.1|735034_735550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756358.1|735602_736313_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	6.7e-17
WP_015756359.1|736866_738243_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.5	1.8e-50
WP_015756360.1|738396_738924_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.3	1.3e-20
WP_015756361.1|739030_740323_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	1.4e-20
WP_015756362.1|740339_741080_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_015756363.1|741129_742566_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	33.7	6.9e-61
WP_015756364.1|742595_743636_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.9	1.2e-70
WP_042315352.1|743699_744308_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.8	2.3e-29
WP_015756366.1|744338_745880_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	1.4e-64
>prophage 4
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	817999	875000	4545624	tRNA,transposase	Streptococcus_phage(30.0%)	50	NA	NA
WP_015756431.1|817999_818506_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_015756432.1|818572_819532_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_015756433.1|819552_820992_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_042316658.1|821171_822866_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_015756435.1|823103_826541_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	41.2	6.8e-248
WP_015756436.1|826675_826903_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_015756437.1|827076_827268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756438.1|827295_828144_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_015756439.1|828145_829123_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_015756440.1|829253_830216_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_015756441.1|830228_831980_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	42.2	1.2e-11
WP_015756442.1|832331_832931_+	DedA family protein	NA	NA	NA	NA	NA
WP_015756443.1|832979_833975_+	G-D-S-L family lipolytic protein	NA	NA	NA	NA	NA
WP_015756444.1|834268_836293_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_015756445.1|836225_837434_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_015756446.1|837459_838578_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_015756447.1|838621_840070_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_015756448.1|840134_841061_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	53.6	6.8e-86
WP_157862843.1|841297_841879_+	DUF1256 domain-containing protein	NA	NA	NA	NA	NA
WP_042315376.1|842501_842801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756450.1|842828_844073_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	41.4	3.6e-13
WP_015756451.1|844096_845695_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015756452.1|845753_846428_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_015756453.1|846655_847489_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	50.2	3.5e-73
WP_015756454.1|847505_848618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157862845.1|849081_849246_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015756456.1|849723_851007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756458.1|853006_854329_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	35.0	7.8e-59
WP_052292906.1|854402_854732_+	FAD-dependent thymidylate synthase	NA	NA	NA	NA	NA
WP_015756459.1|854825_855068_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_015756460.1|855280_855673_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015755906.1|856031_857714_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015756464.1|858652_858850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157863060.1|858908_859376_+	AAA family ATPase	NA	A0A142F1B0	Bacillus_phage	39.7	6.6e-21
WP_015756466.1|859650_859857_+	helix-turn-helix transcriptional regulator	NA	A0A0C5ABM0	Bacteriophage	51.5	4.6e-11
WP_015756467.1|860175_861402_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	37.5	1.6e-53
WP_015756468.1|862233_862569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756469.1|862786_862954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756471.1|863279_863594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013532.1|863616_863811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756473.1|864111_864780_+|transposase	IS607 family transposase	transposase	A0A1S5RFV4	Helicobacter_phage	34.3	6.5e-22
WP_015756475.1|866462_866873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756476.1|866924_867647_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015756477.1|867850_868234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756478.1|868632_868965_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_015756479.1|868961_869438_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157862847.1|869496_869817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756481.1|870078_871803_-	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_015756482.1|872064_873327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756483.1|873542_875000_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 5
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	910733	964199	4545624	bacteriocin,transposase	Acinetobacter_phage(30.0%)	40	NA	NA
WP_015756509.1|910733_911825_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	33.5	7.1e-50
WP_015756510.1|911830_912235_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	3.1e-51
WP_015756512.1|912331_913531_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_015756513.1|913801_914134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756514.1|914911_915931_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_015756515.1|915945_917106_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_042316699.1|917384_918857_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_015756517.1|918903_919509_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	55.7	4.1e-63
WP_015756518.1|919528_920563_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.2	1.3e-72
WP_015756519.1|920559_921375_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.0	9.4e-39
WP_015756520.1|921376_922012_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_015756521.1|922004_922823_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_015756522.1|922809_923634_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_042315396.1|923926_924661_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_015756524.1|924673_926365_+	type I-B CRISPR-associated protein Cas8b1/Cst1	NA	NA	NA	NA	NA
WP_015756525.1|926368_927241_+	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_015756526.1|927227_927980_+	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_157863061.1|927976_930226_+	CRISPR-associated helicase Cas3'	NA	A0A2R2ZGW0	Clostridioides_phage	23.6	1.5e-25
WP_015756528.1|930255_930744_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_015756529.1|930755_931748_+	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_015756530.1|931750_932029_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_015756115.1|938140_939955_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_083773365.1|943910_944069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756532.1|944479_946597_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_015756533.1|946611_947865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756534.1|947869_949003_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	28.3	3.0e-19
WP_015756535.1|949105_950155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315405.1|950147_951785_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	24.8	2.5e-38
WP_015756537.1|951809_952694_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_015756538.1|952764_953007_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_015756539.1|953003_953504_+	MFS transporter	NA	NA	NA	NA	NA
WP_015756540.1|953491_953827_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_015756541.1|953828_954257_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015756542.1|954253_955882_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015756543.1|955907_956450_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157862851.1|956451_956619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756545.1|956635_957778_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015756546.1|957798_959193_+|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
WP_157863062.1|959295_961446_+|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.3	6.5e-31
WP_015756548.1|961472_964199_+|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	25.7	1.7e-31
>prophage 6
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	1112924	1160099	4545624	tRNA,transposase,coat	uncultured_Mediterranean_phage(42.86%)	42	NA	NA
WP_015756690.1|1112924_1115708_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.4	2.9e-95
WP_015756691.1|1115920_1116916_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_015756692.1|1116964_1117960_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_042316748.1|1117976_1119116_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015756694.1|1119116_1120310_-	CapA family protein	NA	NA	NA	NA	NA
WP_015756695.1|1120535_1121390_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_015756696.1|1121393_1122242_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_042315434.1|1122365_1122674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157863068.1|1123001_1123640_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015756700.1|1123697_1124390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157862859.1|1124522_1124789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315437.1|1124867_1125398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756702.1|1125838_1128067_-	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	50.0	4.9e-90
WP_157862861.1|1128208_1128385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756704.1|1128581_1129313_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015756705.1|1129475_1130171_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_015756706.1|1130314_1130938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756707.1|1131142_1132600_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_015756708.1|1132877_1133174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756709.1|1133251_1133644_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_015756710.1|1133760_1134240_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_015756711.1|1134245_1134857_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_015756712.1|1134911_1135922_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.1e-07
WP_015756713.1|1136610_1138449_+	APC family permease	NA	NA	NA	NA	NA
WP_015756714.1|1138550_1140377_-	APC family permease	NA	NA	NA	NA	NA
WP_015756715.1|1141194_1143012_+	DNA mismatch repair protein MutS domain-containing protein	NA	E3T5Q7	Cafeteria_roenbergensis_virus	26.2	1.5e-15
WP_015756716.1|1143634_1145848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042316755.1|1146056_1146614_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_015756718.1|1146619_1146841_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_015756719.1|1147025_1148417_+	SpoIID/LytB domain-containing protein	NA	NA	NA	NA	NA
WP_015756721.1|1149509_1150619_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	1.6e-89
WP_015756722.1|1150735_1151044_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.7	1.2e-07
WP_042315443.1|1151143_1151806_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015756724.1|1151831_1153082_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_042316758.1|1153098_1153971_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.4	8.5e-38
WP_015756726.1|1154168_1154465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052292910.1|1154467_1155175_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_015756728.1|1155339_1156311_+	cation transporter	NA	NA	NA	NA	NA
WP_015756729.1|1156492_1157260_+	RNA polymerase sigma-I factor	NA	NA	NA	NA	NA
WP_157862863.1|1157426_1157990_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_042315445.1|1158207_1159224_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_015756732.1|1159565_1160099_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
>prophage 7
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	1445668	1489338	4545624	transposase,integrase	uncultured_Mediterranean_phage(60.0%)	21	1484820:1484836	1493584:1493600
WP_015757004.1|1445668_1446049_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_015757005.1|1446020_1446971_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015757006.1|1447480_1450318_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.9	6.8e-52
WP_015757007.1|1450320_1454994_+	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.9	6.4e-15
WP_015757008.1|1454990_1461401_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.7	1.2e-67
WP_042315503.1|1461387_1463514_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_042315505.1|1463691_1464030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757010.1|1464522_1468251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756644.1|1468311_1469445_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042315506.1|1469702_1471784_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015757012.1|1471780_1472965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757013.1|1473146_1474445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757014.1|1474437_1475637_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	30.0	4.3e-24
WP_015757015.1|1475623_1476331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757016.1|1476708_1477212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315508.1|1477254_1477635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315510.1|1477683_1478556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757017.1|1478806_1479196_+	hypothetical protein	NA	NA	NA	NA	NA
1484820:1484836	attL	GTAAGCGCTTAATTTAA	NA	NA	NA	NA
WP_015757018.1|1485239_1486922_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015757019.1|1487348_1488377_-|integrase	tyrosine-type recombinase/integrase	integrase	U5Q0B8	Bacillus_phage	25.4	1.0e-10
WP_015757020.1|1488366_1489338_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1493584:1493600	attR	TTAAATTAAGCGCTTAC	NA	NA	NA	NA
>prophage 8
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	1578187	1585409	4545624		Erysipelothrix_phage(66.67%)	6	NA	NA
WP_015757100.1|1578187_1579819_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	38.8	3.2e-94
WP_015757101.1|1579787_1580687_+	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	21.5	1.4e-14
WP_015757102.1|1580709_1582368_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	46.2	4.3e-123
WP_157863077.1|1582435_1583737_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	51.3	3.1e-108
WP_015757104.1|1583947_1584151_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	73.1	1.6e-19
WP_174260377.1|1584191_1585409_+	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	27.9	5.5e-27
>prophage 9
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	1870608	1950755	4545624	protease,transposase	Staphylococcus_phage(25.0%)	57	NA	NA
WP_157862885.1|1870608_1870812_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_015757333.1|1870875_1871511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757334.1|1872124_1872550_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	45.1	1.6e-21
WP_015757335.1|1872803_1874960_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_015757336.1|1875110_1877660_+	alpha-glucan family phosphorylase	NA	NA	NA	NA	NA
WP_015757337.1|1877907_1878066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315596.1|1878133_1878448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757339.1|1878784_1880242_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_015757340.1|1881083_1881416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757341.1|1881460_1882009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042316942.1|1882181_1882703_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015757343.1|1882692_1884087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757344.1|1884116_1886381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757345.1|1886377_1887298_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	1.6e-26
WP_015757346.1|1887300_1888137_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015757347.1|1888310_1889021_-	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_015757348.1|1889020_1890400_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_157862887.1|1891987_1892761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757353.1|1893029_1893482_+	DUF188 domain-containing protein	NA	NA	NA	NA	NA
WP_015757354.1|1893541_1895368_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	40.7	5.8e-20
WP_015757356.1|1895882_1896032_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_015757357.1|1896637_1897633_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_015757358.1|1897701_1899309_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_015757359.1|1899432_1900083_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_015757360.1|1900196_1901144_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015757361.1|1901248_1901545_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015757362.1|1901576_1901957_-	DUF4363 family protein	NA	NA	NA	NA	NA
WP_015757363.1|1901970_1902645_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015757364.1|1902751_1903870_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_015757365.1|1903953_1904808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757366.1|1905052_1905883_+	nitrilase	NA	NA	NA	NA	NA
WP_015757367.1|1905939_1906290_-	DsrE family protein	NA	NA	NA	NA	NA
WP_015757368.1|1906386_1906902_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_157863084.1|1907376_1907886_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015757370.1|1907885_1909064_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_015757371.1|1909082_1909994_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	9.5e-32
WP_015757372.1|1909990_1910824_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015757373.1|1910894_1911122_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_015757374.1|1911235_1913221_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_015757375.1|1913437_1913917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757376.1|1913998_1914328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757377.1|1914469_1915255_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_015757378.1|1915280_1917521_+	DNA topoisomerase III	NA	A0A2P1EID3	Megavirus	25.7	3.1e-23
WP_174260379.1|1923504_1924890_-	MFS transporter	NA	NA	NA	NA	NA
WP_015757380.1|1925641_1926382_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	26.8	2.0e-19
WP_015757381.1|1927646_1928951_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	4.4e-30
WP_015756162.1|1931781_1933542_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015757384.1|1934009_1934603_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_015757385.1|1934691_1935165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757386.1|1936433_1939598_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	38.6	2.5e-39
WP_015757387.1|1939611_1940637_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_015757388.1|1940636_1941437_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_042316953.1|1941821_1941941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042316955.1|1943723_1944938_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_015757391.1|1946601_1947348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757392.1|1947360_1948458_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_015756032.1|1949042_1950755_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	1955156	2014273	4545624	transposase,tail,integrase	Bacillus_phage(33.33%)	53	1939814:1939829	1970880:1970895
1939814:1939829	attL	TGGCTTTTATTGATGA	NA	NA	NA	NA
WP_015757397.1|1955156_1956971_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015757398.1|1957698_1957845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757401.1|1960095_1960509_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015757402.1|1960662_1961775_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	35.3	1.3e-38
WP_083773403.1|1962824_1963166_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_015757404.1|1963168_1964569_+|tail	phage tail protein	tail	A0A0N9SIL8	Paenibacillus_phage	40.3	2.2e-64
WP_015757405.1|1964579_1965833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757406.1|1965845_1966658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015756644.1|1966684_1967818_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_015757407.1|1967940_1970730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757408.1|1970767_1971001_+	hypothetical protein	NA	NA	NA	NA	NA
1970880:1970895	attR	TGGCTTTTATTGATGA	NA	NA	NA	NA
WP_015757409.1|1970993_1971620_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	50.0	2.1e-46
WP_015757410.1|1971669_1971894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757411.1|1972008_1972653_+	hypothetical protein	NA	A0A0E3T7R5	Bacillus_phage	51.6	1.6e-25
WP_015757412.1|1973207_1974341_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_174260362.1|1974367_1974676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757413.1|1974688_1975111_-	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_015757414.1|1975453_1975909_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015755906.1|1976044_1977727_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015757415.1|1977926_1978349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757417.1|1978469_1979117_+	ATP-binding protein	NA	A0A142F1P9	Bacillus_phage	32.2	1.4e-21
WP_015757418.1|1979109_1980369_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015757419.1|1980400_1981219_+	prophage antirepressor	NA	A0A290FZK7	Caldibacillus_phage	37.7	6.1e-30
WP_015757420.1|1981211_1982162_+	toprim domain-containing protein	NA	A0A0N9S7Y2	Paenibacillus_phage	41.4	4.6e-61
WP_015757421.1|1982158_1982890_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_157862893.1|1982902_1984234_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_015757423.1|1984560_1985121_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015757424.1|1985188_1985878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042316979.1|1985994_1988232_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	43.3	5.0e-143
WP_015757426.1|1988215_1989115_+	phage antirepressor KilAC domain-containing protein	NA	M4ZRI7	Bacillus_phage	37.6	4.1e-35
WP_015757427.1|1989118_1990021_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	40.0	4.5e-42
WP_015757428.1|1990020_1990371_+	Holliday junction DNA helicase	NA	NA	NA	NA	NA
WP_015757429.1|1990390_1990858_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015757430.1|1990835_1992740_+	anaerobic ribonucleoside-triphosphate reductase	NA	H7BUX6	unidentified_phage	27.8	1.6e-65
WP_042316984.1|1992798_1993308_+	dUTP diphosphatase	NA	A0A142CJG3	Brazilian_marseillevirus	46.7	1.8e-27
WP_015757433.1|1993407_1994136_+	cell wall hydrolase	NA	A0A172JHR8	Bacillus_phage	37.6	2.6e-32
WP_015757434.1|1994159_1994813_+	FAD-dependent thymidylate synthase	NA	K9MCR9	Sulfolobus_virus	32.4	4.2e-13
WP_015757435.1|1994855_1995314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757436.1|1995531_1995804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757437.1|1995751_1996270_+	hypothetical protein	NA	A0A0N9SJZ0	Paenibacillus_phage	46.5	2.4e-32
WP_015757438.1|1996270_1996639_+	RNA polymerase subunit sigma-28	NA	NA	NA	NA	NA
WP_015757439.1|1996625_1997000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052292923.1|1997001_1997331_+	hypothetical protein	NA	A0A0K2CZE3	Paenibacillus_phage	54.9	1.6e-18
WP_052292924.1|1997320_1997977_+	phage antirepressor KilAC domain-containing protein	NA	A0A1P8CWY0	Bacillus_phage	38.3	3.1e-16
WP_015757441.1|2000787_2001588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757442.1|2003099_2003846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157862895.1|2004164_2004434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042315621.1|2005825_2006260_+	recombinase family protein	NA	A0A1S5RFV4	Helicobacter_phage	34.9	7.8e-08
WP_015757445.1|2006216_2007674_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_015757446.1|2007938_2008799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757447.1|2009032_2010835_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_083773405.1|2010962_2011094_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015756644.1|2013139_2014273_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	2325598	2386951	4545624	transposase,tail,integrase	Paenibacillus_phage(22.22%)	57	2367105:2367121	2394717:2394733
WP_015757680.1|2325598_2326057_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_015757681.1|2326068_2326257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757682.1|2326355_2326811_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174260363.1|2326862_2327243_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	63.9	1.5e-39
WP_083773422.1|2327320_2327605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157863091.1|2327741_2327963_+	helix-turn-helix domain-containing protein	NA	A0A2I7SC34	Paenibacillus_phage	45.3	1.4e-10
WP_015757684.1|2327949_2328276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757686.1|2328769_2329261_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_174260364.1|2329302_2329446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757687.1|2329763_2330369_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015757688.1|2330553_2332029_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.9	3.8e-46
WP_157862917.1|2332558_2332753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757690.1|2333547_2334741_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_015757691.1|2334787_2335213_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015757692.1|2335362_2335842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042315698.1|2336310_2336865_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_015757693.1|2337029_2337767_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015757695.1|2338129_2338363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757696.1|2338400_2338868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162013535.1|2338792_2339206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757697.1|2339423_2340035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757698.1|2340163_2340658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757699.1|2340650_2341184_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_015757700.1|2341436_2342729_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_015757701.1|2342719_2343064_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042317119.1|2343704_2343947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013536.1|2344371_2346108_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_015757703.1|2347039_2347441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757705.1|2347626_2350395_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.8	4.8e-42
WP_015757707.1|2351768_2352326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157863092.1|2352533_2353469_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	37.9	4.4e-08
WP_083773423.1|2353564_2353693_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015757709.1|2353757_2354021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757711.1|2356393_2356729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757712.1|2356825_2357014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157862919.1|2357132_2357489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757714.1|2357997_2360418_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.4	1.1e-13
WP_015757715.1|2360982_2361588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757716.1|2362757_2363984_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	37.2	7.7e-53
WP_015757718.1|2364858_2366139_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	60.9	1.3e-138
WP_015757719.1|2366158_2367679_-	dynamin family protein	NA	NA	NA	NA	NA
2367105:2367121	attL	TTTTCCTTCATTAAAAA	NA	NA	NA	NA
WP_015757720.1|2368050_2368998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757721.1|2370760_2372164_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	38.4	1.5e-84
WP_157863093.1|2373191_2374625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757725.1|2374930_2375659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757726.1|2375665_2375845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757727.1|2376063_2376378_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015757728.1|2376364_2376637_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_015757729.1|2376823_2377087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757730.1|2377424_2377748_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015757731.1|2377750_2377999_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_083773424.1|2378222_2378495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757733.1|2379542_2380676_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042317125.1|2381209_2381695_+	rubrerythrin	NA	NA	NA	NA	NA
WP_015757736.1|2382790_2384044_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015757737.1|2384043_2385909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015757738.1|2385901_2386951_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2394717:2394733	attR	TTTTTAATGAAGGAAAA	NA	NA	NA	NA
>prophage 12
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	2391921	2449701	4545624	tRNA,transposase,integrase	Streptococcus_phage(15.38%)	54	2412403:2412462	2416472:2416551
WP_015756115.1|2391921_2393736_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015757744.1|2393874_2395074_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	42.8	1.5e-85
WP_015757745.1|2395100_2395847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757746.1|2396739_2397837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757747.1|2397994_2398504_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXC6	Streptococcus_phage	39.9	2.1e-20
WP_015757748.1|2398685_2398934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757018.1|2399124_2400807_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015757749.1|2400959_2402111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757750.1|2402127_2403285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757751.1|2403787_2405107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757752.1|2405096_2406854_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	26.3	4.9e-16
WP_015757753.1|2407185_2408478_-	recombinase family protein	NA	E4ZFN9	Streptococcus_phage	54.6	1.1e-131
WP_015757755.1|2411216_2412104_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_042315718.1|2412103_2412283_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
2412403:2412462	attL	TTATCCTCAACATTAGAAAATCCTCAGGATTGTATGAAAGTAGCTTAAATCAAGGATATA	NA	NA	NA	NA
WP_015757756.1|2412485_2413523_-|integrase	tyrosine-type recombinase/integrase	integrase	U5Q1D8	Bacillus_phage	25.2	5.6e-12
WP_015757757.1|2413512_2414487_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015757758.1|2414483_2416388_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_042315721.1|2416483_2417827_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
2416472:2416551	attR	TATATCCTTGATTTAAGCTACTTTCATACAATCCTGAGGATTTTCTAATGTTGAGGATAAGGCCAAGTTGTTATCCATTG	NA	NA	NA	NA
WP_157862923.1|2417997_2418570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757761.1|2418490_2419021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757762.1|2419013_2419769_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_015757763.1|2419761_2420112_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015757764.1|2420234_2421611_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	35.8	7.3e-84
WP_015757765.1|2421653_2422076_-	YaaR family protein	NA	NA	NA	NA	NA
WP_015757766.1|2422585_2424193_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_015757767.1|2424210_2425047_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_015757768.1|2425074_2426145_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_015757769.1|2426156_2426666_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_015757770.1|2426693_2427323_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_015757771.1|2427408_2427726_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	50.0	1.9e-19
WP_015757772.1|2427795_2427981_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015757773.1|2428003_2428177_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015757774.1|2428295_2429063_-	helix-turn-helix transcriptional regulator	NA	A0A0R8VBU2	Thermobifida_phage	50.8	4.0e-07
WP_083773530.1|2429133_2430720_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_015757776.1|2430888_2432103_-	U32 family peptidase	NA	Q6DW11	Phage_TP	34.7	2.9e-52
WP_015757777.1|2432117_2433152_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_015757778.1|2433413_2434775_-	VanW family protein	NA	NA	NA	NA	NA
WP_015757779.1|2434963_2435269_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_015757780.1|2435345_2435765_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_042317135.1|2435781_2436723_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015757782.1|2436758_2437022_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_015757783.1|2437091_2439728_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.7	5.9e-74
WP_015757784.1|2440001_2440184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757785.1|2440208_2440382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757786.1|2440500_2441145_+	DUF2250 domain-containing protein	NA	NA	NA	NA	NA
WP_015757787.1|2441219_2442308_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015757788.1|2442317_2442692_-	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	55.6	1.5e-31
WP_015757789.1|2442684_2443893_-	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	29.8	4.6e-42
WP_015757790.1|2443928_2444357_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_015757791.1|2444592_2444883_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_042317141.1|2444991_2445324_-	thioredoxin	NA	A0A218MMB7	uncultured_virus	34.3	6.6e-07
WP_015757793.1|2445440_2446175_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_015757794.1|2446587_2448414_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015757795.1|2448441_2449701_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 13
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	2592686	2602214	4545624	integrase	Bacillus_phage(42.86%)	10	2594588:2594600	2601172:2601184
WP_157863100.1|2592686_2595347_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.0	1.6e-55
2594588:2594600	attL	ACCAATTAGATTA	NA	NA	NA	NA
WP_015757928.1|2595359_2596187_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	28.3	5.4e-26
WP_015757929.1|2596275_2596929_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_042317164.1|2597038_2597638_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_015757931.1|2597704_2598286_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	39.9	2.8e-13
WP_015757932.1|2598568_2599576_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	35.4	6.3e-53
WP_015757933.1|2599569_2600541_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	36.6	5.9e-48
WP_015757934.1|2600580_2601438_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	32.6	3.3e-10
2601172:2601184	attR	ACCAATTAGATTA	NA	NA	NA	NA
WP_052292940.1|2601434_2601776_-	ParA family protein	NA	NA	NA	NA	NA
WP_052292941.1|2601794_2602214_-	ParA family protein	NA	Q8JL10	Natrialba_phage	38.6	3.4e-16
>prophage 14
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	2638122	2677533	4545624	protease,transposase	Geobacillus_virus(25.0%)	42	NA	NA
WP_015756644.1|2638122_2639256_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042315766.1|2639283_2639604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757981.1|2639640_2639823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757983.1|2639963_2640449_-	macro domain-containing protein	NA	A0A0H3V0V8	Geobacillus_virus	39.4	5.8e-20
WP_015757984.1|2640518_2640884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157862937.1|2640861_2642325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157862938.1|2642422_2642875_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_015757987.1|2642816_2643350_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_015757988.1|2643327_2643510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757989.1|2643528_2643720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757990.1|2643804_2643996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757991.1|2644080_2644263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757992.1|2644288_2644432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757993.1|2644455_2645340_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_015757994.1|2645353_2646274_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_083773535.1|2646276_2647470_-	CpaF family protein	NA	NA	NA	NA	NA
WP_042315769.1|2647678_2648044_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_015757996.1|2648044_2649295_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015757997.1|2649302_2650046_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_157862940.1|2650059_2650428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015757999.1|2650678_2651101_-	Tad domain-containing protein	NA	NA	NA	NA	NA
WP_015758000.1|2651935_2652532_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015758001.1|2652572_2654933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758002.1|2654933_2655896_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015756467.1|2656441_2657668_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	37.5	1.6e-53
WP_015758003.1|2658640_2659051_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015758004.1|2659034_2659307_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015756162.1|2659825_2661586_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_083773433.1|2661888_2662533_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_015758006.1|2662607_2664542_-	chromosome partitioning ATPase-like protein	NA	NA	NA	NA	NA
WP_015758007.1|2664566_2665439_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	49.5	2.2e-17
WP_015758008.1|2666832_2667558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758009.1|2667557_2669003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758010.1|2668995_2671374_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015758011.1|2671374_2671752_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_015758012.1|2671801_2672092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758013.1|2672107_2673019_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_042315782.1|2673018_2673450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756644.1|2673598_2674732_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042315785.1|2674759_2675410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042315787.1|2675442_2675835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758015.1|2676129_2677533_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	39.1	3.2e-87
>prophage 15
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	3061743	3086483	4545624	protease,transposase,tail,integrase	Bacteriophage(33.33%)	19	3074134:3074150	3097270:3097286
WP_015758338.1|3061743_3063066_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.0	3.5e-59
WP_015758339.1|3063379_3063859_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_015758340.1|3064025_3064991_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015758341.1|3065035_3065281_+|tail	tail fiber protein	tail	C4MYW8	Escherichia_phage	48.2	8.2e-07
WP_015758342.1|3065302_3065557_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_015758343.1|3065747_3065990_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_015758344.1|3066031_3067102_+	cadherin-like beta sandwich domain-containing protein	NA	NA	NA	NA	NA
WP_015758345.1|3067134_3072153_+	cadherin-like beta sandwich domain-containing protein	NA	NA	NA	NA	NA
WP_052292952.1|3072337_3073123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015758348.1|3073119_3073383_+	PqqD family protein	NA	NA	NA	NA	NA
WP_157862967.1|3073375_3073822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015758350.1|3073845_3075039_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
3074134:3074150	attL	GAAAAGGGAATTGTCAG	NA	NA	NA	NA
WP_015758351.1|3075530_3076550_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	48.6	4.6e-27
WP_015758352.1|3076563_3076815_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_083773454.1|3078552_3078747_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_042315880.1|3078861_3079095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758354.1|3079240_3079693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758355.1|3079668_3083484_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_015758356.1|3083819_3086483_+|protease	protease complex subunit PrcB family protein	protease	NA	NA	NA	NA
3097270:3097286	attR	CTGACAATTCCCTTTTC	NA	NA	NA	NA
>prophage 16
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	3533341	3598792	4545624	tRNA,protease,transposase	uncultured_virus(16.67%)	57	NA	NA
WP_015758750.1|3533341_3534214_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_015758751.1|3534226_3534997_-	M23 family metallopeptidase	NA	S5VY01	Leptospira_phage	37.6	1.6e-08
WP_015758752.1|3535064_3535727_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_015758753.1|3535812_3536955_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_015758754.1|3537108_3537384_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_015758755.1|3537426_3538221_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_042317372.1|3538257_3538647_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_015758757.1|3538871_3540857_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_015758758.1|3540874_3541375_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_042316015.1|3541371_3542238_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_015758760.1|3542259_3543291_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_042317374.1|3543332_3543992_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_015758762.1|3544048_3544624_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_015758763.1|3544640_3544898_-	DUF4321 domain-containing protein	NA	NA	NA	NA	NA
WP_015758764.1|3545016_3545475_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	38.9	6.2e-24
WP_015758765.1|3545544_3546552_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_015758766.1|3546999_3548289_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_015758767.1|3549287_3549431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015758768.1|3549488_3552134_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.1	1.4e-176
WP_015758769.1|3552439_3552886_-	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_015758770.1|3553015_3554110_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042317375.1|3554180_3554684_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015758772.1|3554984_3555590_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_015758773.1|3555586_3558007_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	9.2e-175
WP_015758774.1|3558269_3559997_-|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	25.2	6.7e-10
WP_015758775.1|3560106_3561357_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.0	1.1e-147
WP_015758776.1|3561580_3562888_-	trigger factor	NA	NA	NA	NA	NA
WP_015758777.1|3563540_3564167_-	cell wall hydrolase	NA	A0A0E3XAL9	Bacillus_phage	39.1	2.4e-26
WP_015758778.1|3564302_3564551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758779.1|3564625_3566437_+	adenine deaminase	NA	NA	NA	NA	NA
WP_015758780.1|3566547_3567639_-	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_015758781.1|3567641_3568526_-	RNA polymerase sigma-I factor	NA	NA	NA	NA	NA
WP_015758782.1|3568675_3570769_-	beta-propeller domain-containing protein	NA	NA	NA	NA	NA
WP_015758783.1|3570894_3571479_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_015758784.1|3571494_3572409_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	1.1e-75
WP_015758785.1|3572497_3573580_-	endospore germination permease	NA	NA	NA	NA	NA
WP_015758786.1|3573831_3575391_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	66.2	4.9e-12
WP_015758787.1|3575905_3576175_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_015758788.1|3576266_3576518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157862990.1|3576901_3577075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758791.1|3577432_3578674_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_015758792.1|3579079_3580720_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.1	3.6e-162
WP_015758793.1|3580779_3581064_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	44.6	2.7e-17
WP_015758794.1|3581452_3582235_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_042316027.1|3582312_3583383_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_157863128.1|3583366_3584584_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
WP_015758797.1|3584954_3586484_+	coproporphyrinogen dehydrogenase HemZ	NA	NA	NA	NA	NA
WP_015758798.1|3586995_3589839_+	CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein	NA	NA	NA	NA	NA
WP_015758799.1|3590006_3590180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015758800.1|3590216_3590945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015758802.1|3591922_3592222_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157863129.1|3592485_3592884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015758804.1|3592992_3594315_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.0	5.9e-59
WP_157862991.1|3595124_3595331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015758806.1|3595284_3595839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042316038.1|3597246_3597669_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157862992.1|3597886_3598792_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	3849480	3868136	4545624	transposase,capsid,integrase	Brevibacillus_phage(33.33%)	32	3849232:3849276	3869561:3869605
3849232:3849276	attL	TGGAGCTGATGGAGGGAATTGAACCCTCGACCTACGCATTACGAG	NA	NA	NA	NA
WP_015759058.1|3849480_3850650_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	39.2	1.7e-81
WP_015759059.1|3850649_3851606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759060.1|3851747_3851948_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015759061.1|3851948_3852215_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015759062.1|3852267_3853281_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_015759063.1|3853404_3853980_+	hypothetical protein	NA	Q0H230	Geobacillus_phage	34.0	1.3e-07
WP_015759064.1|3853976_3854471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759065.1|3854759_3855002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759066.1|3855032_3855191_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_157863134.1|3855413_3855602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759068.1|3855705_3856299_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_015759069.1|3856301_3856670_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_015759070.1|3856788_3856944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759071.1|3856955_3857159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759072.1|3857171_3857411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759073.1|3857556_3857838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759074.1|3857854_3858148_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015759075.1|3858163_3858424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759076.1|3858450_3858651_-	helix-turn-helix transcriptional regulator	NA	S5M9U8	Brevibacillus_phage	48.4	1.0e-07
WP_042316192.1|3858810_3859122_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	42.5	2.1e-07
WP_015756467.1|3859457_3860684_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	37.5	1.6e-53
WP_015759078.1|3861512_3861791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759079.1|3861825_3861984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759080.1|3861989_3862262_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015759081.1|3862442_3862844_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015759082.1|3862866_3863025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759083.1|3863021_3863492_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015759084.1|3863525_3863879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169306038.1|3864308_3864641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759086.1|3864752_3865865_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	36.3	1.5e-47
WP_015759087.1|3865939_3867178_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015759088.1|3867170_3868136_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3869561:3869605	attR	TGGAGCTGATGGAGGGAATTGAACCCTCGACCTACGCATTACGAG	NA	NA	NA	NA
>prophage 18
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	3967513	4038690	4545624	tRNA,transposase	Thermus_phage(21.43%)	54	NA	NA
WP_015759182.1|3967513_3969211_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	58.2	9.6e-187
WP_015759183.1|3969588_3970161_+	HPP family protein	NA	NA	NA	NA	NA
WP_015759184.1|3970176_3970416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759185.1|3970620_3970944_+	DUF1992 domain-containing protein	NA	NA	NA	NA	NA
WP_015759186.1|3970945_3971752_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015759187.1|3971860_3972832_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.5e-22
WP_015759188.1|3973628_3973841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759189.1|3974203_3975397_-	CZB domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.4	2.9e-12
WP_083773496.1|3976092_3976353_-	signal peptidase I	NA	NA	NA	NA	NA
WP_042316215.1|3976349_3977552_-	RNA-splicing ligase RtcB	NA	A0A223LGY9	Bacillus_phage	57.0	1.1e-123
WP_015759191.1|3977969_3978572_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_015759192.1|3978830_3979922_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	37.8	8.4e-59
WP_015759193.1|3979927_3980332_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.7	1.1e-51
WP_083773497.1|3980533_3980806_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015756151.1|3980927_3982742_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_042316217.1|3983045_3983300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759196.1|3984402_3985383_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_162013543.1|3985407_3988098_-	DEAD/DEAH box helicase	NA	A0A2K9L021	Tupanvirus	23.4	1.1e-06
WP_015759198.1|3988724_3990374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759200.1|3996786_3997878_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	36.1	1.9e-55
WP_015759202.1|3998282_3998711_+	universal stress protein	NA	NA	NA	NA	NA
WP_157863140.1|3998967_3999873_+	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_042317457.1|3999992_4000748_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	5.9e-11
WP_015759205.1|4000725_4001514_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.3	1.2e-11
WP_015759206.1|4001554_4002541_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_042317458.1|4002567_4003404_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015759208.1|4003487_4004672_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015759209.1|4005557_4006742_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015759210.1|4006881_4007565_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_042317459.1|4007604_4008789_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_015759212.1|4008865_4010968_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_015759213.1|4011061_4011634_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015759214.1|4011928_4012984_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_015759215.1|4013121_4014999_-	iron hydrogenase small subunit	NA	NA	NA	NA	NA
WP_015759216.1|4014958_4016992_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015759217.1|4016975_4017644_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_015759218.1|4017852_4018317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759219.1|4018493_4019588_+	hypothetical protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	22.3	4.4e-07
WP_015759220.1|4019724_4022451_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_015759221.1|4022661_4023330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759222.1|4023451_4023838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759223.1|4024136_4024397_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_015759224.1|4024412_4025201_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_015759225.1|4025197_4026586_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_015759226.1|4026825_4028181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759227.1|4028173_4028905_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157863013.1|4028958_4029210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759229.1|4029514_4030642_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_083773499.1|4030769_4033496_-	pyruvate, phosphate dikinase	NA	A0A1V0SGR7	Hokovirus	33.7	1.5e-35
WP_015759231.1|4033502_4034132_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042317465.1|4034373_4035303_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015759233.1|4035975_4036413_+	universal stress protein	NA	NA	NA	NA	NA
WP_015758955.1|4037188_4038280_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	37.5	3.2e-58
WP_015756076.1|4038285_4038690_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.0	5.3e-51
>prophage 19
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	4042709	4092138	4545624	portal,terminase,transposase,integrase	Paenibacillus_phage(31.82%)	54	4066433:4066492	4098152:4098215
WP_015756032.1|4042709_4044422_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_042316228.1|4044527_4044719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042317466.1|4044909_4046298_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.5	1.5e-113
WP_157863014.1|4048485_4049754_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_157863015.1|4050199_4050481_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052292971.1|4050509_4050857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157863016.1|4051132_4051381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759242.1|4052168_4052330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759243.1|4052374_4052728_-	DUF2680 domain-containing protein	NA	NA	NA	NA	NA
WP_015759244.1|4052901_4053102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162013544.1|4053320_4053518_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162013545.1|4053537_4053738_-	hypothetical protein	NA	S5MNM1	Brevibacillus_phage	59.1	1.0e-15
WP_015759246.1|4053840_4054188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759247.1|4054493_4054739_+	toxin HicA	NA	NA	NA	NA	NA
WP_015759248.1|4054731_4055097_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	51.3	3.8e-24
WP_042316237.1|4055856_4056330_+	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_042316239.1|4056372_4056648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759249.1|4056958_4057123_-	hypothetical protein	NA	A0A2H4J2N9	uncultured_Caudovirales_phage	61.8	2.6e-09
WP_015759250.1|4057262_4058414_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6WBJ9	Vibrio_phage	32.7	3.0e-06
WP_042316241.1|4058418_4058922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759252.1|4059859_4060270_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A0H3V0P8	Geobacillus_virus	43.5	2.8e-23
WP_042316242.1|4062498_4063359_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.3	2.2e-70
WP_015759256.1|4063458_4063629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759257.1|4063661_4064126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759258.1|4064122_4064893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157863141.1|4064952_4065543_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	47.9	3.0e-26
WP_015759260.1|4065621_4066254_-	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
4066433:4066492	attL	TTGGTGGAGGCGGGGGGAGTCGAACCCACCGTCCGAAAGAACGACCACAAGAGTATCTCC	NA	NA	NA	NA
WP_015759261.1|4066831_4067320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759263.1|4067476_4067869_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	39.5	4.4e-10
WP_015759264.1|4067837_4068227_-	RNA polymerase subunit sigma-28	NA	NA	NA	NA	NA
WP_157863017.1|4068177_4068804_-	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	43.0	1.1e-31
WP_015759267.1|4068980_4069514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759268.1|4069657_4069879_+	helix-turn-helix transcriptional regulator	NA	A0A076G7N2	Bacillus_phage	56.5	7.7e-12
WP_015759269.1|4069964_4070474_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015759270.1|4070508_4071159_-	FAD-dependent thymidylate synthase	NA	Q684F8	Sulfolobus_virus	31.4	3.5e-12
WP_157863142.1|4071178_4071691_-	cell wall hydrolase	NA	U5PWL4	Bacillus_phage	50.9	5.3e-24
WP_015758390.1|4071710_4073474_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_042316249.1|4073637_4073901_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015759273.1|4074006_4074498_-	dUTP diphosphatase	NA	A0A1S5XYX0	Kurlavirus	47.6	7.6e-28
WP_015759275.1|4076966_4077323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759276.1|4077317_4078202_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	35.8	3.1e-43
WP_015759277.1|4078201_4079668_-|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	59.7	1.7e-152
WP_157863143.1|4079708_4081418_-|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	51.6	1.7e-146
WP_015759279.1|4081557_4082001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759280.1|4081978_4082470_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	36.8	3.7e-22
WP_015759281.1|4082564_4083023_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_042316253.1|4083138_4083414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759283.1|4083487_4084351_-	amidoligase family protein	NA	A0A218KCI6	Bacillus_phage	37.8	6.2e-41
WP_042317473.1|4084497_4085859_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	44.9	1.0e-42
WP_015759285.1|4085978_4086476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759286.1|4086581_4087469_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	33.0	8.4e-41
WP_157863144.1|4087596_4088001_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015759288.1|4089710_4090940_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_015759289.1|4091088_4092138_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	24.1	1.1e-10
4098152:4098215	attR	TTGGTGGAGGCGGGGGGAGTCGAACCCACCGTCCGAAAGAACGACCACAAGAGTATCTCCGAGC	NA	NA	NA	NA
>prophage 20
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	4192318	4263172	4545624	protease,transposase	Tupanvirus(30.0%)	71	NA	NA
WP_042316275.1|4192318_4192531_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015759370.1|4192908_4193094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042316278.1|4193280_4193487_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_015759371.1|4193741_4193948_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015759372.1|4194167_4194392_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_015759373.1|4194451_4194673_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_015759374.1|4194791_4194983_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_015759376.1|4195438_4196437_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_157863149.1|4196544_4196745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759377.1|4197018_4197231_-	YgiT-type zinc finger protein	NA	NA	NA	NA	NA
WP_015759378.1|4197302_4197599_-	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_157863020.1|4198097_4198433_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_015759379.1|4199954_4201202_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	1.3e-31
WP_015759380.1|4201268_4201409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759383.1|4203380_4203665_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	37.5	1.2e-06
WP_015759384.1|4203657_4204023_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_157863021.1|4204167_4204287_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_015759385.1|4204436_4204685_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015759387.1|4205186_4206209_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_015759388.1|4206350_4208597_-	YifB family Mg chelatase-like AAA ATPase	NA	S6BFL3	Thermus_phage	33.3	1.7e-21
WP_042316282.1|4208623_4209193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015759389.1|4209850_4210015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157863150.1|4211011_4211329_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_157863022.1|4211480_4211735_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_052292977.1|4212960_4213605_-	maturase	NA	NA	NA	NA	NA
WP_083773546.1|4213886_4214564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015756032.1|4215284_4216997_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_042316287.1|4217903_4218536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759394.1|4218971_4219235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759395.1|4219231_4219606_+|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_015759389.1|4220466_4220631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759397.1|4221440_4221929_-	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_015759398.1|4221912_4222209_-	UPF0175 family protein	NA	NA	NA	NA	NA
WP_015759399.1|4222683_4222974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042316291.1|4223050_4223230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759400.1|4224402_4224888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052292978.1|4225157_4225349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759403.1|4225955_4226180_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_015759404.1|4226845_4227241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759405.1|4227243_4227540_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_157863151.1|4227690_4227924_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015759407.1|4227965_4228361_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_015759408.1|4229392_4230391_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_015759409.1|4230548_4230998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759410.1|4231352_4232366_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	53.2	2.2e-98
WP_015759411.1|4233052_4233520_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_015759389.1|4233528_4233693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759412.1|4236190_4236589_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_015759413.1|4236555_4236888_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015759414.1|4237104_4237428_-	UPF0175 family protein	NA	NA	NA	NA	NA
WP_157863023.1|4237531_4238002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759416.1|4238038_4238974_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015759417.1|4238966_4239287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759418.1|4240186_4241209_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_087943748.1|4241350_4242451_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	33.8	9.7e-23
WP_015759420.1|4242456_4244001_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_042316293.1|4244027_4244597_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157863024.1|4245525_4245765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759422.1|4246388_4246541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015759423.1|4247240_4248617_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	42.2	5.7e-89
WP_015759424.1|4248873_4250379_-	copper amine oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_015759425.1|4250608_4252447_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	26.4	7.1e-26
WP_015759427.1|4252804_4253818_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	52.6	3.8e-98
WP_015759428.1|4254004_4255381_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	43.1	3.4e-89
WP_015759429.1|4255648_4256443_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015759430.1|4256461_4257100_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	41.5	2.9e-27
WP_015759432.1|4257721_4257985_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_157863025.1|4258045_4258576_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052292979.1|4258569_4259358_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015759434.1|4259911_4261204_-	flippase	NA	NA	NA	NA	NA
WP_083773509.1|4262887_4263172_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	4351655	4359673	4545624		Catovirus(16.67%)	10	NA	NA
WP_015759512.1|4351655_4352810_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.6	5.8e-26
WP_015759513.1|4353038_4353350_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_015759514.1|4353484_4353949_-	ComE operon protein 2	NA	A0A0N9QQ67	Chrysochromulina_ericina_virus	48.5	1.3e-29
WP_015759515.1|4353964_4355206_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.8	2.3e-97
WP_015759516.1|4355233_4355683_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_015759517.1|4355783_4356254_-	low molecular weight protein arginine phosphatase	NA	A0A2H4PQT9	Staphylococcus_phage	36.9	2.7e-06
WP_015759518.1|4356275_4356821_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_042316325.1|4356941_4357979_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	36.9	1.5e-44
WP_015759520.1|4358025_4358883_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_015759521.1|4358920_4359673_-	metal ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.0	5.1e-15
>prophage 22
NC_013216	Desulfofarcimen acetoxidans DSM 771, complete sequence	4545624	4389056	4427894	4545624	terminase,transposase,plate,tail,portal	Bacillus_phage(65.52%)	49	NA	NA
WP_015759551.1|4389056_4391054_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0N7ACC7	Bacillus_phage	44.3	8.2e-145
WP_015759552.1|4391066_4391225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759553.1|4391249_4392182_+	AAA family ATPase	NA	A0A0N7ACA6	Bacillus_phage	47.2	1.1e-67
WP_015759554.1|4392368_4392881_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_015759555.1|4392911_4393343_+	hypothetical protein	NA	A0A0M4U437	Ralstonia_phage	36.9	5.9e-16
WP_015759556.1|4393433_4393718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157863030.1|4393764_4394154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759557.1|4394062_4394848_+	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	37.9	6.5e-21
WP_015759558.1|4394875_4395217_+	Mor transcription activator domain-containing protein	NA	NA	NA	NA	NA
WP_015759559.1|4395322_4395772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759560.1|4395815_4396142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759561.1|4396141_4396483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759562.1|4396495_4397080_+	DUF3486 family protein	NA	A0A2H4JAV3	uncultured_Caudovirales_phage	30.7	8.8e-15
WP_015759563.1|4397064_4397559_+	antiterminator LoaP	NA	NA	NA	NA	NA
WP_042316336.1|4397860_4398439_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	44.6	1.6e-32
WP_015759565.1|4398481_4400266_+|terminase	phage terminase large subunit	terminase	A0A2H4JE58	uncultured_Caudovirales_phage	58.8	8.3e-189
WP_015759566.1|4400271_4401798_+|portal	phage portal protein	portal	A0A0A8WI73	Clostridium_phage	56.2	1.1e-157
WP_015759567.1|4401797_4403669_+	hypothetical protein	NA	A0A0N7ACI5	Bacillus_phage	43.6	4.2e-74
WP_015759568.1|4403665_4403980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042317552.1|4404120_4405206_+	hypothetical protein	NA	A0A0N7ACY8	Bacillus_phage	48.2	5.2e-93
WP_015759570.1|4405202_4405391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759571.1|4405404_4405827_+	DUF2190 family protein	NA	A0A0N7ACR5	Bacillus_phage	40.3	1.2e-16
WP_015759572.1|4405842_4406889_+	hypothetical protein	NA	A0A0N7ACJ3	Bacillus_phage	39.9	4.1e-63
WP_015759573.1|4406913_4407273_+	hypothetical protein	NA	A0A0N7ACH0	Bacillus_phage	54.1	1.1e-26
WP_015759574.1|4407272_4407656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759575.1|4407683_4408115_+	hypothetical protein	NA	A0A0N7ACC6	Bacillus_phage	51.8	4.5e-40
WP_015759576.1|4408118_4408961_+	hypothetical protein	NA	A0A0N7ACG6	Bacillus_phage	45.2	1.2e-68
WP_015759577.1|4408972_4409188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759578.1|4409189_4410638_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0N7AEC6	Bacillus_phage	42.9	1.8e-101
WP_015759579.1|4410653_4411112_+|tail	phage tail tube protein	tail	A0A0N7ACS0	Bacillus_phage	50.4	8.1e-32
WP_015759580.1|4411118_4411523_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	46.2	1.1e-27
WP_015759581.1|4411537_4411696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759582.1|4411688_4416125_+|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	39.9	5.6e-61
WP_015759583.1|4416136_4416790_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	52.0	2.9e-51
WP_015759584.1|4416786_4417785_+	hypothetical protein	NA	A0A0N6W8H4	Bacillus_phage	57.3	5.2e-108
WP_015759585.1|4417768_4418185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759586.1|4418177_4418636_+	DUF2634 domain-containing protein	NA	A0A0N7ACH4	Bacillus_phage	38.4	6.9e-23
WP_015759587.1|4418635_4419766_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	34.5	4.2e-45
WP_015759588.1|4419762_4420704_+	DUF2313 domain-containing protein	NA	A0A0N7AED0	Bacillus_phage	31.4	1.1e-11
WP_015759589.1|4420703_4420958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759590.1|4420957_4421257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759591.1|4421260_4421770_+	hypothetical protein	NA	A0A2K9VGY9	Faecalibacterium_phage	43.9	9.4e-05
WP_015759592.1|4421782_4422160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015759593.1|4422159_4423152_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	H7BVP1	unidentified_phage	37.5	5.3e-52
WP_015759594.1|4423220_4423562_+	diversity-generating retroelement protein Avd	NA	A0A0N7ACE0	Bacillus_phage	59.6	4.3e-30
WP_015759595.1|4423879_4424989_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	51.5	2.4e-106
WP_015759596.1|4424985_4425144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174260369.1|4425224_4426073_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_015759599.1|4426310_4427894_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.1	1.5e-85
