The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013223	Desulfohalobium retbaense DSM 5692, complete sequence	2864304	423781	487504	2864304	transposase	Burkholderia_virus(22.22%)	50	NA	NA
WP_015750802.1|423781_425008_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.9	1.7e-20
WP_015750803.1|425125_427225_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	2.0e-08
WP_015750804.1|427905_428847_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015750805.1|428953_429826_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_015750806.1|429870_430854_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015750807.1|430837_431317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052293252.1|431345_432254_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_015750809.1|432647_433547_+	EamA family transporter	NA	NA	NA	NA	NA
WP_015750810.1|433941_436221_-	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_015750811.1|436505_437267_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015750812.1|437517_438366_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_148213992.1|438512_439877_-	radical SAM protein	NA	NA	NA	NA	NA
WP_015750815.1|440737_441997_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_015750816.1|442578_443475_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015750817.1|443797_445909_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_015750818.1|446019_446910_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_015750819.1|447157_447475_+	MarR family EPS-associated transcriptional regulator	NA	NA	NA	NA	NA
WP_015750822.1|449375_450194_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_083777058.1|450988_451249_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_015750825.1|451245_451437_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_015750828.1|452184_453645_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	2.9e-54
WP_015750829.1|454037_454580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041281824.1|454689_455058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148213994.1|455118_456078_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9KZK0	Tupanvirus	48.8	1.1e-86
WP_083777061.1|456096_456579_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015750832.1|457123_458524_-|transposase	ISKra4-like element ISDere1 family transposase	transposase	NA	NA	NA	NA
WP_015750833.1|458626_459853_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	27.1	6.0e-21
WP_015750835.1|461070_461553_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083777063.1|461549_462596_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	29.4	3.4e-09
WP_015750837.1|462977_464114_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015750838.1|464314_465361_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015750839.1|465366_466428_+	sulfotransferase	NA	NA	NA	NA	NA
WP_015750840.1|466477_467653_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015750841.1|467615_468533_+	sulfotransferase	NA	NA	NA	NA	NA
WP_015750842.1|468529_469933_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_167317781.1|470262_471318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015750844.1|471335_472514_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_083777250.1|472560_473226_+	NAD-dependent epimerase/dehydratase family protein	NA	Q58M85	Prochlorococcus_phage	32.4	9.1e-24
WP_015750845.1|473304_474609_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_015750846.1|474598_475999_+	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_015750847.1|475995_478161_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_041281831.1|478269_478605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015750849.1|478588_478996_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J1D2	uncultured_Caudovirales_phage	48.4	3.1e-06
WP_041281832.1|478973_479405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041282162.1|479427_481080_+	heparinase	NA	NA	NA	NA	NA
WP_015750852.1|481076_482288_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_153304096.1|482284_482434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015750853.1|482862_484083_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	32.7	3.1e-54
WP_015750854.1|484884_485799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015750832.1|486103_487504_-|transposase	ISKra4-like element ISDere1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013223	Desulfohalobium retbaense DSM 5692, complete sequence	2864304	720314	765393	2864304	transposase,integrase	Pseudomonas_phage(20.0%)	37	720308:720344	772677:772713
720308:720344	attL	TGGTTCCTCACACAAATCTGTGCATAATTTGGGGTTC	NA	NA	NA	NA
WP_015751054.1|720314_721541_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.3	1.7e-20
WP_015751055.1|722078_722342_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_015751056.1|722346_722706_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_015751057.1|722708_724391_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_015751058.1|724393_725272_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_015751059.1|725334_725595_+	carbon storage regulator CsrA	NA	L7TH77	Pseudomonas_virus	39.1	8.7e-07
WP_015751060.1|725581_726046_+	flagellar assembly protein FliW	NA	NA	NA	NA	NA
WP_015751061.1|726307_727522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015751063.1|728689_729511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015751064.1|730235_731237_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	38.2	1.9e-41
WP_015751065.1|731233_732451_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	33.1	2.0e-32
WP_167317785.1|732732_734268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015751067.1|734260_735913_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015751068.1|735912_736995_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_148214005.1|737004_737997_+	N-acetylneuraminic acid synthase	NA	NA	NA	NA	NA
WP_015751070.1|737993_738989_+	formyl transferase	NA	E3SNR5	Prochlorococcus_phage	31.8	4.5e-11
WP_015751071.1|738993_740829_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_148214067.1|740852_741758_+	methyltransferase domain-containing protein	NA	E3T531	Cafeteria_roenbergensis_virus	27.5	2.6e-05
WP_015751073.1|741785_743003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148214006.1|743132_744266_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_015751075.1|744297_745020_+	pseudaminic acid cytidylyltransferase	NA	NA	NA	NA	NA
WP_015751076.1|745345_747073_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015751077.1|747083_748895_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	4.2e-31
WP_083777096.1|749088_749415_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015751078.1|750008_751346_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015751079.1|751885_753211_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	8.7e-34
WP_148214007.1|753221_753905_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	28.6	9.4e-08
WP_015751080.1|754668_755175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015751081.1|755210_757148_+	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_015751082.1|757454_758300_+	flagellin	NA	NA	NA	NA	NA
WP_015751083.1|758348_759194_+	flagellin	NA	NA	NA	NA	NA
WP_015751084.1|759274_759700_+	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_015751085.1|759748_761152_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_015751086.1|761167_761626_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_083777101.1|761757_762450_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_015751089.1|762972_763800_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.8	7.1e-34
WP_015751090.1|763878_765393_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
772677:772713	attR	GAACCCCAAATTATGCACAGATTTGTGTGAGGAACCA	NA	NA	NA	NA
>prophage 3
NC_013223	Desulfohalobium retbaense DSM 5692, complete sequence	2864304	1128017	1178732	2864304	protease,transposase,integrase,tRNA	uncultured_Mediterranean_phage(18.18%)	49	1119231:1119248	1179171:1179188
1119231:1119248	attL	AAACTGTAACCCGGACCA	NA	NA	NA	NA
WP_015751398.1|1128017_1129418_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_015751399.1|1129877_1130297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015751400.1|1130293_1130836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015751401.1|1130853_1131258_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_015751402.1|1132173_1132815_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_015751403.1|1132804_1133080_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015751404.1|1133180_1133510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015751405.1|1133964_1134963_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015751406.1|1135313_1136429_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015750613.1|1136413_1137814_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	25.9	2.1e-17
WP_015751407.1|1138546_1139827_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.1	1.2e-96
WP_015751408.1|1140121_1141603_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_015751409.1|1141624_1141870_-	DUF5395 domain-containing protein	NA	NA	NA	NA	NA
WP_148214019.1|1141883_1142087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015751411.1|1142329_1144735_+	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_015751412.1|1144969_1146391_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_015751413.1|1146405_1146888_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	45.3	1.9e-23
WP_015751414.1|1147053_1147791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015751415.1|1147872_1148457_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_015751416.1|1149102_1149804_-	DUF1614 domain-containing protein	NA	NA	NA	NA	NA
WP_015751417.1|1149932_1151690_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	1.3e-53
WP_015751418.1|1151917_1152154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041282310.1|1152233_1153232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015751420.1|1153240_1154377_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041281910.1|1154516_1155125_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015751422.1|1155389_1156439_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015751423.1|1156472_1156889_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_148214071.1|1157156_1159055_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_015751425.1|1159051_1159714_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.3	9.4e-21
WP_083777139.1|1159664_1160381_+	heme ABC transporter permease CcmB	NA	NA	NA	NA	NA
WP_052293328.1|1160425_1161112_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_015751428.1|1161289_1161442_+	CcmD family protein	NA	NA	NA	NA	NA
WP_015751429.1|1161431_1161995_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015751430.1|1162005_1163463_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.7	2.5e-95
WP_015751431.1|1163562_1165110_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.7	3.3e-16
WP_015751432.1|1165450_1165873_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_148214072.1|1165926_1166844_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	35.1	1.0e-33
WP_015751434.1|1166824_1167406_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_015751435.1|1167417_1168053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015751436.1|1168049_1168781_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_015751437.1|1168889_1169087_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_015751438.1|1169306_1170542_-	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	37.8	4.4e-56
WP_015751439.1|1170663_1171290_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015751440.1|1171383_1173027_+	dephospho-CoA kinase	NA	A0A2H4UV25	Bodo_saltans_virus	30.4	2.1e-05
WP_015751441.1|1173269_1174013_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_015751442.1|1174183_1174942_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015751443.1|1174961_1176134_+	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_015751006.1|1176443_1177670_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.3	1.7e-20
WP_012813891.1|1177838_1178732_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1179171:1179188	attR	AAACTGTAACCCGGACCA	NA	NA	NA	NA
>prophage 4
NC_013223	Desulfohalobium retbaense DSM 5692, complete sequence	2864304	1647202	1657484	2864304	tRNA	Staphylococcus_phage(50.0%)	10	NA	NA
WP_015751850.1|1647202_1647433_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	2.2e-09
WP_015751851.1|1647696_1648944_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_015751852.1|1648954_1650217_+	serine hydroxymethyltransferase	NA	Q8JKP0	Heliothis_zea_nudivirus	47.8	6.6e-92
WP_015751853.1|1650213_1650675_+	cytidine deaminase	NA	A0A160DDE4	Gordonia_phage	41.5	6.3e-24
WP_015751854.1|1650685_1651840_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2I2L4R9	Orpheovirus	32.4	1.1e-40
WP_015751855.1|1651858_1652521_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	32.3	7.9e-28
WP_015751856.1|1652630_1653848_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.4	3.0e-97
WP_015751857.1|1653986_1654457_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	44.3	1.7e-29
WP_015751858.1|1654464_1654908_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_015751859.1|1654988_1657484_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.7	8.5e-200
>prophage 5
NC_013223	Desulfohalobium retbaense DSM 5692, complete sequence	2864304	1850492	1858365	2864304	integrase	Staphylococcus_phage(16.67%)	9	1844494:1844506	1860545:1860557
1844494:1844506	attL	GCGAAACTTTGTG	NA	NA	NA	NA
WP_015752029.1|1850492_1851221_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.9e-25
WP_015752030.1|1851201_1851747_-	OstA family protein	NA	NA	NA	NA	NA
WP_015752031.1|1851743_1852322_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_015752032.1|1852300_1852822_-	HAD hydrolase family protein	NA	A0A222YVZ6	Synechococcus_phage	29.2	5.5e-08
WP_015752033.1|1852811_1853627_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.7	4.5e-49
WP_015752034.1|1853627_1855268_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	6.9e-158
WP_015752035.1|1855559_1856366_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015752036.1|1856392_1856890_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	37.7	3.6e-09
WP_015752037.1|1857180_1858365_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	47.2	5.3e-99
1860545:1860557	attR	GCGAAACTTTGTG	NA	NA	NA	NA
