The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013946	Meiothermus ruber DSM 1279, complete sequence	3097457	66367	78300	3097457		Thermus_virus(90.91%)	21	NA	NA
WP_013012380.1|66367_66790_-	hypothetical protein	NA	C8CHM2	Thermus_virus	64.3	8.8e-41
WP_013012381.1|67302_67581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012382.1|67570_67762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012383.1|67761_68403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012384.1|68389_68731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012385.1|68732_69071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012386.1|69085_69961_-	hypothetical protein	NA	Q859S7	Thermus_virus	71.5	2.1e-116
WP_013012387.1|69973_70483_-	hypothetical protein	NA	C8CHL4	Thermus_virus	69.8	2.8e-65
WP_013012388.1|70498_70915_-	hypothetical protein	NA	C8CHL3	Thermus_virus	78.7	2.4e-54
WP_013012389.1|71063_71738_-	ATPase AAA	NA	Q859T0	Thermus_virus	75.9	1.7e-94
WP_081439931.1|71727_72192_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_157413552.1|72169_72349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012390.1|72361_72556_-	hypothetical protein	NA	B3XVS9	Thermus_virus	87.5	1.2e-13
WP_015586242.1|72552_73089_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	73.7	9.1e-67
WP_036197256.1|73069_73447_-	hypothetical protein	NA	C8CHK6	Thermus_virus	67.5	1.5e-36
WP_013012393.1|73520_73934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012394.1|73937_74450_-	hypothetical protein	NA	Q859T5	Thermus_virus	59.6	5.5e-37
WP_013012395.1|74555_74849_-	hypothetical protein	NA	C8CHK5	Thermus_virus	66.0	8.9e-32
WP_013012396.1|74853_75225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012397.1|75306_75813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012398.1|75819_78300_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.7	1.1e-29
>prophage 2
NC_013946	Meiothermus ruber DSM 1279, complete sequence	3097457	533006	593560	3097457	protease,transposase,integrase	Erysipelothrix_phage(18.18%)	59	533412:533433	558499:558520
WP_015586368.1|533006_533432_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
533412:533433	attL	ACACGGGGGGCCGTCTCTTGAA	NA	NA	NA	NA
WP_015586369.1|533649_534060_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_015586370.1|534398_535214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013012852.1|535532_536060_+	hypothetical protein	NA	E5E454	Acinetobacter_phage	45.9	7.7e-34
WP_013012853.1|536097_536319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012854.1|536341_536563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012855.1|536559_536973_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_013012856.1|537148_538732_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_013012857.1|538792_539962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012858.1|540031_540478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012859.1|540554_541361_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013012860.1|541595_541775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012861.1|541798_542194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012862.1|542255_542540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012863.1|542591_542786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015586376.1|542745_542895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012864.1|542941_543637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012865.1|543609_544434_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013012866.1|544730_545159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012867.1|545205_545481_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_013012868.1|545578_546091_+	hypothetical protein	NA	A0A191ZDG3	Pseudoalteromonas_virus	44.1	8.8e-19
WP_157413605.1|546310_546817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012870.1|547189_549865_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	37.1	9.6e-157
WP_013012871.1|549867_551757_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.7	7.1e-114
WP_013012872.1|551940_552753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015586380.1|552743_553601_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_157413568.1|553731_554478_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_013012874.1|554385_555177_-	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	48.6	7.1e-68
WP_013012875.1|555230_555986_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	30.2	8.5e-10
WP_157413570.1|556397_557870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012877.1|559205_560141_+	transcriptional regulator	NA	NA	NA	NA	NA
558499:558520	attR	TTCAAGAGACGGCCCCCCGTGT	NA	NA	NA	NA
WP_013012878.1|560362_562354_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	34.0	1.1e-05
WP_013012879.1|562353_563301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160143424.1|563293_566392_-	DEAD/DEAH box helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	32.0	2.3e-37
WP_160143425.1|566835_570951_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	24.7	1.1e-10
WP_013012882.1|571307_571835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012883.1|572044_572680_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081439962.1|572682_573225_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013012884.1|573363_573795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012885.1|574067_574274_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_013012886.1|574273_574684_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_013012887.1|575372_575729_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_013012888.1|575725_575965_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_013012889.1|576013_577603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156113836.1|577583_577724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081439940.1|577970_578525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012890.1|578511_580311_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.5	1.0e-16
WP_013012891.1|580416_581610_+	MFS transporter	NA	NA	NA	NA	NA
WP_015586389.1|581651_582719_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.3	9.5e-07
WP_152024871.1|582667_582985_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_024049886.1|583199_583343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012892.1|583339_585214_-	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_013012893.1|585206_586181_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_013012894.1|586190_587654_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_013012895.1|587650_588094_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_013012896.1|588245_589199_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_013012897.1|589344_590013_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013012898.1|590039_590534_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_013012899.1|592417_593560_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 3
NC_013946	Meiothermus ruber DSM 1279, complete sequence	3097457	1443460	1457907	3097457	integrase	Thermus_virus(92.86%)	28	1443324:1443366	1459549:1459591
1443324:1443366	attL	GCGCCCGGGAGGATTCGAACCCCCGACCTACCGCTTAGAAGGC	NA	NA	NA	NA
WP_013013688.1|1443460_1444585_-|integrase	site-specific integrase	integrase	Q859R3	Thermus_virus	59.6	1.2e-105
WP_013013689.1|1444590_1445667_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_052310724.1|1445710_1446145_-	S24/S26 family peptidase	NA	A0A0M3LPF9	Mannheimia_phage	34.2	1.9e-06
WP_157413578.1|1446488_1446674_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013013691.1|1446666_1446888_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013013692.1|1446921_1447194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015586577.1|1447265_1447442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013013694.1|1447455_1448688_+	hypothetical protein	NA	C8CHK0	Thermus_virus	56.0	5.1e-105
WP_119361462.1|1448721_1449027_+	hypothetical protein	NA	Q859T8	Thermus_virus	48.9	2.0e-10
WP_013013696.1|1449047_1449425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012395.1|1449429_1449723_+	hypothetical protein	NA	C8CHK5	Thermus_virus	66.0	8.9e-32
WP_013012394.1|1449828_1450341_+	hypothetical protein	NA	Q859T5	Thermus_virus	59.6	5.5e-37
WP_013012393.1|1450344_1450758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036197256.1|1450831_1451209_+	hypothetical protein	NA	C8CHK6	Thermus_virus	67.5	1.5e-36
WP_015586242.1|1451189_1451726_+	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	73.7	9.1e-67
WP_013013697.1|1451722_1451917_+	hypothetical protein	NA	B3XVS9	Thermus_virus	83.8	1.1e-11
WP_013013698.1|1451931_1452141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013013699.1|1452124_1452547_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_013013700.1|1452536_1453211_+	ATPase AAA	NA	Q859T0	Thermus_virus	75.9	1.7e-94
WP_013012388.1|1453359_1453776_+	hypothetical protein	NA	C8CHL3	Thermus_virus	78.7	2.4e-54
WP_013012387.1|1453791_1454301_+	hypothetical protein	NA	C8CHL4	Thermus_virus	69.8	2.8e-65
WP_013012386.1|1454313_1455189_+	hypothetical protein	NA	Q859S7	Thermus_virus	71.5	2.1e-116
WP_013012385.1|1455203_1455542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012384.1|1455543_1455885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012383.1|1455871_1456513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012382.1|1456512_1456704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012381.1|1456693_1456972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012380.1|1457484_1457907_+	hypothetical protein	NA	C8CHM2	Thermus_virus	64.3	8.8e-41
1459549:1459591	attR	GCGCCCGGGAGGATTCGAACCCCCGACCTACCGCTTAGAAGGC	NA	NA	NA	NA
>prophage 4
NC_013946	Meiothermus ruber DSM 1279, complete sequence	3097457	2005279	2035224	3097457	plate,capsid,transposase,head,integrase	unidentified_phage(37.5%)	48	2028207:2028222	2036610:2036625
WP_013014202.1|2005279_2006362_-|plate	baseplate J/gp47 family protein	plate	A0A1B1IUE6	uncultured_Mediterranean_phage	29.2	8.4e-19
WP_013014203.1|2006354_2006729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014204.1|2006728_2007205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014205.1|2007205_2007871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014206.1|2007867_2008449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014207.1|2008448_2010542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014209.1|2011125_2011557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014210.1|2011567_2012995_-	hypothetical protein	NA	H7BVM2	unidentified_phage	25.7	1.4e-13
WP_013014211.1|2012991_2013198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014212.1|2013208_2013706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014213.1|2013702_2014206_-	phage virion morphogenesis protein	NA	A0A2K9VH22	Faecalibacterium_phage	38.7	1.2e-15
WP_013014214.1|2014205_2014748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014215.1|2014875_2015343_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_013014216.1|2015342_2015552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014217.1|2015565_2016465_-|head	Mu-like prophage major head subunit gpT family protein	head	H7BVL8	unidentified_phage	44.7	1.9e-69
WP_013014218.1|2016474_2016885_-	hypothetical protein	NA	A0A0U5KRP3	unidentified_phage	51.9	6.0e-26
WP_013014219.1|2016877_2017882_-	hypothetical protein	NA	B7SDN9	Haemophilus_phage	31.8	1.2e-16
WP_013014220.1|2017915_2018218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014221.1|2018401_2018641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014222.1|2018652_2019873_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_013014223.1|2019850_2021422_-	DUF935 family protein	NA	A0A2H4JAU9	uncultured_Caudovirales_phage	35.2	1.3e-73
WP_013014224.1|2021421_2022702_-	hypothetical protein	NA	A0A2P9JZI8	Alteromonadaceae_phage	45.5	4.5e-96
WP_013014225.1|2022688_2023225_-	DUF3486 family protein	NA	NA	NA	NA	NA
WP_015586831.1|2023160_2023478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014226.1|2023477_2023822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014227.1|2023831_2024071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014228.1|2024142_2024562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014229.1|2024554_2025433_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013014230.1|2025429_2025774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014231.1|2025773_2026100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014232.1|2026087_2026495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014233.1|2026487_2026727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014234.1|2026719_2027019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014235.1|2027011_2027296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014236.1|2027282_2027573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014237.1|2027580_2027820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014240.1|2028098_2028419_-	hypothetical protein	NA	NA	NA	NA	NA
2028207:2028222	attL	GGCCGCCATCGCCCGG	NA	NA	NA	NA
WP_013014241.1|2028534_2028768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014242.1|2028781_2029216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014243.1|2029208_2029595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013014244.1|2029698_2030505_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013014245.1|2030535_2031981_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013012997.1|2031981_2032809_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013014246.1|2032832_2033513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081439956.1|2033493_2033754_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013014247.1|2033775_2034501_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013014248.1|2034505_2034826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157413597.1|2034846_2035224_-|transposase	transposase	transposase	NA	NA	NA	NA
2036610:2036625	attR	GGCCGCCATCGCCCGG	NA	NA	NA	NA
