The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013501	Rhodothermus marinus DSM 4252, complete sequence	3261604	1512530	1572271	3261604	protease,transposase,integrase,tRNA,tail	uncultured_Mediterranean_phage(18.18%)	53	1530486:1530506	1576481:1576501
WP_012843791.1|1512530_1514033_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012843792.1|1513974_1514577_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_012843793.1|1514630_1515317_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_144295495.1|1515561_1517679_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_012843795.1|1517772_1518696_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_012843796.1|1518768_1520142_+	TrpB-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012843797.1|1520154_1520931_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_012843798.1|1520994_1521426_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012843799.1|1521663_1522020_+	DUF5335 family protein	NA	NA	NA	NA	NA
WP_012843800.1|1522109_1522562_+	DUF1931 family protein	NA	NA	NA	NA	NA
WP_012843801.1|1522577_1523411_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A1V0SCZ1	Indivirus	22.3	6.7e-08
WP_012843802.1|1523407_1524127_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_144295496.1|1524111_1526142_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_012843804.1|1526303_1527560_+	DUF2391 family protein	NA	NA	NA	NA	NA
WP_041806333.1|1527560_1529051_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_049772349.1|1529207_1530431_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
1530486:1530506	attL	AAATCCGTTATTGCAATGCAG	NA	NA	NA	NA
WP_049772350.1|1530531_1531617_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_012843808.1|1531618_1533220_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_012843809.1|1533404_1533887_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_012843810.1|1533917_1535183_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_012843811.1|1535215_1537990_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	2.6e-24
WP_012843812.1|1537989_1538370_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_012843813.1|1538373_1539123_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_012843814.1|1539119_1540058_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_012843815.1|1540145_1540412_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_012843816.1|1540492_1542811_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_012843817.1|1542986_1544243_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	30.7	6.1e-45
WP_012843818.1|1544322_1545255_+	SDR family oxidoreductase	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	32.1	4.2e-43
WP_012843819.1|1545258_1546005_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.6	1.1e-06
WP_012843820.1|1545991_1546627_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.2	9.0e-13
WP_012843821.1|1546729_1547536_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_012843822.1|1547507_1549022_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.4	4.2e-101
WP_012843823.1|1549036_1550107_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012843824.1|1550110_1551400_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012843825.1|1551384_1551789_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012843826.1|1551785_1552709_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_012843827.1|1552828_1553074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012843828.1|1553095_1554025_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	21.1	6.8e-09
WP_012843829.1|1554177_1554666_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_187289221.1|1554674_1555553_-	N-glycosylase/DNA lyase	NA	NA	NA	NA	NA
WP_012843831.1|1556146_1556656_-	siphovirus Gp157 family protein	NA	NA	NA	NA	NA
WP_012843832.1|1557126_1558554_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7F1	Microcystis_virus	47.7	6.9e-37
WP_081440059.1|1559431_1560514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012843734.1|1560562_1561402_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012843833.1|1561495_1562539_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012843834.1|1562543_1563530_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	31.9	3.9e-31
WP_012843835.1|1563514_1564321_-	apolipoprotein N-acyltransferase	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	34.5	4.3e-28
WP_187289222.1|1564325_1564781_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_012843837.1|1564812_1565076_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_012843838.1|1565083_1566328_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012843839.1|1566401_1567190_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_012843840.1|1567202_1569341_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_012843841.1|1569367_1572271_+|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
1576481:1576501	attR	CTGCATTGCAATAACGGATTT	NA	NA	NA	NA
