The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013592	Dickeya zeae Ech586, complete sequence	4818394	722019	729394	4818394		Escherichia_phage(33.33%)	7	NA	NA
WP_012883387.1|722019_723087_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	52.7	1.1e-100
WP_012883388.1|723086_723950_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	67.4	1.2e-108
WP_012883389.1|724211_724763_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.1	1.1e-46
WP_041164267.1|724938_726327_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	3.7e-51
WP_012883391.1|726342_727704_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	28.5	3.6e-35
WP_071818942.1|727809_728637_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095522548.1|728638_729394_+	ABC transporter ATP-binding protein	NA	A7IVC2	Paramecium_bursaria_Chlorella_virus	28.2	3.6e-08
>prophage 2
NC_013592	Dickeya zeae Ech586, complete sequence	4818394	811892	846943	4818394	terminase,transposase,capsid,head,portal,integrase,tail,holin	Cronobacter_phage(78.57%)	38	818289:818332	848156:848199
WP_012883459.1|811892_813137_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012883460.1|813654_815706_-	acyltransferase	NA	C6ZR20	Salmonella_phage	28.8	1.5e-45
818289:818332	attL	TGGTGGAGCTGGGGGGAGTTGAACCCCCGTCCGAAATTCCTACA	NA	NA	NA	NA
WP_012883462.1|818381_819473_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	75.5	3.5e-158
WP_012883463.1|819600_820248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012883464.1|820248_821283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012883465.1|821537_822101_-	hypothetical protein	NA	F1BUN8	Cronobacter_phage	39.6	2.8e-34
WP_012883466.1|822230_822452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012883467.1|822484_822994_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	54.5	4.5e-47
WP_012883468.1|823090_823246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012883469.1|823258_823588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012883470.1|823659_823890_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
WP_012883471.1|823889_824213_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_012883472.1|824209_826255_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	62.1	7.2e-237
WP_012883473.1|826294_826495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012883474.1|826783_826939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041164277.1|826945_827266_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	79.6	7.1e-43
WP_012883476.1|827265_828294_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	79.9	8.8e-159
WP_012883477.1|828290_830066_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	76.0	8.0e-269
WP_041164278.1|830216_831059_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	58.6	5.5e-58
WP_012883479.1|831113_832145_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	82.0	1.7e-154
WP_012883480.1|832148_832850_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	59.5	4.7e-71
WP_049779751.1|832946_833399_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	70.7	9.7e-54
WP_012883482.1|833395_833893_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	43.8	1.9e-34
WP_012883483.1|833889_834594_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	69.7	2.3e-86
WP_012883484.1|834596_835712_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	67.7	3.4e-140
WP_012883485.1|835708_836164_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	64.9	4.1e-52
WP_012883486.1|836172_836478_+|holin	holin	holin	C7BGD7	Burkholderia_phage	55.3	1.3e-17
WP_012883487.1|836464_836806_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	83.2	1.1e-44
WP_012883488.1|836805_837162_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	57.5	5.4e-23
WP_012883490.1|837294_837552_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	60.5	8.9e-20
WP_012883492.1|837739_839704_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	51.5	2.2e-190
WP_012883493.1|839703_840033_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	66.3	7.4e-35
WP_012883494.1|840029_841214_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	69.0	1.8e-155
WP_012883495.1|841206_841839_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	61.9	4.1e-58
WP_012883497.1|843451_844072_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	40.5	7.9e-38
WP_012883498.1|844068_844794_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	40.3	2.3e-41
WP_012883499.1|844765_845287_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	58.8	4.4e-50
WP_012883500.1|845290_846943_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	58.4	5.9e-173
848156:848199	attR	TGGTGGAGCTGGGGGGAGTTGAACCCCCGTCCGAAATTCCTACA	NA	NA	NA	NA
>prophage 3
NC_013592	Dickeya zeae Ech586, complete sequence	4818394	1394121	1402139	4818394		Bacillus_phage(33.33%)	6	NA	NA
WP_012883970.1|1394121_1395549_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	1.3e-54
WP_012883971.1|1395563_1396937_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.1	4.2e-31
WP_012883972.1|1397042_1398050_+	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	27.1	9.6e-09
WP_012883973.1|1398284_1399451_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	55.8	5.7e-114
WP_012883974.1|1399537_1400437_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.7	2.0e-50
WP_012883975.1|1400732_1402139_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	30.2	2.1e-30
>prophage 4
NC_013592	Dickeya zeae Ech586, complete sequence	4818394	1963104	2079014	4818394	protease,plate,tail,tRNA,holin	Escherichia_phage(27.27%)	95	NA	NA
WP_012884424.1|1963104_1964046_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	92.2	1.4e-139
WP_041164379.1|1964365_1965817_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	S5M9Y4	Brevibacillus_phage	35.4	2.1e-09
WP_012884426.1|1966708_1967206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012884427.1|1967328_1969353_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_012884428.1|1969670_1969961_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_012884429.1|1970020_1971013_-	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	42.5	3.8e-66
WP_012884430.1|1971234_1972788_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	54.4	6.2e-39
WP_012884431.1|1973093_1975697_+	YdbH family protein	NA	NA	NA	NA	NA
WP_012884432.1|1975723_1975936_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_012884433.1|1976260_1977433_+	acyltransferase	NA	NA	NA	NA	NA
WP_012884434.1|1977635_1978241_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_012884435.1|1978603_1982491_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.6	1.3e-53
WP_041164884.1|1982601_1983297_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_012884437.1|1983296_1984718_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_012884438.1|1984729_1985449_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_012884439.1|1985566_1987117_-	L-lactate permease	NA	NA	NA	NA	NA
WP_012884440.1|1987401_1988220_-|protease	serine protease	protease	NA	NA	NA	NA
WP_012884442.1|1989464_1990820_-	two-component system sensor histidine kinase RstB	NA	NA	NA	NA	NA
WP_012884443.1|1990816_1991560_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_012884444.1|1991786_1992230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041164889.1|1992294_1994010_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.1	5.6e-25
WP_012884446.1|1994280_1995381_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_012884447.1|1996224_1996917_+	transporter	NA	NA	NA	NA	NA
WP_012884448.1|1997093_1998134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012884449.1|1998130_1998991_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012884450.1|1998977_1999820_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_041164891.1|1999831_2000503_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.4	2.2e-17
WP_012884452.1|2000581_2002162_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012884453.1|2002213_2003500_-	chloride channel protein	NA	NA	NA	NA	NA
WP_041164384.1|2003635_2004334_+	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	56.5	1.6e-71
WP_157668895.1|2004488_2004674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012884455.1|2004772_2005072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012884456.1|2005194_2006742_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	53.8	1.1e-35
WP_012884457.1|2007466_2008699_+	exopolysaccharide inner membrane protein	NA	NA	NA	NA	NA
WP_012884458.1|2008843_2010532_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_012884459.1|2010813_2012628_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_012884460.1|2012850_2014155_-	guanine deaminase	NA	NA	NA	NA	NA
WP_012769529.1|2014544_2014736_-	transcriptional activator Ogr/delta	NA	A0A2I8TV89	Erwinia_phage	66.7	6.8e-17
WP_012884461.1|2014832_2016008_-	late control D family protein	NA	Q6K1G4	Salmonella_virus	43.3	1.6e-76
WP_038927221.1|2016004_2016499_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	58.0	1.2e-41
WP_012884462.1|2016509_2017598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012769533.1|2017590_2017710_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	77.1	6.5e-10
WP_012884463.1|2017742_2018033_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	58.4	4.8e-22
WP_012884464.1|2018093_2018612_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	76.7	1.4e-75
WP_012884465.1|2018626_2019796_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.2	1.0e-187
WP_012884466.1|2020022_2020634_-|tail	tail assembly protein	tail	H9C0Y3	Aeromonas_phage	31.5	9.9e-17
WP_012884467.1|2020636_2021233_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	51.3	6.2e-32
WP_012884468.1|2021394_2021976_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	76.2	1.3e-74
WP_012884470.1|2022752_2024108_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_012884471.1|2024260_2025607_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_012884472.1|2025695_2026262_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_012884473.1|2026415_2027621_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	44.5	1.2e-103
WP_012884474.1|2027849_2028461_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	64.6	2.7e-75
WP_012884475.1|2028453_2029362_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	74.8	2.2e-121
WP_012884476.1|2029366_2029717_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	62.9	9.3e-36
WP_012884477.1|2029713_2030367_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	66.8	5.5e-74
WP_012884478.1|2030694_2031156_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	45.1	4.7e-27
WP_012884479.1|2031198_2031402_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	65.7	8.3e-21
WP_012884482.1|2032095_2032317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012884483.1|2032380_2034504_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	46.0	7.1e-171
WP_012884484.1|2034600_2034825_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	52.1	2.9e-14
WP_012884485.1|2034824_2035040_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_012884486.1|2035162_2035675_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	46.6	1.0e-35
WP_012884487.1|2035671_2036154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019845996.1|2036278_2037121_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	55.0	5.2e-85
WP_012884489.1|2037775_2039785_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_012769560.1|2040003_2040195_-	YebW family protein	NA	NA	NA	NA	NA
WP_012884490.1|2040304_2041753_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_012884491.1|2041858_2044489_-	PqiB family protein	NA	NA	NA	NA	NA
WP_012884492.1|2044504_2045776_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_041164896.1|2046078_2046585_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012884494.1|2046669_2047392_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_012884495.1|2047411_2049433_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.4	6.0e-87
WP_012884496.1|2049561_2050617_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_012884497.1|2050846_2052127_-	acyltransferase	NA	NA	NA	NA	NA
WP_012884498.1|2052400_2053048_-	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_012884499.1|2053040_2054849_-	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_012884500.1|2055288_2056680_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_041164388.1|2056789_2057809_-	CAR family subclass B3 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_012884502.1|2057913_2058804_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012884503.1|2059137_2062908_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_012884504.1|2062907_2064467_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.1e-19
WP_012884505.1|2064463_2065183_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_012884506.1|2065182_2065860_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_012884507.1|2066319_2067468_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_012884508.1|2068020_2069046_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_012884509.1|2069459_2069918_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012884510.1|2069979_2070216_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_012884511.1|2070544_2071027_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.7	1.1e-23
WP_012884512.1|2072102_2073284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012884513.1|2073342_2073957_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012884514.1|2073969_2075268_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_012884515.1|2075330_2077676_+	pyruvate phosphate dikinase PEP/pyruvate-binding protein	NA	NA	NA	NA	NA
WP_012884516.1|2077672_2078287_+	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_012884517.1|2078288_2079014_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
>prophage 5
NC_013592	Dickeya zeae Ech586, complete sequence	4818394	2203668	2213352	4818394	tRNA	Tupanvirus(33.33%)	11	NA	NA
WP_012884622.1|2203668_2205597_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	8.8e-128
WP_012884623.1|2205600_2206143_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	7.4e-16
WP_012769670.1|2206239_2206437_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_012769671.1|2206480_2206837_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_146214201.1|2206986_2207055_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_012884624.1|2207246_2208230_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
WP_012884625.1|2208245_2210633_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	1.8e-05
WP_012769674.1|2210636_2210936_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_012884626.1|2211059_2211407_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_041164918.1|2211481_2212381_-	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_012884628.1|2212527_2213352_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.8	2.7e-70
>prophage 6
NC_013592	Dickeya zeae Ech586, complete sequence	4818394	2331670	2400719	4818394	protease	Burkholderia_phage(22.22%)	56	NA	NA
WP_012884725.1|2331670_2333104_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_012884726.1|2333410_2333722_+|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_012884727.1|2333738_2335472_+	type I secretion system permease/ATPase	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.5	1.3e-13
WP_012884728.1|2335485_2336832_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012884729.1|2336844_2338233_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_167316309.1|2338420_2339845_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_012884731.1|2339995_2341438_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_012884732.1|2341852_2343289_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_012884733.1|2343529_2345398_-	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	31.4	1.5e-71
WP_041164926.1|2345641_2346337_-	Expansin-YoaJ	NA	NA	NA	NA	NA
WP_012884735.1|2346631_2347600_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_012884736.1|2348466_2349471_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.2	4.4e-14
WP_012884737.1|2349572_2349917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041164928.1|2350055_2350481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012884739.1|2350486_2351047_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012884740.1|2351053_2351965_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012884741.1|2351977_2352967_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012884745.1|2355124_2355958_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_012884746.1|2355977_2357204_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_012884747.1|2357221_2357992_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012884748.1|2358363_2359113_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_012884749.1|2359410_2359767_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_012884750.1|2359834_2360086_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_012884751.1|2360273_2360945_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_012884752.1|2361091_2362309_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_012884753.1|2362425_2363340_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041164416.1|2363477_2364722_+	MFS transporter	NA	S4TR35	Salmonella_phage	27.2	5.0e-07
WP_041164930.1|2364888_2365815_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_012884756.1|2365818_2367216_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_012884757.1|2367393_2368578_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012884758.1|2368634_2370188_+	YdgA family protein	NA	NA	NA	NA	NA
WP_012884759.1|2370501_2371515_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_012884760.1|2371619_2372078_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012884761.1|2372243_2373239_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_012884762.1|2373392_2374442_-	oxidoreductase	NA	NA	NA	NA	NA
WP_012884763.1|2374681_2375635_-	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_012884764.1|2375705_2376692_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_012884765.1|2376710_2378234_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	1.0e-14
WP_012884766.1|2378322_2379306_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012884767.1|2379688_2381374_+	ribulokinase	NA	NA	NA	NA	NA
WP_012884768.1|2381428_2382940_+	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_012884769.1|2383087_2384800_-	rhamnogalacturonate lyase	NA	NA	NA	NA	NA
WP_012884770.1|2385635_2385851_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_012884771.1|2386236_2386818_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_012884772.1|2386817_2387408_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_012884773.1|2387400_2389680_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_012884774.1|2389680_2390733_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_041164932.1|2390745_2391372_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_012884776.1|2391371_2392067_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_012884777.1|2392068_2392704_+	endonuclease III	NA	NA	NA	NA	NA
WP_012884778.1|2392828_2393803_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_012884779.1|2394143_2396765_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	34.3	2.3e-86
WP_012884780.1|2397205_2397475_+	YciN family protein	NA	NA	NA	NA	NA
WP_012884781.1|2397869_2398463_+	YolA family protein	NA	I6NTM5	Burkholderia_phage	55.3	5.4e-44
WP_012884782.1|2398754_2399243_-	hypothetical protein	NA	I6NP90	Burkholderia_phage	33.1	9.7e-07
WP_012884783.1|2399672_2400719_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.4	2.4e-18
>prophage 7
NC_013592	Dickeya zeae Ech586, complete sequence	4818394	4295448	4304363	4818394	integrase	uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_016942972.1|4295448_4296672_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	3.3e-27
WP_012886371.1|4296805_4297381_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.1	2.0e-72
WP_012886372.1|4297553_4297817_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012886373.1|4297929_4298196_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.1	9.5e-17
WP_012886374.1|4298420_4300466_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.9	4.3e-117
WP_012886375.1|4300458_4300995_-	ash family protein	NA	NA	NA	NA	NA
WP_012886376.1|4300991_4301195_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	8.0e-08
WP_012886377.1|4301194_4302076_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_038909166.1|4303247_4304363_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	25.8	5.1e-19
>prophage 8
NC_013592	Dickeya zeae Ech586, complete sequence	4818394	4506076	4565707	4818394	tail,protease	Erwinia_phage(38.46%)	55	NA	NA
WP_012767897.1|4506076_4506607_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012886538.1|4506616_4507948_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	29.0	3.4e-46
WP_012886539.1|4508120_4509038_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_012886540.1|4509202_4509688_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_012886541.1|4509755_4509998_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_012886542.1|4510598_4511450_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-14
WP_012886543.1|4511477_4512989_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_012886544.1|4513134_4514145_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_012886545.1|4514269_4515016_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_012886546.1|4515072_4515498_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_012886547.1|4515643_4516240_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_012886548.1|4516381_4517152_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_038909280.1|4517304_4518729_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_012886550.1|4518791_4519172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668929.1|4519412_4519661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886552.1|4519983_4520526_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	44.9	6.7e-41
WP_157668909.1|4520730_4521339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886554.1|4521502_4521946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886555.1|4522136_4522466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886556.1|4522801_4523128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668930.1|4523416_4523818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886559.1|4524895_4525450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041164675.1|4525560_4525776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886561.1|4526028_4526376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886562.1|4526537_4526759_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_012886563.1|4526805_4527303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041164677.1|4527410_4527686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886565.1|4528506_4528956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886566.1|4531808_4532141_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012886567.1|4532148_4532406_-	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	53.8	2.1e-13
WP_012886568.1|4532504_4532825_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157668931.1|4533124_4533571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886571.1|4533988_4534336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886572.1|4534338_4537599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886573.1|4537641_4537899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167316317.1|4537885_4538668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668910.1|4539169_4539589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886575.1|4540127_4540577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167316318.1|4540579_4541197_-	filamentous hemagglutinin	NA	NA	NA	NA	NA
WP_012886577.1|4549144_4549681_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_012886578.1|4549693_4551424_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_012886579.1|4551617_4552715_-	agmatine deiminase	NA	M1I5R4	Acanthocystis_turfacea_Chlorella_virus	49.6	4.1e-98
WP_012886580.1|4552718_4553603_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.2	5.7e-82
WP_157668911.1|4553734_4553905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886581.1|4553906_4554869_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_012886582.1|4555067_4555970_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_012886583.1|4556165_4556636_-	Pr2TM family membrane protein	NA	NA	NA	NA	NA
WP_012886584.1|4556838_4557318_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012886585.1|4557289_4557685_-|tail	tail assembly protein	tail	I7LEG3	Yersinia_phage	36.0	8.9e-11
WP_012886586.1|4557681_4559040_-|tail	tail protein	tail	F1BUP1	Erwinia_phage	54.7	8.8e-74
WP_012886587.1|4559323_4559944_-|tail	tail fiber assembly protein	tail	X2KPE1	Enterobacteria_phage	33.0	2.4e-18
WP_012886588.1|4559943_4560939_-|tail	tail protein	tail	A0A2I8TVA9	Erwinia_phage	52.4	5.1e-95
WP_012886589.1|4561190_4562345_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	53.5	3.6e-100
WP_012886590.1|4562651_4563836_-|tail	tail fiber protein	tail	A0A2I8TVA9	Erwinia_phage	48.1	2.5e-85
WP_012886591.1|4564222_4565707_-|tail	tail collar domain-containing protein	tail	M1TAS6	Escherichia_phage	45.0	3.3e-98
