The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013959	Sideroxydans lithotrophicus ES-1, complete sequence	3003656	1618	16478	3003656	tRNA	Bacillus_virus(25.0%)	12	NA	NA
WP_013028143.1|1618_2722_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	33.5	1.7e-38
WP_013028144.1|2757_5187_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.3	2.8e-115
WP_041420704.1|5179_5380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028145.1|5671_8302_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	33.4	1.6e-111
WP_013028146.1|8307_8763_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_013028147.1|8777_9842_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	34.6	1.7e-27
WP_013028148.1|9845_10925_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	47.0	2.9e-11
WP_013028149.1|11015_11519_+	peptide deformylase	NA	Q6VSW0	Vibrio_phage	38.3	4.6e-12
WP_013028150.1|11529_12459_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.5	2.7e-10
WP_013028151.1|12461_13736_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_013028152.1|13710_14343_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_013028153.1|14339_16478_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	25.4	2.7e-08
>prophage 2
NC_013959	Sideroxydans lithotrophicus ES-1, complete sequence	3003656	188485	276834	3003656	transposase,capsid,holin,terminase,tRNA,head,plate,integrase,tail,protease	uncultured_Caudovirales_phage(15.91%)	102	194895:194915	259796:259816
WP_013028310.1|188485_189340_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	70.9	5.7e-103
WP_013028311.1|189401_190727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028312.1|190747_191215_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_013028313.1|191247_191796_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	40.6	1.5e-16
WP_013028314.1|191991_193338_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	58.3	2.1e-112
WP_013028315.1|193334_194177_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_013028316.1|194142_194535_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_013028317.1|194605_196024_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.4	7.8e-41
194895:194915	attL	TTGGCCAGCAGGATGATGCGC	NA	NA	NA	NA
WP_013028318.1|196145_197309_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.9	2.1e-124
WP_013028319.1|197393_198257_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_013028320.1|198256_199126_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	30.6	1.2e-28
WP_041420928.1|199187_199538_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_013028322.1|199575_201039_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_013028323.1|201096_201717_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_013028324.1|201909_203394_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_041420930.1|203390_204740_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_013028326.1|204809_205709_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_013028327.1|205885_206176_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.3	6.1e-17
WP_013028328.1|206209_207856_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.5	2.5e-171
WP_150102911.1|208537_209272_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	26.9	9.7e-11
WP_013028330.1|209474_209819_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	50.0	3.8e-10
WP_013028331.1|209820_210264_+	hypothetical protein	NA	R9U2Q7	Rhizobium_phage	30.6	6.7e-07
WP_013028332.1|210260_212375_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1C6ZDN4	Pseudomonas_phage	40.9	6.1e-122
WP_013028333.1|212440_213187_+	AAA family ATPase	NA	R9U430	Rhizobium_phage	37.6	2.7e-32
WP_013028334.1|213187_213775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150103030.1|213783_214089_+	LacI family transcriptional regulator	NA	A0A0A1IWY8	Pseudomonas_phage	34.7	1.7e-09
WP_150102912.1|214085_214376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028337.1|214372_214654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028338.1|214650_214896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028339.1|214885_215398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028340.1|215394_215931_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	49.6	4.1e-27
WP_013028341.1|215948_216320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028342.1|216351_216723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028343.1|216748_217117_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_190272156.1|217320_218517_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	33.6	9.5e-48
WP_013028345.1|218503_218821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028346.1|218835_219357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028348.1|219469_219802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028349.1|219805_220198_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	44.5	1.4e-27
WP_013028350.1|220265_220547_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	41.3	2.7e-09
WP_013028351.1|220608_220803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028352.1|220807_221239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028353.1|221240_221675_+	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	42.7	3.5e-16
WP_013028354.1|221671_222061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028355.1|222092_222452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028356.1|222453_222786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041420715.1|223035_223335_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	43.9	4.1e-16
WP_150103031.1|223388_223958_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	65.5	1.5e-64
WP_013028359.1|223948_224476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028360.1|224472_224691_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_013028361.1|224691_225102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028362.1|225098_225401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028363.1|225387_225888_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	54.8	3.3e-42
WP_013028364.1|225880_227500_+|terminase	phage terminase large subunit	terminase	Q6TM76	Pseudomonas_phage	74.1	1.8e-238
WP_013028365.1|227493_229071_+	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	52.8	4.5e-154
WP_013028366.1|229057_229864_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	57.0	2.9e-80
WP_013028367.1|229863_230343_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	38.1	2.1e-14
WP_190272142.1|230616_231726_+|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	44.5	3.1e-69
WP_013028369.1|231748_232150_+	hypothetical protein	NA	A0A0U5KRP3	unidentified_phage	57.6	2.1e-31
WP_013028370.1|232176_233085_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	56.7	1.8e-91
WP_013028371.1|233174_233603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028372.1|233602_233977_+	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	64.1	1.1e-34
WP_013028373.1|233973_234396_+	DUF1320 domain-containing protein	NA	A0A2K9VH41	Faecalibacterium_phage	39.3	1.9e-11
WP_013028374.1|234392_234995_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_013028375.1|235003_235180_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_013028376.1|235182_236601_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	45.4	1.2e-89
WP_013028377.1|236620_236995_+	hypothetical protein	NA	A0A2H4J9F8	uncultured_Caudovirales_phage	46.5	4.8e-22
WP_013028378.1|236991_237309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028380.1|237490_239404_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	42.4	2.4e-85
WP_013028381.1|239458_240682_+	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	32.0	2.2e-47
WP_013028382.1|240665_241790_+|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	41.4	4.7e-73
WP_150103032.1|241789_242350_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	47.8	6.5e-23
WP_013028384.1|242349_242721_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	52.0	6.0e-25
WP_013028385.1|242723_243782_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	33.8	6.7e-37
WP_013028386.1|243778_244333_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_013028387.1|244345_245671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028388.1|245673_246201_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_013028389.1|246200_246659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028390.1|246791_246977_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	59.0	7.6e-05
WP_013028391.1|246951_247740_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	69.9	8.3e-109
WP_013028392.1|247881_248265_+	TssQ family T6SS-associated lipoprotein	NA	NA	NA	NA	NA
WP_013028393.1|248434_250477_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	28.2	2.1e-71
WP_013028394.1|250551_254307_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013028395.1|254355_254751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028396.1|254845_256099_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013028397.1|256095_257178_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_013028398.1|257182_258043_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013028399.1|258296_259682_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_013028400.1|259718_260750_+	histidine kinase	NA	NA	NA	NA	NA
259796:259816	attR	GCGCATCATCCTGCTGGCCAA	NA	NA	NA	NA
WP_013028401.1|260755_261520_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	24.7	1.1e-09
WP_013028402.1|261523_262216_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	1.5e-24
WP_013028403.1|262199_263450_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013028404.1|263670_264984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028405.1|265588_266908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028406.1|267345_268683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028407.1|268829_271598_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_013028408.1|271697_272642_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_013028409.1|272634_273411_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013028410.1|273407_274487_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_013028411.1|274483_275644_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_150102914.1|275783_276200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013028413.1|276267_276834_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
>prophage 3
NC_013959	Sideroxydans lithotrophicus ES-1, complete sequence	3003656	655163	664403	3003656	protease	Staphylococcus_phage(25.0%)	12	NA	NA
WP_013028787.1|655163_655568_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	43.2	1.3e-17
WP_013028788.1|655628_656498_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	36.3	5.5e-37
WP_013028789.1|656669_657917_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.2	2.4e-94
WP_013028790.1|657926_658403_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_150103043.1|658423_659491_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.9	3.6e-46
WP_013028792.1|659493_660090_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.1	2.0e-30
WP_013028793.1|660280_661381_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	32.8	1.5e-47
WP_013028794.1|661377_661830_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	35.2	4.6e-11
WP_013028795.1|661826_662279_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_013028796.1|662294_663242_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_013028797.1|663225_663729_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_013028798.1|663725_664403_+	thermonuclease family protein	NA	A0A218ML12	uncultured_virus	31.4	1.8e-06
>prophage 4
NC_013959	Sideroxydans lithotrophicus ES-1, complete sequence	3003656	1952422	1963294	3003656	terminase	Burkholderia_phage(44.44%)	16	NA	NA
WP_190272127.1|1952422_1953778_-|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	36.8	1.3e-72
WP_013030050.1|1953851_1954328_-	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	53.9	1.2e-33
WP_041420838.1|1954360_1955017_-	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	54.8	1.3e-59
WP_013030052.1|1955436_1955715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013030053.1|1955711_1956083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013030054.1|1956079_1956274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013030056.1|1956380_1956611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013030057.1|1956607_1957039_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	50.7	2.6e-32
WP_150102990.1|1957035_1957395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013030061.1|1957767_1958307_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	38.1	2.5e-16
WP_013030062.1|1958303_1958954_-	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	48.5	1.7e-51
WP_013030063.1|1958940_1959687_-	hypothetical protein	NA	I3PUZ7	Vibrio_phage	58.8	1.4e-33
WP_013030064.1|1959689_1962221_-	DNA methylase N-4	NA	A0A1J0GPR3	Mycobacterium_phage	61.5	5.3e-306
WP_013030065.1|1962217_1962520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013030066.1|1962516_1962900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041421213.1|1963054_1963294_-	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	49.2	5.0e-09
>prophage 5
NC_013959	Sideroxydans lithotrophicus ES-1, complete sequence	3003656	1972747	1988494	3003656		Bacillus_phage(18.18%)	17	NA	NA
WP_013030080.1|1972747_1973683_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	33.1	1.7e-39
WP_150102992.1|1973736_1973922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013030082.1|1973915_1975745_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	52.6	1.8e-138
WP_013030083.1|1975741_1976965_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	66.3	3.5e-154
WP_013030084.1|1976961_1977558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013030085.1|1977554_1977911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013030086.1|1977903_1978899_+	phage Gp37/Gp68 family protein	NA	A0A0F6SJL4	Mycobacterium_phage	48.0	1.3e-74
WP_013030087.1|1978895_1979390_+	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	41.3	7.2e-26
WP_013030088.1|1979556_1979949_+	hypothetical protein	NA	F8TUL1	EBPR_podovirus	48.0	1.2e-31
WP_013030089.1|1979945_1980509_+	hypothetical protein	NA	A0A218M303	Acidovorax_phage	38.9	2.2e-34
WP_013030090.1|1980505_1980766_+	DUF4031 domain-containing protein	NA	A0A291LA06	Bordetella_phage	58.0	2.9e-18
WP_013030091.1|1980746_1981049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013030092.1|1981135_1981624_+	single-stranded DNA-binding protein	NA	A0A291LA01	Bordetella_phage	65.5	2.2e-35
WP_013030095.1|1982045_1983620_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	26.7	9.0e-22
WP_150102993.1|1983814_1984192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013030097.1|1984331_1985420_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013030098.1|1985419_1988494_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.3	7.8e-78
>prophage 6
NC_013959	Sideroxydans lithotrophicus ES-1, complete sequence	3003656	2386621	2396745	3003656		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
WP_013030484.1|2386621_2387359_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.3	2.8e-26
WP_013030485.1|2387355_2388102_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013030486.1|2388098_2389427_+	GldG family protein	NA	NA	NA	NA	NA
WP_013030487.1|2389430_2390246_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	29.6	2.3e-21
WP_190272133.1|2390247_2392530_-	bacteriohemerythrin	NA	G3MA91	Bacillus_virus	33.3	8.5e-21
WP_013030489.1|2392745_2393000_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	61.8	5.5e-22
WP_013030490.1|2393011_2393488_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.7	3.1e-26
WP_013030491.1|2393484_2394024_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013030492.1|2394020_2395391_-	insulinase family protein	NA	NA	NA	NA	NA
WP_013030493.1|2395380_2396745_-	insulinase family protein	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	24.8	8.4e-24
