The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011748	Escherichia coli 55989, complete genome	5154862	195810	259057	5154862	transposase,plate,tRNA,protease	Emiliania_huxleyi_virus(11.11%)	51	NA	NA
WP_001346129.1|195810_197163_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|197192_199625_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|199746_200232_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|200235_201261_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|201365_201821_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|201824_202613_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|202612_203761_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|203757_204354_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|204390_207873_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|207885_208845_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|208943_211085_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|211141_211531_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|211595_212894_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|212942_213203_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|213189_213390_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|213555_214101_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|214097_214520_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239154.1|214533_215244_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399656.1|215493_216474_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260716.1|217553_219272_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219383_220091_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220087_220492_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220609_221425_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221464_222118_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222110_223142_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|223329_223902_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|229799_230603_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001352368.1|230713_231922_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000648601.1|231937_232852_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|233092_233893_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|233970_234741_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|234788_236147_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052751.1|236218_236974_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|237007_237730_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917888.1|237726_238194_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|238258_238990_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|239525_240311_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|240447_240927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|240936_241851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284200.1|241894_242377_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|242400_243753_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122987046.1|243763_247198_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240544.1|247306_248722_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|248726_249470_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614396.1|249466_252226_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
WP_000343303.1|252234_252996_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|253000_254332_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|254334_254859_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|254855_256136_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|256160_257243_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393853.1|257206_259057_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NC_011748	Escherichia coli 55989, complete genome	5154862	821225	864801	5154862	head,integrase,capsid,lysis,tail,portal	Enterobacteria_phage(57.69%)	58	819503:819518	843796:843811
819503:819518	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533642.1|821225_822296_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|822273_822492_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|822531_822699_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120064.1|822941_823544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|823754_823976_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|824074_824356_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548541.1|824366_824558_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000682318.1|824530_824713_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|824709_825390_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|825386_826172_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|826177_826474_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|826549_826756_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|827353_828043_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|828147_828378_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|828447_828987_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000147903.1|828983_830003_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_000788812.1|829999_830701_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145901.1|830697_831000_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_001070442.1|831067_831400_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_044168796.1|831448_831559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709099.1|831655_833182_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
WP_000338663.1|833293_833533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|834109_834361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072147432.1|834457_834559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|834555_835011_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|835010_835181_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|835173_835464_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000971074.1|835818_835959_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|836044_836428_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|836616_837699_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|838287_838503_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135297.1|838502_839000_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000092234.1|838996_839434_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001028465.1|839639_840161_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|840510_840921_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|840977_841211_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|841599_842145_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000198149.1|844040_844247_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
843796:843811	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_012601934.1|844243_845845_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	1.0e-310
WP_000123216.1|845825_847145_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001299443.1|847154_847487_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|847542_848568_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|848609_849005_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|849016_849370_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|849381_849960_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|849956_850352_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001390429.1|850359_851100_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000479200.1|851115_851538_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_000459457.1|851519_851954_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840297.1|851946_854508_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
WP_000847379.1|854504_854834_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152576.1|854833_855532_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000140717.1|855537_856281_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_000090917.1|856217_856850_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515639.1|856910_860408_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233090.1|860478_861078_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_001387657.1|861142_864217_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885623.1|864216_864801_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
>prophage 3
NC_011748	Escherichia coli 55989, complete genome	5154862	1079406	1145024	5154862	protease,integrase,holin,terminase,lysis,tail,portal	Escherichia_phage(40.0%)	77	1094491:1094550	1140290:1140351
WP_000156526.1|1079406_1081167_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1081352_1081805_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1081880_1082921_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1083277_1083787_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1084005_1084635_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875044.1|1084597_1086760_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261243.1|1086769_1087216_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420536.1|1087338_1089393_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_001386685.1|1089424_1089883_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847785.1|1089978_1090641_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1090813_1091227_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1091271_1091589_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1091646_1092837_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048243.1|1092931_1093210_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1093206_1093536_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1093626_1094286_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1094491:1094550	attL	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGAC	NA	NA	NA	NA
WP_001299351.1|1094693_1095713_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1095690_1095933_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048485.1|1096000_1098493_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	7.3e-58
WP_000199480.1|1098588_1098777_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1098773_1098962_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001440583.1|1099361_1099481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171958.1|1099529_1099748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379557.1|1099907_1100063_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000787428.1|1100270_1100678_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|1100754_1100982_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|1100965_1101517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020540.1|1101488_1102529_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.6	2.4e-87
WP_072130322.1|1102440_1102983_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450707.1|1103016_1103787_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_001151117.1|1103802_1104225_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	3.3e-64
WP_001275729.1|1104221_1104710_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	9.2e-66
WP_000520323.1|1104702_1104957_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	90.5	1.5e-40
WP_001002676.1|1104949_1105261_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	3.4e-58
WP_001224665.1|1105389_1105572_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753058.1|1105564_1105741_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_001290001.1|1105737_1106253_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	1.0e-35
WP_000813254.1|1107588_1107744_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980988.1|1107960_1108212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405664.1|1108278_1108557_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
WP_001265110.1|1108558_1109614_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	2.0e-89
WP_000140010.1|1109614_1109995_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	1.3e-35
WP_000762888.1|1109991_1110813_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	3.2e-79
WP_000917767.1|1111039_1111237_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000935509.1|1111387_1112437_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	6.8e-199
WP_000143130.1|1113225_1115088_+	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
WP_000284510.1|1115237_1115453_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731189.1|1115457_1116264_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	97.4	3.2e-148
WP_000551290.1|1116273_1116588_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_001092910.1|1116716_1117250_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_032140280.1|1117804_1117891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001342872.1|1117892_1118360_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	90.9	1.0e-69
WP_000348552.1|1118812_1119289_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	95.6	2.9e-80
WP_001077619.1|1119285_1121409_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000102415.1|1121405_1121618_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974569.1|1121617_1123120_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.6	1.6e-289
WP_148713112.1|1123109_1125089_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	Q8VNN5	Enterobacteria_phage	99.7	0.0e+00
WP_001097059.1|1125176_1125503_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_001281345.1|1125495_1125777_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
WP_000974955.1|1125779_1126403_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_000682719.1|1126415_1126814_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	2.9e-70
WP_001007216.1|1126821_1127568_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	91.4	2.6e-120
WP_000479075.1|1127586_1128018_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	6.2e-42
WP_000533397.1|1128044_1128449_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	6.9e-43
WP_000918285.1|1128438_1131042_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
WP_000847345.1|1131041_1131371_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152484.1|1131370_1132069_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_000140709.1|1132073_1132817_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	2.9e-143
WP_000090896.1|1132753_1133386_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.1e-95
WP_000515510.1|1133446_1136842_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.2	0.0e+00
WP_001228258.1|1136909_1137509_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	1.7e-101
WP_000216474.1|1137660_1139064_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	92.2	8.0e-54
WP_000227780.1|1139072_1139681_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	44.7	2.2e-37
WP_001058323.1|1140805_1141924_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1140290:1140351	attR	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|1141920_1143714_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1143732_1144440_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003662.1|1144436_1145024_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NC_011748	Escherichia coli 55989, complete genome	5154862	1408279	1472109	5154862	protease,head,integrase,capsid,terminase,holin,lysis,tail,portal	Enterobacteria_phage(32.65%)	73	1408116:1408143	1458304:1458331
1408116:1408143	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113667.1|1408279_1409410_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1409387_1409636_-	excisionase	NA	NA	NA	NA	NA
WP_000048525.1|1409700_1412172_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.5	2.3e-56
WP_001090200.1|1412264_1412456_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1412452_1412641_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001295058.1|1413207_1413402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|1413390_1413729_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379548.1|1413740_1413893_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001003382.1|1414085_1414493_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	3.3e-24
WP_000476993.1|1414570_1414798_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|1414781_1415303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|1415283_1416249_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151218.1|1416289_1416712_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.8	4.8e-63
WP_000566846.1|1416964_1417864_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001373963.1|1418178_1418832_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000892866.1|1418844_1419540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1420225_1420438_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000980987.1|1420654_1420906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515373.1|1420972_1421251_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_001265117.1|1421252_1422302_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.4e-108
WP_000904125.1|1422314_1422674_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	3.6e-35
WP_001064911.1|1422670_1423360_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	45.1	3.1e-51
WP_001336255.1|1423431_1424271_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	40.2	1.8e-45
WP_000615423.1|1424267_1425011_+	protein phosphatase 2C domain-containing protein	NA	I6PCV8	Cronobacter_phage	43.1	1.6e-48
WP_077466990.1|1425121_1425448_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.8	2.0e-45
WP_000874529.1|1426723_1428580_+	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	88.4	0.0e+00
WP_000284510.1|1428730_1428946_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193273.1|1428950_1429265_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_001274715.1|1429320_1429854_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	2.5e-101
WP_000091923.1|1429850_1430309_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	87.5	3.3e-65
WP_000654791.1|1430725_1431346_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	2.3e-53
WP_000077906.1|1431287_1432355_-	beta family protein	NA	NA	NA	NA	NA
WP_001102145.1|1432759_1433308_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_024174608.1|1433279_1435208_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.7	9.4e-263
WP_000259002.1|1435191_1435398_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_005104612.1|1435394_1436987_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_001253900.1|1436976_1438482_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.6	8.7e-99
WP_000256824.1|1438518_1438866_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000522589.1|1438923_1439952_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	7.3e-113
WP_000201501.1|1440003_1440387_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204556.1|1440379_1440733_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000975016.1|1440747_1441323_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.3	1.7e-47
WP_000798775.1|1441319_1441715_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	9.7e-58
WP_000235111.1|1441722_1442475_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000479111.1|1442488_1442920_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|1442946_1443360_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082387.1|1443340_1445914_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
WP_000847298.1|1445910_1446240_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_012601969.1|1446239_1446938_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	3.2e-128
WP_000194724.1|1446948_1447692_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.1e-147
WP_072129443.1|1447637_1448270_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	2.1e-102
WP_000514729.1|1448612_1452086_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_001233190.1|1452153_1452753_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	1.7e-106
WP_000216491.1|1452904_1456075_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.3	2.0e-84
WP_000885567.1|1456074_1456659_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.1e-101
WP_000240999.1|1456713_1457382_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1457438_1457708_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1457822_1457993_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079509.1|1458481_1458988_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1458304:1458331	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1459033_1459534_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1459619_1459799_-	general stress protein	NA	NA	NA	NA	NA
WP_000443069.1|1460179_1460986_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1460985_1462179_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|1462190_1463552_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1463552_1465148_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194599.1|1465147_1466710_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|1466801_1466846_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1466983_1467865_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1467861_1468482_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1468582_1469455_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1469494_1470085_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|1470081_1470840_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|1471059_1472109_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NC_011748	Escherichia coli 55989, complete genome	5154862	1757735	1804588	5154862	protease,integrase,transposase,terminase,lysis,tail,portal	Enterobacteria_phage(43.18%)	54	1770958:1770973	1809501:1809516
WP_012601982.1|1757735_1758317_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279144.1|1758316_1761280_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.6e-54
WP_001230274.1|1761344_1761944_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	7.0e-108
WP_000515371.1|1762013_1765427_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_012601983.1|1765487_1766135_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	5.6e-111
WP_012601984.1|1766032_1766776_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.7e-151
WP_001152385.1|1766781_1767480_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|1767489_1767819_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372012.1|1767818_1770875_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.9	0.0e+00
WP_001161009.1|1770846_1771176_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
1770958:1770973	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_001420256.1|1771184_1771571_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	98.4	8.0e-65
WP_000211095.1|1771631_1772375_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.2	5.0e-132
WP_001079416.1|1772385_1772787_-|tail	phage tail protein U	tail	A5LH34	Enterobacteria_phage	98.5	4.1e-72
WP_000677112.1|1772783_1773362_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001283152.1|1773373_1773649_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_001097046.1|1773641_1773965_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001136591.1|1774051_1776079_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.8	0.0e+00
WP_000985943.1|1776023_1777532_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.8	3.5e-289
WP_001072975.1|1777531_1777744_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934127.1|1777740_1779843_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
WP_000373425.1|1779842_1780337_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000548585.1|1780889_1781096_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	77.9	7.6e-22
WP_012601992.1|1781383_1781794_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	78.5	1.6e-55
WP_001082503.1|1782113_1782578_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	5.9e-62
WP_001274706.1|1782876_1783410_-	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.7e-97
WP_000192454.1|1783465_1783780_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	97.1	9.1e-51
WP_000839561.1|1783784_1784000_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001348108.1|1784251_1784626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|1784797_1785226_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_029380182.1|1785592_1785721_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000762863.1|1786619_1787441_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_000904112.1|1787437_1787812_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001265278.1|1787824_1788874_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_032213612.1|1788875_1789154_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_012601996.1|1789220_1789472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1789688_1789844_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_122083109.1|1789945_1790053_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000379313.1|1790431_1791457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151219.1|1791684_1792110_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.8e-62
WP_000054487.1|1792150_1793116_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705359.1|1793096_1793618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|1793601_1793829_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1793909_1794317_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379589.1|1794485_1794641_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344944.1|1794642_1795218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1795704_1795893_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083282.1|1795889_1796081_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048303.1|1796174_1798646_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.1e-58
WP_000005552.1|1798718_1798970_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876979.1|1799004_1800285_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	8.6e-156
WP_001360138.1|1800304_1800415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|1801317_1802526_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001295394.1|1802841_1804056_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1804261_1804588_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
1809501:1809516	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
>prophage 6
NC_011748	Escherichia coli 55989, complete genome	5154862	2104499	2196379	5154862	head,integrase,plate,capsid,transposase,terminase,holin,tail,tRNA,portal	Enterobacteria_phage(66.67%)	106	2142027:2142086	2177671:2177794
WP_000564745.1|2104499_2105471_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176815.1|2105635_2108065_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2108089_2109190_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185740.1|2109577_2110324_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001326063.1|2110337_2110904_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025327.1|2111119_2112853_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001299676.1|2113029_2113518_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|2113637_2114030_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|2114029_2116108_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278936.1|2116100_2117249_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|2117450_2118095_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2118105_2118495_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036379.1|2118509_2119559_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|2119561_2120422_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483221.1|2120440_2122042_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001370571.1|2122087_2123749_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000147302.1|2123893_2124397_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|2124417_2126382_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2126386_2127313_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906340.1|2127309_2128197_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2128323_2128902_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2128904_2129255_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122437.1|2130033_2130462_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2130468_2131893_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001299673.1|2131867_2132668_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100205.1|2132834_2133821_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2133835_2135350_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|2135419_2136409_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2137205_2137709_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2137787_2138039_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2138153_2138240_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237875.1|2138502_2138826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2138997_2139495_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2139532_2139772_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|2139961_2141173_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847876.1|2141234_2141900_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2142027:2142086	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_000116244.1|2142256_2143258_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865209.1|2143263_2143611_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290355.1|2143640_2144291_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|2144306_2144711_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2144800_2144938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2145009_2145213_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000159466.1|2145596_2145875_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	6.2e-35
WP_000514281.1|2145886_2146129_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_000021670.1|2146125_2146239_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	5.8e-08
WP_000985146.1|2146325_2146529_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	1.1e-25
WP_000153684.1|2146525_2146771_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000599413.1|2146912_2147278_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.1e-60
WP_000123434.1|2147284_2150107_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.9	0.0e+00
WP_000686557.1|2150183_2151143_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	8.4e-180
WP_000211293.1|2151147_2151462_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000201254.1|2151481_2151913_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224220.1|2151914_2152178_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_000087799.1|2152689_2153736_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	3.3e-206
WP_000613804.1|2153735_2155487_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262681.1|2155641_2156478_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
WP_001055095.1|2156501_2157554_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	93.4	2.7e-187
WP_000632367.1|2157599_2158400_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	86.8	7.9e-123
WP_000063074.1|2158503_2158998_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_000864893.1|2158997_2159198_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	3.0e-31
WP_000104351.1|2159200_2159524_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	3.6e-50
WP_000072319.1|2159520_2159913_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	3.2e-69
WP_000780566.1|2159909_2160317_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
WP_000202153.1|2160455_2162336_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	2.1e-299
WP_000921130.1|2162359_2162827_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	1.3e-82
WP_000356335.1|2162819_2163455_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_077626052.1|2163466_2164033_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	2.8e-98
WP_001067548.1|2164050_2164380_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111919.1|2164383_2165280_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	2.3e-155
WP_000071727.1|2165272_2165881_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.4	7.6e-86
WP_000125666.1|2165877_2167893_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.0	1.9e-93
WP_000885636.1|2167892_2168471_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	90.1	2.7e-96
WP_000954200.1|2168514_2169087_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|2169243_2169732_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_001388248.1|2169744_2172552_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000333503.1|2172538_2172694_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2172702_2173077_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|2173132_2173645_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005382.1|2173644_2174829_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	2.0e-223
WP_000132825.1|2174986_2176096_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	9.0e-194
WP_000488112.1|2176138_2176399_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2176590_2176731_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001303543.1|2176919_2177201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160187.1|2178193_2178742_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2177671:2177794	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_001283421.1|2178798_2180631_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000611335.1|2180627_2181284_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_000590344.1|2181579_2181756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106474.1|2181742_2181967_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001152713.1|2182034_2182757_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_001272991.1|2182986_2183739_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001158220.1|2183735_2184404_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001128215.1|2184418_2185405_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001317901.1|2185509_2186310_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001386865.1|2186397_2186949_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001087467.1|2186994_2187714_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_000079759.1|2187877_2188927_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146830.1|2189174_2190590_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000270663.1|2190605_2191016_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001057844.1|2191015_2191381_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245699.1|2191458_2192946_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001295642.1|2192979_2193393_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118890.1|2193579_2194785_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2194781_2195015_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000334575.1|2195123_2195621_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	64.5	3.8e-51
WP_001336494.1|2195502_2195832_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_048814997.1|2195854_2196379_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.2	1.9e-32
>prophage 7
NC_011748	Escherichia coli 55989, complete genome	5154862	2632434	2710113	5154862	head,integrase,transposase,terminase,lysis,tRNA,portal	Enterobacteria_phage(43.75%)	95	2662248:2662264	2712566:2712582
WP_001283590.1|2632434_2633247_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2633246_2634260_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699126.1|2634325_2635462_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.6e-23
WP_000615821.1|2635560_2636556_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|2636552_2637731_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2638023_2639244_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683791.1|2639402_2641409_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2641529_2641808_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2641841_2642390_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2642389_2643199_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043820.1|2643198_2644023_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2644026_2645112_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2645146_2646079_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730807.1|2646244_2646796_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000399648.1|2646989_2647970_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001356216.1|2648196_2649069_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|2649055_2649580_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2649576_2650047_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2650043_2650592_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|2650566_2651319_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296855.1|2651338_2653981_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2654062_2654626_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2655300_2655786_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426166.1|2655988_2658133_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531990.1|2658132_2659443_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2659622_2659907_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2660278_2661619_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937848.1|2661984_2663043_+	hypothetical protein	NA	NA	NA	NA	NA
2662248:2662264	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|2663224_2663980_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2664273_2665206_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958672.1|2665517_2666675_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
WP_000178979.1|2666895_2668806_+	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000129896.1|2668876_2670856_-|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	93.5	2.8e-60
WP_001407254.1|2670958_2671246_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	64.2	7.9e-25
WP_001085225.1|2671260_2671482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000143223.1|2671481_2672210_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	66.8	4.0e-81
WP_001525195.1|2672298_2673009_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	71.0	1.1e-86
WP_000655894.1|2672998_2673172_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	89.1	1.5e-18
WP_000033146.1|2673283_2673604_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	92.9	8.7e-41
WP_001085430.1|2673702_2673882_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757526.1|2673895_2674261_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_000832790.1|2674291_2674519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000179846.1|2674515_2676639_-	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	29.5	1.6e-50
WP_000257027.1|2676623_2677967_-	DNA transfer protein	NA	A0A0M5M1J8	Salmonella_phage	89.7	2.2e-218
WP_000964864.1|2677977_2678670_-	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	100.0	3.0e-118
WP_000614037.1|2678672_2679128_-	DUF2824 family protein	NA	A0A088CQ57	Enterobacteria_phage	99.3	8.8e-87
WP_000785535.1|2679127_2679976_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	92.9	5.8e-100
WP_001122376.1|2679975_2681394_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.2	1.6e-275
WP_000246749.1|2681402_2681885_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_000375637.1|2681859_2682045_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_001133485.1|2682087_2683359_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000426730.1|2683370_2684255_-	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_000852331.1|2684268_2686395_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.2	0.0e+00
WP_000200764.1|2686397_2687810_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	100.0	1.5e-278
WP_000179914.1|2687806_2688232_-	hypothetical protein	NA	Q716H4	Shigella_phage	90.1	3.2e-67
WP_000807788.1|2688311_2688554_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999675.1|2688657_2689038_-	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	3.2e-66
WP_000191869.1|2689271_2689751_-	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	60.4	1.1e-55
WP_032350523.1|2689832_2689985_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	6.8e-20
WP_001407257.1|2689972_2690410_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	3.8e-71
WP_001504512.1|2690406_2690904_-	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	99.4	2.9e-91
WP_000286100.1|2690881_2691085_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000027552.1|2691875_2692364_-	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	98.8	1.7e-88
WP_000994516.1|2692360_2692549_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2692545_2692908_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002235.1|2692904_2693195_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003987.1|2693194_2693917_-	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	99.2	1.6e-130
WP_000566861.1|2693909_2694080_-	protein ninF	NA	K7P6X0	Enterobacteria_phage	100.0	5.5e-26
WP_001254251.1|2694076_2694259_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000814617.1|2694255_2694666_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_000344570.1|2694865_2695180_-	hypothetical protein	NA	K7PKU8	Enterobacteria_phage	95.2	1.4e-51
WP_000807325.1|2695197_2695404_-	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	97.1	6.9e-31
WP_000131505.1|2695479_2696916_-	AAA family ATPase	NA	G5DA90	Enterobacteria_phage	99.4	5.1e-274
WP_000539338.1|2696905_2697796_-	hypothetical protein	NA	K7PH45	Enterobacterial_phage	100.0	1.4e-160
WP_000166961.1|2697782_2697944_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000424164.1|2697978_2698257_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	100.0	3.6e-43
WP_000276886.1|2698365_2698551_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2698631_2699282_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219331.1|2700053_2700353_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	87.9	3.4e-31
WP_000167595.1|2700361_2700832_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001183771.1|2701026_2701197_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000050554.1|2701272_2701443_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031367.1|2701453_2702059_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951329.1|2702058_2702442_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_001111299.1|2702465_2702762_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
WP_032159494.1|2702781_2703063_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001214454.1|2703059_2703227_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_000034245.1|2703223_2703895_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_000951713.1|2704257_2704467_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208008.1|2704463_2705093_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_001277767.1|2705189_2705369_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001163428.1|2705500_2705701_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197025.1|2706230_2707478_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2707549_2708464_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2708679_2710113_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
2712566:2712582	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NC_011748	Escherichia coli 55989, complete genome	5154862	3070715	3077855	5154862		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3070715_3073277_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141316.1|3073382_3074039_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001297141.1|3074089_3074857_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3075052_3075961_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3075957_3077220_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3077216_3077855_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 9
NC_011748	Escherichia coli 55989, complete genome	5154862	3310508	3365085	5154862	transposase,tRNA,protease,integrase	Staphylococcus_phage(20.0%)	43	3311493:3311510	3355658:3355675
WP_000701841.1|3310508_3311267_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105559.1|3311472_3312393_-	agmatinase	NA	NA	NA	NA	NA
3311493:3311510	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758915.1|3312528_3313260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3313405_3315382_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3315390_3315522_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3315657_3315873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3316176_3317331_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3317766_3319161_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3319237_3319735_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3319829_3320537_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|3320616_3321348_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3321360_3322311_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3322419_3322983_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3322982_3323399_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001349546.1|3323574_3324555_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3324572_3325277_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3325294_3325861_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3325857_3326148_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|3326155_3326749_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239939.1|3326741_3327878_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|3328032_3329040_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|3329156_3330203_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3330378_3331098_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3331281_3331608_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3331607_3332327_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|3332487_3333540_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3333567_3333843_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|3333907_3334987_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3335188_3336445_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839766.1|3336494_3338630_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3339027_3339735_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218809.1|3340113_3341376_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_000286652.1|3343586_3346436_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001273465.1|3346461_3347442_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000126412.1|3347451_3349839_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000105162.1|3349848_3351477_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000081335.1|3351479_3354350_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001091149.1|3354438_3354732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747051.1|3354801_3355152_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001254932.1|3355071_3356223_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3355658:3355675	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_000624688.1|3359213_3359564_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|3359560_3359995_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001045649.1|3360966_3365085_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
>prophage 10
NC_011748	Escherichia coli 55989, complete genome	5154862	3376122	3427057	5154862	transposase,plate	uncultured_marine_virus(25.0%)	45	NA	NA
WP_001154665.1|3376122_3377535_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000152747.1|3377553_3378105_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001033155.1|3378112_3379189_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001390299.1|3379192_3379492_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000005080.1|3379501_3379969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000198270.1|3379979_3381962_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_001173973.1|3381974_3382907_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001390300.1|3382897_3384700_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000555549.1|3384692_3385115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233190.1|3385124_3385631_-	type VI secretion system protein AaiC/Hcp2	NA	NA	NA	NA	NA
WP_000215053.1|3385640_3387119_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000072549.1|3387121_3387598_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001352368.1|3388043_3389252_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001420591.1|3390353_3390479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014966195.1|3390456_3390843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387054.1|3391662_3391986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387055.1|3392051_3392696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226517.1|3392716_3392986_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502863.1|3393064_3393709_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.0	3.0e-56
WP_001204642.1|3393693_3394926_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.3	2.3e-60
WP_000370895.1|3394966_3395797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000586175.1|3395799_3396360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200211.1|3396574_3397942_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001390303.1|3398366_3400112_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_044168561.1|3400347_3401550_-	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	60.6	7.8e-66
WP_001403987.1|3401746_3402148_-	hypothetical protein	NA	A0A0R6PKW9	Moraxella_phage	71.9	1.5e-05
WP_001137932.1|3402304_3402736_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000974469.1|3402738_3403275_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000553781.1|3403255_3404356_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000342463.1|3404310_3406074_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000115357.1|3406081_3406774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146515.1|3406775_3408374_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001037088.1|3408373_3411763_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_001403985.1|3411755_3412904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033410.1|3412907_3413174_-	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	6.9e-07
WP_000196357.1|3413205_3413883_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_000196359.1|3414026_3414704_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_000170556.1|3414723_3416406_-	T6SS effector phospholipase Tle1-EAEC	NA	NA	NA	NA	NA
WP_001054503.1|3416402_3418928_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000148361.1|3419450_3420017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431645.1|3420013_3422671_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.5	5.7e-93
WP_001007313.1|3422839_3423331_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000558483.1|3423336_3425067_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001040045.1|3425069_3425723_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000708637.1|3425719_3427057_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 11
NC_011748	Escherichia coli 55989, complete genome	5154862	4737449	4807925	5154862	transposase,tRNA,protease,integrase	Pseudomonas_phage(33.33%)	35	4739616:4739630	4809207:4809221
WP_001295074.1|4737449_4738967_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856837.1|4739203_4740661_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	5.2e-48
4739616:4739630	attL	AAGCCAAAGGCAAAC	NA	NA	NA	NA
WP_001295383.1|4740719_4742867_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|4742946_4744281_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|4744646_4746185_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_001290187.1|4746933_4747776_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772029.1|4747860_4748058_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761715.1|4748077_4748566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094430.1|4748562_4748940_-	toxin	NA	NA	NA	NA	NA
WP_001285620.1|4748986_4749364_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692350.1|4749443_4749665_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001387238.1|4749751_4750228_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855057.1|4750243_4750717_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.1e-12
WP_001189118.1|4752652_4754161_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001387241.1|4755125_4757321_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750143.1|4757326_4758664_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015711.1|4758660_4760403_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287497.1|4760402_4761350_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001387605.1|4761350_4763075_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074478.1|4763210_4764404_+	MFS transporter	NA	NA	NA	NA	NA
WP_001387604.1|4764353_4765280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555384.1|4766019_4767153_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189118.1|4767764_4769273_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001390760.1|4771262_4772387_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_001045649.1|4773548_4777667_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_001189118.1|4778394_4779903_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000477619.1|4782656_4782983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|4784433_4786524_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000080206.1|4787128_4788742_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.6e-170
WP_001189111.1|4790359_4791868_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000422750.1|4792702_4793128_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_000291751.1|4795738_4796320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034110.1|4796366_4800224_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000344103.1|4802694_4806210_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001218804.1|4806662_4807925_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
4809207:4809221	attR	GTTTGCCTTTGGCTT	NA	NA	NA	NA
>prophage 12
NC_011748	Escherichia coli 55989, complete genome	5154862	4917419	4981813	5154862	transposase,tRNA,integrase	uncultured_marine_virus(23.08%)	57	4920465:4920479	4965646:4965660
WP_000399648.1|4917419_4918400_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|4918676_4919063_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4919135_4919597_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013042.1|4919609_4920545_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	3.8e-52
4920465:4920479	attL	TGTCGCCAGCACCAG	NA	NA	NA	NA
WP_001296693.1|4920548_4920683_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|4920963_4921359_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500725.1|4921489_4922203_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256656.1|4922273_4922867_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|4923011_4923464_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_001387612.1|4923586_4924906_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001387613.1|4924917_4925148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|4925248_4926253_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4926414_4926831_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059422.1|4926876_4927380_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079641.1|4927572_4928769_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416376.1|4928824_4931680_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|4931679_4932123_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4932256_4933768_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4934034_4935135_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4935134_4936217_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294558.1|4936335_4937838_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
WP_001349989.1|4937915_4938914_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|4938980_4940300_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|4940364_4941129_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197416.1|4941152_4942184_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896735.1|4942400_4942964_+	gluconokinase	NA	NA	NA	NA	NA
WP_000061766.1|4942967_4943987_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_001218930.1|4944453_4945719_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_012602112.1|4946042_4947542_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001477155.1|4947715_4948456_-	porin family protein	NA	NA	NA	NA	NA
WP_001274542.1|4949068_4950718_+	DNA phosphorothioation-dependent restriction protein DptF	NA	NA	NA	NA	NA
WP_000283233.1|4950722_4952048_+	DNA phosphorothioation-dependent restriction protein DptG	NA	NA	NA	NA	NA
WP_000114120.1|4952028_4957083_+	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
WP_001327223.1|4957120_4957639_+	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_000071509.1|4957639_4957945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533805.1|4957993_4958800_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_000937304.1|4958858_4959215_-	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
WP_000905895.1|4959214_4961215_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_000041168.1|4961204_4962839_-	DNA phosphorothioation system sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.9	6.1e-21
WP_000179014.1|4962835_4963921_-	DNA sulfur modification protein DndB	NA	NA	NA	NA	NA
WP_000258195.1|4964383_4964557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166952.1|4964553_4964898_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	38.4	3.1e-07
WP_001167422.1|4964916_4965465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000831911.1|4965552_4965711_-	hypothetical protein	NA	NA	NA	NA	NA
4965646:4965660	attR	TGTCGCCAGCACCAG	NA	NA	NA	NA
WP_000958149.1|4965707_4965944_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991584.1|4966012_4966588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|4967417_4968626_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001352368.1|4969247_4970456_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000562370.1|4971978_4972299_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|4972291_4972678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|4972685_4973372_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|4973349_4973973_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|4974054_4975260_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|4975372_4975966_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001352368.1|4976479_4977688_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001611300.1|4977757_4977895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|4980651_4981813_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 13
NC_011748	Escherichia coli 55989, complete genome	5154862	4989099	5039275	5154862	transposase,holin,terminase,integrase	Enterobacteria_phage(25.0%)	49	4998356:4998370	5026530:5026544
WP_123906543.1|4989099_4989594_+|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_001295213.1|4989607_4990630_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_024174622.1|4990629_4991409_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	4.9e-138
WP_001075491.1|4991624_4992356_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000778605.1|4993025_4993556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110727.1|4995175_4996030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126799.1|4996026_4996989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010383.1|4997094_4997979_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_001282919.1|4998181_4998862_+	WYL domain-containing protein	NA	NA	NA	NA	NA
4998356:4998370	attL	TACAGAAATGGCAGG	NA	NA	NA	NA
WP_001097301.1|4999009_4999687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278287.1|4999692_4999926_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001175163.1|5000015_5000834_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	1.9e-47
WP_000206664.1|5000925_5001411_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001186165.1|5001425_5001902_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|5001988_5002210_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001285607.1|5002289_5002658_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094443.1|5002747_5003125_+	toxin	NA	NA	NA	NA	NA
WP_000761685.1|5003121_5003610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327226.1|5003629_5003827_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001290178.1|5003911_5004058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142493.1|5004470_5005397_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001223819.1|5005386_5007006_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001143292.1|5008306_5008600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202281.1|5008967_5009840_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001178761.1|5010084_5010465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099275.1|5012003_5012300_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001104341.1|5012929_5014006_+	Fic family protein	NA	NA	NA	NA	NA
WP_000729465.1|5014056_5014686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114712.1|5015596_5016421_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351184.1|5016586_5018143_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000859648.1|5018142_5018832_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001215044.1|5018943_5019108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416151.1|5021077_5022109_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|5022379_5022823_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|5022838_5023126_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|5023138_5024395_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|5024641_5024896_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|5025317_5026331_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998350.1|5026342_5027659_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
5026530:5026544	attR	CCTGCCATTTCTGTA	NA	NA	NA	NA
WP_000350265.1|5027686_5028607_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|5028912_5029695_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080200.1|5030878_5032492_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|5032522_5032873_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422739.1|5032869_5033295_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001422798.1|5033433_5033562_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145474.1|5033742_5034399_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000625669.1|5034644_5035922_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|5035984_5037982_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|5038135_5039275_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
