The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	720890	773583	4965553	lysis,holin,terminase,transposase,capsid,tail,integrase,head,portal	Enterobacteria_phage(48.39%)	74	720803:720817	771763:771777
720803:720817	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000533654.1|720890_721961_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|721938_722157_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545741.1|722196_722364_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_000002111.1|722436_722721_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	96.8	1.0e-48
WP_000208133.1|722713_723346_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	90.5	2.0e-81
WP_000360279.1|723356_723554_-	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	84.6	1.5e-30
WP_001339358.1|723555_723951_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	96.9	3.3e-66
WP_001014291.1|723953_724145_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_000034177.1|724146_724785_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.3	1.0e-93
WP_000004315.1|724771_725041_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	55.2	1.1e-17
WP_001214458.1|725037_725205_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	1.2e-22
WP_001111304.1|725215_725512_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000098523.1|725525_726032_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_000018648.1|726028_726496_-	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	61.3	1.0e-45
WP_000365292.1|726496_727204_-	recombinase	NA	Q716E7	Shigella_phage	99.6	3.8e-137
WP_001183771.1|727458_727629_-	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000065351.1|727704_728073_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000387878.1|728252_728576_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	98.1	2.5e-59
WP_001077327.1|728638_728863_-	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	100.0	8.0e-33
WP_000216182.1|728866_729175_-	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	69.6	3.0e-30
WP_000971597.1|729173_729386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633167.1|729617_730442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250470.1|730646_731354_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
WP_001180318.1|731432_731660_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438488.1|731766_732066_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	97.0	1.4e-48
WP_000062366.1|732228_733005_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	98.4	2.1e-136
WP_012578852.1|733112_734993_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
WP_000736893.1|735070_735511_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	1.6e-80
WP_001254251.1|735507_735690_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000567008.1|735686_735866_+	protein ninF	NA	M1FPE8	Enterobacteria_phage	86.0	1.7e-14
WP_024201048.1|736225_736399_+	ninF	NA	NA	NA	NA	NA
WP_000237093.1|736388_736781_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	35.3	2.9e-14
WP_000002251.1|736773_737064_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_000994516.1|737419_737608_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|737819_738779_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|739117_739240_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097234.1|739254_739944_+	hypothetical protein	NA	I6PDF8	Cronobacter_phage	47.6	4.5e-58
WP_001302581.1|740128_740872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|740957_741116_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023276.1|741414_743265_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_024164617.1|743703_743919_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|743918_744416_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|744412_744850_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000881326.1|744999_745617_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|745804_745999_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235436.1|746393_746903_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012578855.1|746874_748803_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.2e-262
WP_000259002.1|748786_748993_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012578856.1|748989_750582_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_001254036.1|750571_752077_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256818.1|752113_752461_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|752518_753547_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|753598_753973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204536.1|753965_754319_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	6.7e-42
WP_000975033.1|754333_754867_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.9e-57
WP_000683066.1|754863_755259_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000106788.1|755266_756019_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.8	8.2e-130
WP_000479086.1|756032_756464_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|756490_756904_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082311.1|756884_759446_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	93.6	0.0e+00
WP_000847401.1|759442_759772_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001152649.1|759771_760470_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000140734.1|760475_761219_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.0e-148
WP_000090850.1|761155_761758_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000515449.1|761818_765232_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.0	0.0e+00
WP_001233161.1|765301_765901_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.5	6.7e-111
WP_000279191.1|765965_767279_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.7	4.4e-78
WP_001101709.1|767280_767550_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	96.6	2.7e-43
WP_000950983.1|767655_768537_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	3.3e-146
WP_001002868.1|770012_770393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|770476_770698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|770710_771364_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767425.1|771867_772344_-	kinase inhibitor	NA	NA	NA	NA	NA
771763:771777	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000817269.1|772452_773583_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
>prophage 2
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	816285	925828	4965553	lysis,protease,tRNA,terminase,plate,head,capsid,tail,integrase,transposase,portal	Salmonella_phage(60.71%)	113	852346:852371	886489:886514
WP_000526113.1|816285_816744_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_001054650.1|816856_818440_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001001761.1|818711_818840_-	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_000091016.1|819025_819493_+	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_000056448.1|819489_820608_+	anion transporter	NA	NA	NA	NA	NA
WP_001056384.1|820665_821586_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000961458.1|821804_823397_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114251.1|823596_824412_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209390.1|824556_826989_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	1.4e-08
WP_001340108.1|826994_827894_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424899.1|828024_828687_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	6.3e-25
WP_000829253.1|828762_829512_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397327.1|829511_830747_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513804.1|830950_831916_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001409358.1|831902_833774_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
WP_000090150.1|833793_835332_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936024.1|835349_836270_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|836272_837184_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_000950329.1|837360_839709_+	CHASE9 sensor domain-containing protein	NA	NA	NA	NA	NA
WP_000086882.1|839716_841045_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|841091_842417_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497141.1|842629_843013_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555018.1|843123_844239_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001340105.1|844235_844862_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|845108_846311_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450116.1|846357_847116_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|847173_847770_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180089.1|848054_849287_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000605482.1|849327_849612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578860.1|849697_850513_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217870.1|850512_851721_-	MFS transporter	NA	NA	NA	NA	NA
WP_001295903.1|851804_852341_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
852346:852371	attL	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290941.1|852445_853498_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.1e-105
WP_000649630.1|853584_855102_-	NTPase	NA	R9TRQ8	Vibrio_phage	34.4	4.8e-44
WP_000107166.1|855127_856051_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.8	2.1e-34
WP_000051080.1|856101_856671_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	2.7e-37
WP_000804007.1|856796_857018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460902.1|857050_857560_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	5.1e-83
WP_000956184.1|857567_857768_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
WP_000963473.1|857731_858073_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244228.1|858140_858374_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|858373_858601_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104133.1|858597_859455_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	2.1e-158
WP_000017609.1|859451_861866_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.1	0.0e+00
WP_001154431.1|862020_862209_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|862219_862453_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|862645_862981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324531.1|864074_865049_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000520398.1|865073_866099_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	2.0e-171
WP_001098422.1|866098_867865_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216246.1|868007_868841_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	1.4e-122
WP_000742523.1|868857_869916_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_000059192.1|869919_870570_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_000673512.1|870665_871130_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	6.0e-75
WP_000868175.1|871129_871333_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|871336_871552_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069909.1|871532_872045_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727846.1|872046_872424_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001080937.1|872420_872849_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	1.1e-46
WP_001039945.1|872944_873376_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000104819.1|873730_874792_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.0	2.0e-150
WP_001086818.1|874788_875394_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_000268309.1|875386_876295_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_000177580.1|876281_876641_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000993763.1|876637_877216_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000575294.1|877307_878453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905023.1|878570_879137_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_000249532.1|879279_880452_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.5	6.6e-203
WP_001207667.1|880461_880977_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|881031_881334_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|881348_881468_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282790.1|881460_884538_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.5	0.0e+00
WP_000980387.1|884534_885020_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_001011806.1|885016_886117_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	1.0e-176
WP_000972391.1|886204_886423_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|886658_888344_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
886489:886514	attR	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|888613_888991_+	membrane protein	NA	NA	NA	NA	NA
WP_001195231.1|889020_889278_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201578.1|889437_889725_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189166.1|889708_890431_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|890491_891394_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|891481_891958_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|892307_893420_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|893514_894648_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105422.1|894657_895611_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|895607_896453_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|896512_897001_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149710.1|897041_898169_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
WP_001295905.1|898197_898929_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|899154_899823_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|899822_900539_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|900545_901277_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|901294_902023_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001295906.1|902240_902756_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|902881_903205_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255161.1|903201_904032_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	29.4	7.4e-07
WP_001305933.1|904028_905042_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136526.1|905140_906571_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566381.1|906581_907583_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815374.1|907619_909338_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000178693.1|909470_910439_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|910450_912103_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491136.1|912246_913146_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|913629_914325_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599803.1|914750_916409_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|916405_917362_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746481.1|917512_918628_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188123.1|918624_920571_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	8.5e-38
WP_000410785.1|920643_920868_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520792.1|921190_921511_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|921541_923818_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|924620_924839_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241681.1|925123_925828_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 3
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	1038705	1148661	4965553	lysis,protease,holin,terminase,tail,integrase,transposase,portal	Enterobacteria_phage(50.0%)	106	1085463:1085486	1139595:1139618
WP_000066490.1|1038705_1038918_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1038928_1039117_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1039091_1039322_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1039311_1039485_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818463.1|1039533_1040607_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054742.1|1040689_1043422_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	33.3	3.7e-39
WP_000533666.1|1043516_1044590_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	1.5e-198
WP_001303849.1|1044567_1044786_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545733.1|1044825_1044993_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|1045081_1045363_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_012578863.1|1045565_1046234_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	2.7e-68
WP_000827661.1|1046230_1046794_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	60.8	6.0e-45
WP_001214459.1|1046790_1046955_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111334.1|1046965_1047259_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	1.2e-49
WP_000168274.1|1047272_1047779_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_000365290.1|1047779_1048487_-	recombinase	NA	Q716E7	Shigella_phage	99.6	1.3e-137
WP_001243355.1|1048741_1048894_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1048878_1049013_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000065364.1|1049088_1049457_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
WP_000167595.1|1049607_1050078_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000088206.1|1050136_1050409_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	1.7e-40
WP_000032717.1|1050847_1051690_-	hypothetical protein	NA	F5A3D6	Riemerella_phage	42.5	1.2e-52
WP_096246228.1|1051770_1052466_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000067727.1|1052540_1052756_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438530.1|1052897_1053194_+	hypothetical protein	NA	G9L678	Escherichia_phage	95.9	2.2e-46
WP_000185505.1|1053226_1054126_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788881.1|1054122_1054824_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|1054820_1055111_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000796283.1|1055183_1055510_+	hypothetical protein	NA	I6RSP8	Salmonella_phage	99.1	9.5e-59
WP_000810177.1|1055532_1055979_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	91.2	2.9e-74
WP_000153283.1|1055975_1056503_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
WP_001254226.1|1056499_1056682_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	98.3	4.3e-29
WP_000566998.1|1056678_1056849_+	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	100.0	7.2e-26
WP_001003979.1|1056841_1057564_+	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	95.0	4.2e-123
WP_000002243.1|1057563_1057854_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008186.1|1057850_1058213_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	6.0e-62
WP_001235460.1|1058355_1058979_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|1059231_1059975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499456.1|1060060_1060219_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|1060299_1060698_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1060840_1061056_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075164.1|1061055_1061553_+	lysozyme	NA	H6WZK1	Escherichia_phage	98.8	3.8e-91
WP_000092249.1|1061549_1062017_+|lysis	lysis protein	lysis	H6WZK2	Escherichia_phage	97.4	4.6e-75
WP_001059339.1|1062215_1062740_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_000373425.1|1063347_1063842_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934130.1|1063841_1065944_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_001072975.1|1065940_1066153_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|1066080_1067661_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_086214752.1|1067605_1069633_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
WP_001097046.1|1069719_1070043_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283145.1|1070035_1070311_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	96.7	1.6e-43
WP_000677106.1|1070322_1070901_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079423.1|1070897_1071299_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	100.0	8.3e-73
WP_000211121.1|1071309_1072053_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_001372042.1|1072113_1072500_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_001161009.1|1072508_1072838_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447253.1|1075864_1076194_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|1076203_1076902_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_012578866.1|1076906_1077650_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_012578867.1|1077547_1078195_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	1.6e-113
WP_109840064.1|1078255_1080223_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	99.7	0.0e+00
WP_001233161.1|1082039_1082639_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.5	6.7e-111
WP_012578868.1|1082703_1084017_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	6.3e-77
WP_001024006.1|1084018_1084288_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_012578869.1|1084402_1084981_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	58.5	3.6e-53
WP_000950813.1|1085342_1086323_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
1085463:1085486	attL	CCTATTCTTTTTCAGTGGTTTGAA	NA	NA	NA	NA
WP_001592261.1|1086356_1087376_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_001247931.1|1087844_1088543_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_001265017.1|1089017_1090046_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1090018_1090711_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|1090840_1092013_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063129.1|1092012_1094559_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.3e-70
WP_000209902.1|1094555_1095155_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024568.1|1095510_1095816_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|1095815_1096736_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_001044299.1|1097270_1098512_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000244367.1|1098700_1100074_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_001143120.1|1100108_1100336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151437.1|1100356_1100953_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001273658.1|1101325_1101499_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001298362.1|1101581_1102910_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.4e-233
WP_001028090.1|1102930_1103425_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	95.8	2.5e-50
WP_001001173.1|1103435_1104026_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001340068.1|1104035_1104836_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126780.1|1104843_1105230_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001340067.1|1105241_1105934_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001340066.1|1105933_1107025_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191701.1|1107312_1107951_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_012578870.1|1107990_1111953_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979523.1|1112007_1112217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018494.1|1112375_1113884_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497957.1|1114103_1114934_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154378.1|1114991_1116119_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199145.1|1116124_1117396_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000533536.1|1118022_1118811_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
WP_000009232.1|1119373_1120060_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279877.1|1120325_1121543_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.8	1.1e-43
WP_012578871.1|1121712_1123242_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070929.1|1123213_1123501_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001258871.1|1123601_1125437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282108.1|1126811_1127375_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001260398.1|1128542_1128782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609738.1|1138202_1138709_-	NleE/OspZ family T3SS effector cysteine methyltransferase	NA	NA	NA	NA	NA
WP_000022709.1|1142233_1142455_+	hypothetical protein	NA	NA	NA	NA	NA
1139595:1139618	attR	TTCAAACCACTGAAAAAGAATAGG	NA	NA	NA	NA
WP_170315999.1|1144891_1146104_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	3.3e-165
WP_000255946.1|1147638_1148661_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
>prophage 4
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	1268128	1318903	4965553	lysis,tRNA,holin,terminase,head,tail,integrase,transposase,portal	Escherichia_phage(35.9%)	57	1263175:1263191	1291765:1291781
1263175:1263191	attL	CCTGCTGCCAGCGGTAA	NA	NA	NA	NA
WP_012578884.1|1268128_1269247_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	5.9e-84
WP_000003742.1|1269215_1269485_-	excisionase	NA	NA	NA	NA	NA
WP_000048294.1|1269546_1272018_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	1.0e-59
WP_000854559.1|1272298_1272487_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001340038.1|1272887_1273052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171943.1|1273055_1273274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379593.1|1273433_1273589_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|1273780_1274188_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|1274265_1274493_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705374.1|1274476_1275028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020543.1|1274999_1276040_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.9e-89
WP_157861261.1|1275951_1276494_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	9.8e-85
WP_001340033.1|1276600_1276801_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	93.9	5.9e-11
WP_001227887.1|1277240_1278083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000827088.1|1279121_1280495_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001124204.1|1280481_1281117_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_122993170.1|1281221_1281329_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	84.8	9.4e-08
WP_001178383.1|1281371_1282460_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_000813264.1|1282531_1282687_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.2e-16
WP_000980999.1|1282903_1283155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578887.1|1283221_1283500_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	7.4e-12
WP_012578888.1|1283501_1284560_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.9e-88
WP_000140024.1|1284560_1284926_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640018.1|1284934_1285477_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.8	2.4e-67
WP_000917691.1|1285790_1285988_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	1.4e-28
WP_000611208.1|1286138_1287188_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.8	1.8e-183
WP_001340026.1|1287986_1288118_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	7.0e-05
WP_000871291.1|1288383_1288719_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874298.1|1288979_1290830_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	89.1	0.0e+00
WP_000244358.1|1291264_1292638_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
1291765:1291781	attR	TTACCGCTGGCAGCAGG	NA	NA	NA	NA
WP_000526113.1|1292775_1293234_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_024164617.1|1293384_1293600_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_001135302.1|1293599_1294097_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000092312.1|1294093_1294531_+|lysis	lysis protein	lysis	B9UDJ2	Salmonella_phage	95.9	6.1e-69
WP_157778920.1|1294647_1294878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000828067.1|1295553_1295880_+	TonB family protein	NA	H6WZK5	Escherichia_phage	97.2	1.4e-54
WP_001339565.1|1296012_1296153_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	84.8	1.0e-14
WP_001102143.1|1296571_1297120_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_012578890.1|1297091_1299020_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.2	2.3e-261
WP_000259002.1|1299003_1299210_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831782.1|1299206_1300799_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	7.9e-183
WP_024201053.1|1300788_1301109_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	41.0	5.2e-09
WP_000741586.1|1301134_1301782_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	6.6e-112
WP_000515450.1|1301842_1305256_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.0	0.0e+00
WP_001233161.1|1305325_1305925_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.5	6.7e-111
WP_000279191.1|1305989_1307303_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.7	4.4e-78
WP_001101709.1|1307304_1307574_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	96.6	2.7e-43
WP_072131109.1|1307925_1308507_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.4	1.0e-95
WP_000799406.1|1308739_1309603_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1309586_1310723_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1310972_1312199_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1312247_1313369_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000734671.1|1313444_1314905_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265479.1|1314904_1315576_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1315745_1317116_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001295971.1|1317119_1317761_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001386208.1|1317796_1318903_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	1427474	1514080	4965553	protease,holin,terminase,head,capsid,tail,integrase,transposase,portal	Stx2-converting_phage(26.79%)	95	1427311:1427336	1480552:1480577
1427311:1427336	attL	CGGTCTGGTACATGGATATCGATACC	NA	NA	NA	NA
WP_000113687.1|1427474_1428605_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	5.7e-103
WP_000113189.1|1428582_1428831_-	excisionase	NA	NA	NA	NA	NA
WP_000048378.1|1428895_1431367_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1431459_1431651_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1431647_1431836_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000358771.1|1432394_1432673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339605.1|1432632_1433034_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_000367380.1|1433045_1433198_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	4.3e-06
WP_000362153.1|1433463_1433883_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1433983_1434265_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693943.1|1434248_1434674_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095665.1|1434696_1435659_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	50.9	1.0e-68
WP_001151205.1|1435699_1436122_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.9e-65
WP_001002673.1|1436365_1436677_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	3.1e-59
WP_001339608.1|1436938_1437331_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	58.3	3.7e-33
WP_001380433.1|1437327_1437921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000748514.1|1437961_1438390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893384.1|1438386_1439478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967405.1|1439767_1439980_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.8e-26
WP_001410105.1|1440146_1440425_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265094.1|1440426_1441476_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	5.9e-110
WP_000904174.1|1441488_1441848_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	3.9e-37
WP_001064912.1|1441844_1442534_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.1e-60
WP_000244363.1|1443110_1444484_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000874861.1|1445018_1446872_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	94.2	0.0e+00
WP_000372595.1|1447022_1447238_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193280.1|1447242_1447593_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000992071.1|1447656_1448190_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1448744_1448831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1449052_1449238_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736383.1|1449323_1449548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1449746_1449947_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1449988_1450354_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958372.1|1450644_1451208_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_001339613.1|1451204_1452866_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000173031.1|1452929_1454867_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1454911_1455133_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_012578896.1|1455078_1457664_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.7	0.0e+00
WP_000125990.1|1457660_1457987_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007915.1|1457996_1458347_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.0e-58
WP_000573362.1|1458343_1458790_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|1458786_1459131_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1459195_1459912_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1459926_1460301_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1460396_1460606_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212986.1|1460653_1463896_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.1	0.0e+00
WP_000807924.1|1463888_1464230_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_001420466.1|1464229_1464928_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	9.9e-130
WP_000194793.1|1464933_1465677_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_122999376.1|1465622_1466255_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	3.9e-101
WP_000514675.1|1466495_1469969_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001233154.1|1470036_1470636_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.5e-107
WP_000216481.1|1470787_1472065_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	88.9	2.4e-73
WP_001023459.1|1472066_1472336_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000767050.1|1472556_1473099_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106409363.1|1473043_1473238_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_001025663.1|1473580_1474903_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	83.9	2.1e-221
WP_106409364.1|1476494_1476617_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1476723_1477635_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1477700_1478270_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000350514.1|1480562_1480685_+	membrane protein	NA	NA	NA	NA	NA
1480552:1480577	attR	CGGTCTGGTACATGGATATCGATACC	NA	NA	NA	NA
WP_000526113.1|1480806_1481265_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_000244358.1|1481556_1482930_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000443085.1|1483005_1483812_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1483811_1485005_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195274.1|1485016_1486375_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763545.1|1486378_1487974_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	1.1e-51
WP_001194637.1|1487973_1489530_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1489621_1489666_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|1489803_1490685_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1490681_1491302_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001339671.1|1491329_1493219_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1493431_1494307_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278899.1|1494346_1494937_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1494933_1495692_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422059.1|1495911_1496961_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1496996_1497248_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|1497627_1500225_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_000776253.1|1500434_1501409_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_000908596.1|1501703_1501868_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_001308616.1|1501870_1502038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310756.1|1502151_1502247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099527.1|1502409_1505085_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001176295.1|1505148_1505739_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_001256548.1|1505908_1506673_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876274.1|1506821_1507130_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_000891353.1|1507136_1508306_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_001339668.1|1508497_1509235_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001339667.1|1509234_1509561_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000480199.1|1509686_1509905_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001088619.1|1510173_1510923_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288368.1|1511012_1511186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024201056.1|1511333_1513319_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000221852.1|1513372_1513477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000526113.1|1513621_1514080_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
>prophage 6
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	1864234	1910454	4965553	tRNA,holin,terminase,plate,capsid,tail,integrase,head,portal	Enterobacteria_phage(72.34%)	58	1866636:1866660	1903095:1903119
WP_000029464.1|1864234_1864984_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|1864983_1865535_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956501.1|1865596_1866577_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1866636:1866660	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000416304.1|1866766_1867162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247208.1|1867172_1868108_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000904672.1|1868196_1868505_-	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001151410.1|1868601_1868880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917809.1|1868894_1869233_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_000158964.1|1869243_1869531_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000514277.1|1869542_1869785_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021668.1|1869781_1869895_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|1869981_1870185_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153684.1|1870181_1870427_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000599411.1|1870568_1870934_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	3.9e-61
WP_000123423.1|1870940_1873763_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.4	0.0e+00
WP_000686479.1|1873839_1874799_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
WP_000211288.1|1874803_1875115_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	7.2e-48
WP_000248600.1|1875493_1876576_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_000970615.1|1876572_1878777_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000087812.1|1879281_1880328_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613749.1|1880327_1882079_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262654.1|1882233_1883070_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_001055100.1|1883093_1884146_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_000632335.1|1884191_1884992_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_000063103.1|1885093_1885588_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|1885587_1885788_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1885790_1886114_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1886110_1886503_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_001437610.1|1886499_1886907_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920596.1|1887044_1887512_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	7.6e-86
WP_000356305.1|1887504_1888140_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_012578915.1|1888151_1888718_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	1.2e-98
WP_001067548.1|1888735_1889065_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111951.1|1889068_1889965_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_000071724.1|1889957_1890566_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_000217022.1|1890562_1892128_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.7	1.4e-139
WP_012578916.1|1892138_1892615_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.6	1.2e-46
WP_001057723.1|1892621_1893233_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.0	2.5e-84
WP_012578917.1|1893232_1893691_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.5	3.4e-38
WP_001165545.1|1893762_1894362_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	81.7	2.6e-86
WP_000979945.1|1894388_1894877_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853385.1|1894889_1897697_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.9	0.0e+00
WP_000333505.1|1897683_1897839_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	2.8e-21
WP_000789085.1|1897847_1898222_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	7.6e-36
WP_000290450.1|1898277_1898790_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005409.1|1898789_1899974_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	3.6e-225
WP_000132806.1|1900131_1901232_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.2	1.1e-204
WP_024188892.1|1901588_1902092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488101.1|1902241_1902502_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1902692_1902833_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|1903136_1903436_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1903095:1903119	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672423.1|1903440_1905828_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|1905842_1906826_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1907109_1907154_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1907276_1907633_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_012578919.1|1907685_1907883_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1907979_1908522_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|1908525_1910454_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 7
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	2218398	2236163	4965553		Bacillus_phage(16.67%)	16	NA	NA
WP_000043439.1|2218398_2219805_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000271561.1|2219925_2220822_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	32.3	1.5e-29
WP_000626462.1|2220832_2221570_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	28.2	1.5e-11
WP_000983273.1|2221570_2222737_-	O90/O127 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_012578939.1|2222744_2223398_-	CatB-related O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	39.0	4.2e-13
WP_001403120.1|2223394_2224666_-	O90/O127 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000736844.1|2224678_2226052_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	1.1e-31
WP_001286272.1|2226055_2227504_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	3.2e-58
WP_012578940.1|2227496_2227997_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000089908.1|2227999_2228965_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_001140914.1|2228967_2230089_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
WP_000799972.1|2230115_2231132_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000234389.1|2231150_2232170_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.0	3.2e-84
WP_000183075.1|2232479_2233373_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|2233615_2234611_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001115987.1|2234768_2236163_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.7e-19
>prophage 8
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	2338779	2348224	4965553		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292780.1|2338779_2339916_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.7e-163
WP_012578945.1|2339912_2341916_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_001340078.1|2342040_2342502_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001302807.1|2342542_2343013_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.3e-81
WP_000598641.1|2343059_2343779_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001340080.1|2343775_2345461_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	4.3e-304
WP_001240407.1|2345682_2346414_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2346473_2346581_+	protein YohO	NA	NA	NA	NA	NA
WP_000783128.1|2346561_2347293_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569341.1|2347297_2348224_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	2556444	2634151	4965553	protease,tRNA,holin,terminase,plate,capsid,tail,integrase	Enterobacteria_phage(33.33%)	106	2550827:2550843	2604061:2604077
2550827:2550843	attL	TACGGTTTGCCCAGAAT	NA	NA	NA	NA
WP_001283598.1|2556444_2557257_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2557256_2558270_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699119.1|2558335_2559472_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615815.1|2559570_2560566_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127788.1|2560562_2561741_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2562005_2563226_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683533.1|2563384_2565391_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2565511_2565790_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2565823_2566372_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447360.1|2566371_2567181_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|2567180_2568005_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2568008_2569094_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_012578955.1|2569128_2570061_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2570226_2570778_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001408062.1|2570847_2571711_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001037538.1|2571712_2572258_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000826833.1|2572254_2572734_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000826023.1|2572730_2573222_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000170520.1|2573237_2573987_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001114065.1|2574006_2576646_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033310.1|2576729_2577296_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195816.1|2577958_2578444_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425006.1|2578646_2580791_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531916.1|2580790_2582101_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2582326_2582611_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001339815.1|2582982_2584323_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2584384_2585140_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2585433_2586366_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958685.1|2586677_2587835_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	3.7e-222
WP_096959196.1|2588065_2588281_-	Hin recombinase	NA	K7PJT4	Enterobacteria_phage	66.7	2.0e-17
WP_024201066.1|2588256_2588613_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	68.6	2.2e-40
WP_001096966.1|2588621_2589650_-|tail	tail fiber protein	tail	A0A0M3ULD8	Salmonella_phage	46.3	3.5e-30
WP_000049950.1|2589649_2590330_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001197072.1|2590326_2591526_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.6	2.9e-185
WP_001270636.1|2591525_2591879_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_000301071.1|2591878_2592631_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	4.5e-88
WP_001123212.1|2592695_2593091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113597.1|2593077_2593848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077826329.1|2593968_2594277_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	98.7	2.5e-37
WP_000081741.1|2594312_2595374_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	83.4	4.1e-159
WP_000155121.1|2595376_2595679_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	9.1e-48
WP_001349561.1|2595678_2596266_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.1	3.1e-84
WP_000990882.1|2596265_2598254_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	1.6e-270
WP_000393944.1|2598431_2598884_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.0	2.2e-58
WP_000257260.1|2598887_2599328_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_000046921.1|2599339_2600485_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	7.5e-159
WP_032211368.1|2600488_2601052_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.6e-80
WP_001142483.1|2601026_2601416_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	1.1e-66
WP_000008742.1|2601402_2601957_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.9	4.7e-82
WP_001125668.1|2601953_2602361_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	7.4e-69
WP_162010769.1|2602359_2602593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627485.1|2602589_2603531_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	1.7e-156
WP_001066736.1|2603542_2604049_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	78.7	3.2e-69
WP_000873163.1|2604052_2605273_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.8	1.4e-203
2604061:2604077	attR	TACGGTTTGCCCAGAAT	NA	NA	NA	NA
WP_000246484.1|2605287_2606025_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	96.0	6.0e-109
WP_000113480.1|2605933_2607379_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.6	3.7e-264
WP_001130793.1|2607378_2609001_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_001218996.1|2609003_2609555_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_001472362.1|2609508_2610123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113285.1|2610255_2610441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311799.1|2610584_2610977_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.9	2.5e-50
WP_000229385.1|2610960_2611437_-	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	94.3	7.3e-84
WP_000783734.1|2611420_2611744_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000658764.1|2612196_2612709_-	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	99.4	1.4e-96
WP_000027553.1|2612903_2613422_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.3	2.9e-94
WP_000994516.1|2613418_2613607_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2613603_2613966_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002231.1|2613962_2614253_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	96.9	9.3e-50
WP_001279421.1|2614252_2614522_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000950970.1|2614514_2614691_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	7.4e-26
WP_000386655.1|2614690_2615050_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	1.0e-61
WP_001254259.1|2615052_2615229_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	3.0e-27
WP_012578958.1|2615225_2615753_-	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	2.1e-100
WP_000736903.1|2615749_2616190_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_001248389.1|2616263_2617640_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	1.6e-253
WP_000431319.1|2617636_2618524_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	3.1e-144
WP_001244622.1|2618586_2618859_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	1.4e-42
WP_012578960.1|2618881_2619178_-	hypothetical protein	NA	A0A2D1GLZ9	Escherichia_phage	99.0	1.2e-47
WP_000437875.1|2619316_2619517_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274760.1|2619617_2620331_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_000588958.1|2620338_2620776_+	hypothetical protein	NA	C6ZR46	Salmonella_phage	73.8	1.0e-55
WP_000050903.1|2620762_2621134_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	58.3	3.6e-06
WP_000198444.1|2621635_2622019_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167602.1|2622077_2622548_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	4.1e-87
WP_000505906.1|2622594_2622891_+	hypothetical protein	NA	A0A2D1GLR6	Escherichia_phage	95.9	8.1e-49
WP_000865171.1|2622890_2623079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005784.1|2623213_2624182_+	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.7	2.2e-55
WP_000638547.1|2624205_2624337_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2624321_2624474_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000365292.1|2624728_2625436_+	recombinase	NA	Q716E7	Shigella_phage	99.6	3.8e-137
WP_000018648.1|2625436_2625904_+	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	61.3	1.0e-45
WP_000098523.1|2625900_2626407_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_001111303.1|2626420_2626714_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_001214458.1|2626724_2626892_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	1.2e-22
WP_000004315.1|2626888_2627158_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	55.2	1.1e-17
WP_000034177.1|2627144_2627783_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.3	1.0e-93
WP_001014291.1|2627784_2627976_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_012578961.1|2627978_2628374_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	96.1	9.7e-66
WP_000360279.1|2628375_2628573_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	84.6	1.5e-30
WP_000208133.1|2628583_2629216_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	90.5	2.0e-81
WP_000545737.1|2629316_2629484_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2629541_2629742_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_032160942.1|2630037_2630190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001197004.1|2630269_2631517_-	MFS transporter	NA	NA	NA	NA	NA
WP_001274892.1|2631578_2632502_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194529.1|2632717_2634151_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	9.1e-29
>prophage 10
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	2697801	2790909	4965553	protease,tRNA,holin,terminase,plate,head,capsid,tail,transposase	Pseudomonas_phage(11.63%)	101	NA	NA
WP_000244367.1|2697801_2699175_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000517443.1|2699214_2700006_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175631.1|2700285_2701182_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040491.1|2701185_2702610_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001339829.1|2702789_2703689_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838959.1|2703784_2704360_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|2704420_2704870_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2704856_2705282_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102892.1|2705495_2706365_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_001298446.1|2706368_2707268_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000858968.1|2707311_2707983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001007643.1|2707979_2711429_-	helicase SNF2	NA	G8DDA1	Micromonas_pusilla_virus	29.6	2.9e-36
WP_000003978.1|2711527_2712790_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_001285745.1|2712830_2713148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000753675.1|2713226_2714279_-	HTH-type transcriptional regulator EutR	NA	NA	NA	NA	NA
WP_001295463.1|2714324_2714825_-	ethanolamine utilization microcompartment protein EutK	NA	NA	NA	NA	NA
WP_001111043.1|2714837_2715497_-	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_000197710.1|2716246_2716894_-	helix-turn-helix domain-containing protein	NA	A0A2I7S9A5	Vibrio_phage	39.0	1.2e-07
WP_000989761.1|2717076_2717313_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.4	1.8e-14
WP_000500007.1|2717312_2719355_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	49.3	3.5e-175
WP_000053170.1|2719373_2720267_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	56.6	1.2e-90
WP_000361028.1|2720281_2720506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206134.1|2720762_2721407_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	66.8	1.7e-75
WP_000553850.1|2721408_2721642_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012578964.1|2721622_2721814_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	54.4	5.2e-09
WP_000564495.1|2721954_2722173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000653700.1|2722261_2722972_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_000687524.1|2723198_2723429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234091.1|2723418_2723733_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	62.8	2.1e-23
WP_000082800.1|2723704_2723869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292367.1|2723865_2724135_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	46.0	4.1e-15
WP_001289972.1|2724121_2724619_+	ead/Ea22-like family protein	NA	A0A076GCN9	Escherichia_phage	72.2	3.7e-14
WP_001261588.1|2724618_2724789_+	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	91.2	1.4e-18
WP_000687850.1|2725041_2725320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000914513.1|2725291_2725690_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.6	2.7e-39
WP_000976762.1|2725686_2726163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192999.1|2726263_2726731_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	39.6	2.3e-18
WP_000186337.1|2726757_2727036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372993.1|2727218_2727611_+|holin	phage holin family protein	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_000445983.1|2727600_2727897_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.5	8.1e-17
WP_000836742.1|2727880_2728426_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.6	6.4e-92
WP_000198193.1|2728422_2728605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241905.1|2728679_2728832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312577.1|2728831_2729332_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.2	9.8e-39
WP_001171800.1|2729378_2730119_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.4	2.4e-65
WP_001129149.1|2730120_2731761_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.1	6.6e-193
WP_000068056.1|2731764_2733360_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	45.7	3.5e-122
WP_001143306.1|2733346_2734513_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	46.1	8.4e-57
WP_000094313.1|2734509_2735061_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_012578967.1|2735270_2736386_+|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	37.1	7.3e-50
WP_000375809.1|2736386_2736782_+	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	37.8	1.9e-16
WP_000960880.1|2736792_2737701_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	60.3	7.4e-101
WP_000416600.1|2737704_2738037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119401.1|2738040_2738472_+	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	27.4	9.1e-09
WP_071791946.1|2738468_2739107_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	39.4	9.9e-28
WP_000671672.1|2739120_2739321_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_001290034.1|2739313_2740735_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M3LQC3	Mannheimia_phage	45.7	3.2e-95
WP_000053463.1|2740747_2741122_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	61.2	1.7e-32
WP_000152396.1|2741118_2741502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178828.1|2741516_2741675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918298.1|2741664_2743938_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.5	5.6e-81
WP_000539587.1|2743937_2745287_+	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	26.6	1.1e-36
WP_001143147.1|2745270_2746482_+	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	37.5	1.3e-68
WP_000263495.1|2746481_2747132_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	48.2	6.1e-41
WP_000372929.1|2747185_2747536_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	8.1e-32
WP_001116499.1|2747535_2748615_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.4	1.2e-73
WP_001098747.1|2748618_2749191_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	39.8	2.3e-31
WP_032211389.1|2749448_2749940_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	81.4	1.1e-69
WP_000805554.1|2749939_2750533_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.3	1.1e-52
WP_001032314.1|2750504_2750921_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	4.1e-22
WP_001115593.1|2750923_2751430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000769961.1|2752154_2753516_-	ethanolamine ammonia-lyase subunit alpha	NA	NA	NA	NA	NA
WP_000244358.1|2754774_2756148_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_024201071.1|2756254_2756491_-	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
WP_000512386.1|2756487_2757714_-	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_012578971.1|2757930_2759118_-	ethanolamine utilization ethanol dehydrogenase EutG	NA	NA	NA	NA	NA
WP_000929720.1|2759107_2759944_-	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
WP_001075698.1|2759954_2761358_-	aldehyde dehydrogenase EutE	NA	NA	NA	NA	NA
WP_000762196.1|2761369_2761657_-	ethanolamine utilization microcompartment protein EutN	NA	NA	NA	NA	NA
WP_000387713.1|2761763_2762057_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_000582973.1|2762095_2763112_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_000651284.1|2763108_2763912_-	ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT	NA	NA	NA	NA	NA
WP_000733877.1|2763908_2764610_-	ethanolamine utilization acetate kinase EutQ	NA	NA	NA	NA	NA
WP_000820789.1|2764584_2765064_-	ethanolamine utilization acetate kinase EutP	NA	NA	NA	NA	NA
WP_000356956.1|2765076_2765412_-	ethanolamine utilization microcompartment protein EutS	NA	NA	NA	NA	NA
WP_000342632.1|2765703_2767983_-	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_001003720.1|2768271_2769222_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.8	9.7e-11
WP_000087317.1|2769241_2771245_+	transketolase	NA	NA	NA	NA	NA
WP_001270532.1|2771321_2772365_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_001296284.1|2772490_2773066_-	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_001078900.1|2773133_2775113_-	formate-dependent uric acid utilization protein AegA	NA	NA	NA	NA	NA
WP_000636131.1|2775318_2777037_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_001082402.1|2777123_2780297_-	autotransporter adhesin glycoprotein EhaJ	NA	A0A2L1IV18	Escherichia_phage	24.6	7.6e-44
WP_000069202.1|2780300_2781536_-	adhesin-glycosylating O-heptosyltransferase EhaJ	NA	NA	NA	NA	NA
WP_001273135.1|2782673_2785787_+	multidrug efflux RND transporter permease AcrD	NA	NA	NA	NA	NA
WP_001386977.1|2785885_2785945_-	protein YpfM	NA	NA	NA	NA	NA
WP_000258253.1|2786325_2786682_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_001277801.1|2786685_2787813_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_000383836.1|2787840_2788041_+	YpfN family protein	NA	NA	NA	NA	NA
WP_000679819.1|2788121_2788820_-	esterase	NA	NA	NA	NA	NA
WP_000829364.1|2788893_2790909_-|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
>prophage 11
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	2810396	2855644	4965553	terminase,integrase,holin,tail	Salmonella_phage(59.62%)	55	2812234:2812249	2852531:2852546
WP_000017553.1|2810396_2810549_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|2810566_2810758_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|2811068_2811587_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|2811602_2812142_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
2812234:2812249	attL	ATCATTCCCACTCAAT	NA	NA	NA	NA
WP_012578972.1|2812359_2812842_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	87.5	5.7e-68
WP_000354071.1|2812838_2813465_-	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	95.7	1.5e-113
WP_000207017.1|2813454_2813763_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	98.0	5.8e-50
WP_001275998.1|2813749_2814154_-	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_000751339.1|2814350_2815358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578973.1|2815451_2816525_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.2	3.9e-24
WP_000218894.1|2816554_2819242_-	hypothetical protein	NA	T1S9Y2	Salmonella_phage	73.2	5.6e-96
WP_001189556.1|2819440_2819701_+	hypothetical protein	NA	T1SA06	Salmonella_phage	98.8	2.9e-42
WP_001248449.1|2819901_2822376_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	98.4	0.0e+00
WP_000119842.1|2822380_2824183_-	hypothetical protein	NA	T1SAQ5	Salmonella_phage	96.2	1.6e-304
WP_001143616.1|2824179_2826690_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	82.8	0.0e+00
WP_000337194.1|2826702_2827245_-	hypothetical protein	NA	T1SA02	Salmonella_phage	98.9	2.8e-71
WP_000588339.1|2827244_2827709_-	hypothetical protein	NA	T1SA73	Salmonella_phage	98.7	2.0e-86
WP_000885914.1|2827708_2830186_-	hypothetical protein	NA	Q858G3	Salmonella_phage	98.5	0.0e+00
WP_000179046.1|2830185_2830791_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	2.6e-110
WP_000366671.1|2830790_2831114_-	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	71.8	1.5e-35
WP_000012264.1|2831165_2831546_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	52.8	2.1e-25
WP_000599566.1|2831556_2831997_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.7	7.0e-65
WP_000268705.1|2832048_2833035_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	86.6	1.7e-164
WP_001047889.1|2833049_2833760_-	peptidase	NA	T1SAP9	Salmonella_phage	81.9	1.6e-63
WP_000619835.1|2833774_2834320_-	hypothetical protein	NA	S4TSV9	Salmonella_phage	58.8	9.7e-40
WP_000968687.1|2834316_2834616_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	67.3	2.0e-31
WP_000852153.1|2834612_2836283_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	98.9	0.0e+00
WP_000334867.1|2836297_2836504_-	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_000031196.1|2837375_2837807_+	hypothetical protein	NA	A0A248SKX0	Klebsiella_phage	54.9	6.1e-37
WP_000123109.1|2837850_2839332_-	hypothetical protein	NA	M1F3C4	Salmonella_phage	98.6	1.3e-293
WP_172437434.1|2839328_2840003_-|terminase	terminase small subunit	terminase	M1F219	Salmonella_phage	98.2	8.7e-115
WP_001140120.1|2840025_2840364_-	hypothetical protein	NA	Q858C6	Salmonella_phage	86.6	2.3e-47
WP_012578976.1|2840897_2841194_-	hypothetical protein	NA	A0A2R2YB59	Pseudomonas_phage	65.1	8.2e-09
WP_000856943.1|2841204_2841411_-	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	88.1	2.9e-29
WP_029694141.1|2841413_2841629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000828691.1|2842025_2842367_-	hypothetical protein	NA	T1SA23	Salmonella_phage	76.3	2.6e-43
WP_001066738.1|2842484_2843270_-	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	89.7	2.2e-138
WP_000086426.1|2843266_2844073_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	78.5	1.2e-91
WP_000402891.1|2844088_2844289_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	75.8	2.5e-22
WP_001278768.1|2844436_2844670_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
WP_000836620.1|2844825_2845422_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	98.0	1.1e-105
WP_001198622.1|2845646_2845796_+	hypothetical protein	NA	T1SA20	Salmonella_phage	70.2	1.1e-14
WP_172437433.1|2845828_2846752_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	79.7	1.6e-50
WP_000548052.1|2846759_2847062_+	hypothetical protein	NA	T1SA88	Salmonella_phage	97.0	6.5e-46
WP_001091673.1|2847058_2847880_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	97.4	9.1e-159
WP_000063813.1|2847876_2848758_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	94.5	4.3e-154
WP_000816432.1|2848804_2849053_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_000041115.1|2849162_2849462_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	99.0	3.1e-48
WP_000184078.1|2849454_2849613_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	86.5	3.5e-19
WP_000664383.1|2849609_2850323_+	hypothetical protein	NA	R9VWB9	Serratia_phage	70.0	4.0e-94
WP_001013665.1|2850319_2850913_+	adenine methylase	NA	T1SA14	Salmonella_phage	98.5	1.2e-115
WP_000177704.1|2850909_2851089_+	hypothetical protein	NA	T1SA82	Salmonella_phage	100.0	2.4e-24
WP_000954549.1|2851085_2852339_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	96.4	1.9e-232
WP_000138264.1|2852531_2854109_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2852531:2852546	attR	ATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001296289.1|2854177_2855644_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 12
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	2927017	3046352	4965553	protease,tRNA,tail,integrase,transposase	Escherichia_phage(19.44%)	111	2917412:2917428	3021925:3021941
2917412:2917428	attL	GTCATCAGGCGTTTCAT	NA	NA	NA	NA
WP_001305240.1|2927017_2927554_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190646.1|2927578_2928214_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_012578985.1|2928422_2929271_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196297.1|2929326_2929587_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_000128777.1|2929780_2929861_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986038.1|2930281_2930662_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001309669.1|2930661_2931393_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399398.1|2931404_2932133_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020737.1|2932144_2933050_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|2933046_2933727_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2933997_2934972_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|2934987_2936787_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589053.1|2936984_2937464_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|2937460_2938417_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|2938416_2939067_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|2939099_2939675_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|2939671_2939827_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094401.1|2940082_2941705_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083664.1|2941689_2942427_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2942558_2943893_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001386374.1|2943925_2944807_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000627804.1|2945551_2945935_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2946239_2946929_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997418.1|2946976_2948014_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2948220_2948640_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001339408.1|2948708_2949407_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082956.1|2949438_2952099_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2952212_2953568_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001339409.1|2953613_2953937_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852123.1|2953933_2955232_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
WP_001235102.1|2962513_2965087_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040119.1|2965216_2965948_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079111.1|2965944_2966925_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2967059_2967797_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2969167_2969509_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2969612_2969660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200108.1|2969758_2970919_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2970961_2972083_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2972093_2973164_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001339413.1|2973374_2973740_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212401.1|2973887_2974406_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969004.1|2974395_2975622_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589817.1|2975637_2976120_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001408077.1|2976323_2977253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000503755.1|2977584_2978079_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	59.8	4.1e-45
WP_000548501.1|2978078_2978681_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	90.3	6.2e-96
WP_001106833.1|2978652_2979093_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	1.6e-53
WP_032160959.1|2979114_2979504_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	54.1	1.9e-13
WP_001195986.1|2979533_2980112_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	80.2	2.9e-79
WP_001286668.1|2980176_2981364_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.5	3.8e-190
WP_001207671.1|2981376_2981895_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	80.2	3.0e-75
WP_000361834.1|2981957_2982230_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	78.8	1.3e-29
WP_000763326.1|2982271_2982391_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_000069482.1|2982383_2984813_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	79.3	2.4e-279
WP_000978925.1|2984824_2985289_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	78.4	4.5e-62
WP_000884170.1|2985291_2986464_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.0	4.5e-167
WP_000972008.1|2986540_2986759_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	81.9	8.6e-32
WP_000948614.1|2986796_2987519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065253.1|2987724_2988072_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264790.1|2988113_2988881_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2988911_2989460_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2989478_2989727_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2989863_2991225_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2991391_2992183_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2992203_2993490_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2993544_2994138_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2994260_2995139_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880896.1|2995224_2996886_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2997034_2997376_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2997437_2997728_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2997717_2998194_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2998325_2998808_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001339422.1|3001569_3001887_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PGM3	Moraxella_phage	46.8	1.6e-10
WP_001816740.1|3002215_3002512_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.9	4.6e-20
WP_001339425.1|3002536_3002782_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	50.7	1.1e-16
WP_071526065.1|3005192_3005294_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001034000.1|3005493_3009411_-|protease	serine protease autotransporter toxin EspC	protease	Q9LA58	Enterobacterial_phage	38.2	3.0e-223
WP_000606941.1|3009980_3011153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578991.1|3014160_3014541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993124.1|3014848_3015826_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000271979.1|3015845_3017114_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000772826.1|3017136_3018585_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000097680.1|3018598_3019879_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	4.9e-34
WP_001298180.1|3020115_3021516_+	GABA permease	NA	NA	NA	NA	NA
WP_000156817.1|3021536_3022199_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
3021925:3021941	attR	GTCATCAGGCGTTTCAT	NA	NA	NA	NA
WP_000522415.1|3022199_3022649_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000508177.1|3022732_3022891_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000137287.1|3023073_3023373_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001229436.1|3023382_3023907_+	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000115381.1|3023953_3024358_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000492656.1|3025024_3025474_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000281320.1|3025510_3025855_-	YgaC family protein	NA	NA	NA	NA	NA
WP_001295174.1|3026006_3026336_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000209795.1|3027812_3028244_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001223227.1|3028452_3028698_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080940.1|3028694_3029105_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.5	3.0e-17
WP_000246589.1|3029077_3031222_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.1e-195
WP_000777941.1|3031231_3032191_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	9.1e-134
WP_000985495.1|3032547_3033750_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000774965.1|3033742_3034807_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_001216533.1|3034864_3035857_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000165669.1|3036305_3037490_+	MFS transporter	NA	NA	NA	NA	NA
WP_000445658.1|3037613_3038351_+	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000119749.1|3038340_3038676_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000378442.1|3038766_3039297_+	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_001295175.1|3039423_3040596_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_001296316.1|3040612_3042151_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001097125.1|3042408_3043116_+	RNA ligase family protein	NA	NA	NA	NA	NA
WP_000638139.1|3043112_3044225_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000244358.1|3044412_3045786_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000526113.1|3045893_3046352_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
>prophage 13
NC_011601	Escherichia coli O127:H6 str. E2348/69, complete genome	4965553	3089120	3096260	4965553		Escherichia_phage(83.33%)	6	NA	NA
WP_000103866.1|3089120_3091682_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.7e-31
WP_001141306.1|3091787_3092444_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001296319.1|3092494_3093262_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847970.1|3093457_3094366_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	4.3e-117
WP_000590412.1|3094362_3095625_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.8e-135
WP_001279001.1|3095621_3096260_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 1
NC_011603	Escherichia coli O127:H6 str. E2348/69 plasmid pMAR2, complete sequence	97978	33148	86698	97978	tRNA,transposase	Wolbachia_phage(20.0%)	58	NA	NA
WP_000244358.1|33148_34522_+|transposase	IS4-like element ISEc13 family transposase	transposase	Q9JMP3	Wolbachia_phage	29.1	2.1e-43
WP_000139319.1|34554_35112_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704512.1|35214_36075_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000205749.1|36133_36880_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000986966.1|36899_42170_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450520.1|42251_42479_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911313.1|42478_42877_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000009324.1|42885_45039_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000850423.1|45291_46023_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000628106.1|46036_46546_-	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_001007001.1|46542_49368_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000488447.1|49364_50738_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_071781708.1|50737_51151_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_012477176.1|51104_51446_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059835.1|51375_51921_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_000624108.1|51907_52192_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000415570.1|52272_52587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287909.1|52588_52936_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_001030379.1|52951_53695_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_000864318.1|53687_53945_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_000821827.1|53972_55781_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000777697.1|55777_56416_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000830821.1|56424_57417_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203740.1|57413_58046_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000214079.1|58042_58429_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001064253.1|58425_61053_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001278689.1|61212_61434_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
WP_000809838.1|61568_62084_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038342.1|62080_62332_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_071791934.1|62324_62678_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000002788.1|62631_63222_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_000146685.1|63211_64639_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_072095570.1|64638_65343_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399792.1|65353_65920_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|65941_66253_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340270.1|66267_66633_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_012477178.1|66666_66894_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000332491.1|66988_67675_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|67864_68248_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_172682412.1|68592_69183_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234454.1|69478_70300_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	7.5e-44
WP_134810086.1|70418_70616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014106970.1|70729_70849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000244358.1|71570_72944_-|transposase	IS4-like element ISEc13 family transposase	transposase	Q9JMP3	Wolbachia_phage	29.1	2.1e-43
WP_000556070.1|73050_73527_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	37.7	5.5e-15
WP_000170720.1|73573_74935_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_032163416.1|74986_75205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027497.1|76203_76395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271711.1|76394_76814_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001436678.1|76860_77163_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000747078.1|78651_79002_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.4e-39
WP_001254946.1|78921_80073_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	3.4e-42
WP_000907654.1|81015_82092_+|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_001386133.1|82839_83325_+	glutamate decarboxylase A subunit	NA	NA	NA	NA	NA
WP_071589304.1|83305_83542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000063567.1|83581_85042_+	amino acid permease	NA	NA	NA	NA	NA
WP_000490358.1|85075_85885_+	glutamate racemase	NA	NA	NA	NA	NA
WP_085947597.1|86003_86698_-|transposase	IS1-like element ISEc30 family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	9.8e-130
