The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013891	Listeria seeligeri serovar 1/2b str. SLCC3954, complete genome	2797636	1028963	1036308	2797636		Hokovirus(33.33%)	8	NA	NA
WP_003746848.1|1028963_1029347_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.0	1.8e-16
WP_012985346.1|1029359_1030343_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.8	1.7e-10
WP_012985347.1|1030357_1031371_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.4	1.1e-09
WP_012985348.1|1031511_1033002_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.3	2.3e-112
WP_012985349.1|1033013_1033838_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	2.3e-69
WP_012985350.1|1033850_1034159_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012985351.1|1034217_1034622_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012985352.1|1034751_1036308_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.6	3.9e-17
>prophage 2
NC_013891	Listeria seeligeri serovar 1/2b str. SLCC3954, complete genome	2797636	1171703	1218731	2797636	protease,integrase,transposase,tRNA	Listeria_phage(16.67%)	48	1164434:1164450	1174755:1174771
1164434:1164450	attL	GAAACTTTTATTTTTTC	NA	NA	NA	NA
WP_012985474.1|1171703_1172705_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_077904629.1|1173157_1173376_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATX2	Listeria_phage	53.5	6.2e-14
WP_012985476.1|1173572_1173833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985477.1|1174427_1177790_+	type VI-A CRISPR-associated RNA-guided ribonuclease Cas13a	NA	NA	NA	NA	NA
1174755:1174771	attR	GAAAAAATAAAAGTTTC	NA	NA	NA	NA
WP_012985478.1|1177975_1179385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985479.1|1179396_1179747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985480.1|1179867_1180011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985481.1|1180933_1181725_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012985482.1|1181984_1182578_-	YdeI family protein	NA	NA	NA	NA	NA
WP_012985483.1|1182711_1183119_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_012985484.1|1183284_1183893_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.5	1.5e-28
WP_012985485.1|1183939_1184200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041176170.1|1184324_1185737_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	5.0e-56
WP_012985487.1|1185761_1186025_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_012985488.1|1186177_1186654_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003747345.1|1186691_1186937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985489.1|1186933_1188139_-	MFS transporter	NA	NA	NA	NA	NA
WP_012985490.1|1188344_1189004_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003747352.1|1189050_1189245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985491.1|1189309_1190155_-	YitT family protein	NA	NA	NA	NA	NA
WP_003747356.1|1190482_1190620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985493.1|1190769_1191486_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_012985494.1|1193181_1194666_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_012985495.1|1194790_1195243_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003747366.1|1195280_1195745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985496.1|1195933_1196863_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012985498.1|1196975_1198223_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.3	2.1e-106
WP_012985499.1|1198206_1199037_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.7	4.3e-47
WP_012985500.1|1199203_1200343_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012985501.1|1200423_1200819_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	55.9	3.0e-14
WP_003747378.1|1200969_1201185_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012985502.1|1201772_1202384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985503.1|1202405_1202774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985504.1|1202959_1203187_+	hypothetical protein	NA	R4IDW6	Listeria_phage	70.7	1.3e-25
WP_012985505.1|1203485_1204424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985506.1|1204539_1205823_+	trigger factor	NA	NA	NA	NA	NA
WP_012985507.1|1206007_1207267_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.4	2.1e-146
WP_012985508.1|1207385_1207952_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_012985509.1|1207985_1208555_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_012985510.1|1208657_1209200_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_012985511.1|1209209_1210073_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_012985512.1|1210069_1210855_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	40.2	3.6e-27
WP_012985513.1|1210988_1211855_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_012985514.1|1212115_1214194_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.4	3.5e-106
WP_012985515.1|1214257_1215562_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_012985516.1|1215845_1216748_+	tyrosine recombinase XerC	NA	W8EHC2	Mycobacterium_phage	28.5	7.5e-13
WP_003724001.1|1216768_1217308_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012985518.1|1217321_1218731_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	29.0	1.7e-43
>prophage 3
NC_013891	Listeria seeligeri serovar 1/2b str. SLCC3954, complete genome	2797636	1620393	1663024	2797636	holin,terminase,capsid,head,tRNA,tail,portal,protease,integrase	Staphylococcus_phage(21.74%)	55	1606215:1606235	1670613:1670633
1606215:1606235	attL	TTTTTTCATTATTATTCATCC	NA	NA	NA	NA
WP_012985785.1|1620393_1620888_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_041176178.1|1620884_1621214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985786.1|1621687_1622116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003748110.1|1622552_1623437_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003748112.1|1623516_1624266_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_012985787.1|1624478_1624772_-	phage transcriptional activator ArpU family protein	NA	NA	NA	NA	NA
WP_012985788.1|1624961_1626410_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003752729.1|1626422_1627313_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_012985789.1|1627463_1628315_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041176179.1|1628402_1630814_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.9	0.0e+00
WP_003752733.1|1631219_1632185_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	63.8	6.9e-49
WP_012985791.1|1632181_1632757_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	46.0	5.1e-39
WP_012985792.1|1632781_1634647_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	30.0	1.3e-38
WP_012985793.1|1634782_1635982_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.8	5.6e-149
WP_012985795.1|1636646_1636931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985796.1|1636949_1637189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012985798.1|1638052_1638331_-|holin	holin	holin	A0A1S7FZ29	Listeria_phage	58.2	1.5e-20
WP_012985799.1|1638352_1638739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148213644.1|1638757_1638907_-	XkdX family protein	NA	NA	NA	NA	NA
WP_012985801.1|1638908_1639196_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_012985802.1|1639214_1639694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985803.1|1639693_1640074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985804.1|1640066_1640684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985805.1|1640698_1642132_-|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	45.9	1.4e-85
WP_012985806.1|1642132_1642837_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	42.2	6.2e-47
WP_012985807.1|1642836_1645422_-|tail	phage tail tape measure protein	tail	A0A1G5SB90	Enterococcus_phage	42.2	2.4e-64
WP_012985809.1|1645740_1646025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985810.1|1646026_1646605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985811.1|1646601_1646985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985812.1|1646987_1647398_-	hypothetical protein	NA	A0A0S2MVE4	Bacillus_phage	46.2	2.9e-12
WP_012985813.1|1647399_1647726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985814.1|1647729_1648047_-|head,tail	phage head-tail connector protein	head,tail	A0A1X9I6Z8	Streptococcus_phage	33.8	7.7e-05
WP_012985815.1|1648051_1648876_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	49.5	9.1e-66
WP_012985816.1|1648896_1649481_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_012985817.1|1649589_1650354_-|capsid	minor capsid protein	capsid	A0A090D822	Clostridium_phage	29.7	1.4e-23
WP_012985818.1|1650343_1651735_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	42.4	1.9e-87
WP_012985819.1|1651734_1653027_-|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	68.1	1.2e-176
WP_012985820.1|1653016_1653769_-	helix-turn-helix domain-containing protein	NA	A0A0B5CTX0	Listeria_phage	36.7	8.7e-31
WP_012985821.1|1654097_1654460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985822.1|1654452_1654647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148213645.1|1654636_1654903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985824.1|1655081_1655786_-	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	32.7	1.5e-21
WP_012985825.1|1655798_1656341_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	49.4	7.1e-43
WP_012985826.1|1656333_1656852_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012985827.1|1656871_1657273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985828.1|1657269_1657623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077904644.1|1657615_1658251_-	hypothetical protein	NA	A0A068EMK6	Bacillus_phage	35.5	6.4e-27
WP_012985830.1|1658288_1659212_-	restriction endonuclease specificity (S) protein	NA	A0A1L2JY26	Aeribacillus_phage	53.7	7.7e-21
WP_012985831.1|1659220_1659925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985832.1|1660023_1660209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985834.1|1660380_1660545_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	73.6	1.2e-17
WP_041176182.1|1660690_1661008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985836.1|1661034_1661280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012985837.1|1661447_1661795_+	helix-turn-helix transcriptional regulator	NA	A0A1D6Z276	Staphylococcus_phage	40.0	1.2e-14
WP_012985838.1|1661803_1663024_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	28.2	1.7e-28
1670613:1670633	attR	GGATGAATAATAATGAAAAAA	NA	NA	NA	NA
>prophage 4
NC_013891	Listeria seeligeri serovar 1/2b str. SLCC3954, complete genome	2797636	1787239	1795511	2797636		Synechococcus_phage(33.33%)	8	NA	NA
WP_012985918.1|1787239_1787794_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.2	5.4e-30
WP_012985919.1|1787790_1788840_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.7	3.4e-65
WP_012985920.1|1788855_1790283_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	1.8e-53
WP_012985921.1|1790267_1792487_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.6	8.8e-156
WP_012985922.1|1792479_1793163_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012985923.1|1793166_1793412_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012985924.1|1793423_1794137_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	37.8	1.5e-40
WP_012985925.1|1794218_1795511_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	1.4e-17
>prophage 5
NC_013891	Listeria seeligeri serovar 1/2b str. SLCC3954, complete genome	2797636	1964795	1972806	2797636		Faustovirus(14.29%)	10	NA	NA
WP_012986053.1|1964795_1965881_-	histidinol-phosphate transaminase	NA	A0A1X7BZP2	Faustovirus	26.0	5.5e-18
WP_003748597.1|1965880_1966255_-	chorismate mutase	NA	NA	NA	NA	NA
WP_012986054.1|1966251_1967349_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	28.2	6.7e-24
WP_012986055.1|1967351_1968518_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	39.2	1.6e-47
WP_003748602.1|1968722_1969166_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.8	1.4e-28
WP_012986056.1|1969185_1970151_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	22.2	7.8e-08
WP_012986057.1|1970161_1970875_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_012986058.1|1970896_1971664_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003748610.1|1971723_1972293_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	47.2	3.1e-41
WP_003720260.1|1972530_1972806_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	69.7	2.0e-25
>prophage 6
NC_013891	Listeria seeligeri serovar 1/2b str. SLCC3954, complete genome	2797636	2441519	2449373	2797636		Streptococcus_phage(50.0%)	7	NA	NA
WP_003749469.1|2441519_2442491_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	8.8e-52
WP_003749470.1|2442498_2443467_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.7	3.3e-67
WP_012986393.1|2443468_2444344_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_012986394.1|2444451_2446182_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	52.1	7.8e-168
WP_012986395.1|2446227_2447298_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012986396.1|2447312_2448299_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.9	5.1e-55
WP_012986397.1|2448413_2449373_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.1	8.9e-89
>prophage 7
NC_013891	Listeria seeligeri serovar 1/2b str. SLCC3954, complete genome	2797636	2739110	2749165	2797636		Tupanvirus(33.33%)	7	NA	NA
WP_012986588.1|2739110_2741264_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	33.6	2.6e-43
WP_012986589.1|2741310_2743086_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.3	3.7e-80
WP_012986590.1|2743248_2744715_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	1.8e-96
WP_012986591.1|2744998_2745529_-	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	46.6	1.7e-28
WP_012986592.1|2745586_2747197_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	1.0e-44
WP_077904636.1|2747375_2747684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012986593.1|2747710_2749165_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.8	3.6e-49
