The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_004459	Vibrio vulnificus CMCP6 chromosome I, complete sequence	3281866	46829	131384	3281866	plate,tRNA,protease,tail,integrase	Vibrio_phage(28.57%)	96	68395:68454	110788:110847
WP_011078165.1|46829_49847_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_011078166.1|50129_51386_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011078167.1|51410_52481_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011078168.1|52511_52901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043920892.1|52945_53698_+	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_011078170.1|53694_54453_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011078171.1|54547_54808_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_011078172.1|54824_55079_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_011078173.1|55082_55640_+	septation protein IspZ	NA	NA	NA	NA	NA
WP_011078174.1|55647_57015_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_011078175.1|57027_57399_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_011078176.1|57391_59101_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011078177.1|59078_60623_+	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	31.8	7.7e-58
WP_011078178.1|60631_61078_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_043920893.1|61047_61704_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_011078180.1|61693_64003_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_043920894.1|63999_64608_+	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_011078182.1|64617_65805_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_011078183.1|65797_66262_+	hotdog family protein	NA	NA	NA	NA	NA
WP_011078184.1|66258_66984_+	3-oxoacyl-ACP reductase FabG	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	3.1e-09
WP_011078185.1|66980_68210_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
68395:68454	attL	ACCGTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCAGTCCGACCATACACCTAA	NA	NA	NA	NA
WP_039549357.1|69734_69929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078188.1|70129_70645_-	PadR family transcriptional regulator	NA	K7R9C0	Vibrio_phage	39.3	6.4e-09
WP_011078189.1|70656_71277_-	HNH endonuclease	NA	A0A1S5SAI9	Streptococcus_phage	37.6	8.5e-24
WP_011078190.1|71269_71506_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	48.7	1.9e-13
WP_043920895.1|71539_71791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078192.1|71783_72038_-	hypothetical protein	NA	U3PIK2	Vibrio_phage	33.8	3.6e-05
WP_011078193.1|72030_72270_-	DUF3850 domain-containing protein	NA	R9TIU2	Vibrio_phage	56.3	7.5e-13
WP_011078194.1|72273_72837_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	57.5	5.1e-52
WP_011078195.1|72848_75608_-	toprim domain-containing protein	NA	E5E3T2	Burkholderia_phage	50.2	5.8e-266
WP_133295494.1|75573_75879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078197.1|75862_76162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078198.1|76154_76466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078199.1|76476_76692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078200.1|76679_77384_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011078201.1|77413_77893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078202.1|78084_78273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078203.1|78408_79215_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158306836.1|79486_79798_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011078205.1|79781_81095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078206.1|81167_82175_-	hypothetical protein	NA	D4HTW7	Vibrio_phage	36.0	1.5e-41
WP_011078207.1|82165_82372_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_011078208.1|82368_82764_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	39.3	1.4e-19
WP_011078209.1|82772_84899_-	hypothetical protein	NA	A0A2P9JZK0	Alteromonadaceae_phage	42.9	1.7e-76
WP_011078210.1|84939_85350_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_011078211.1|85359_85875_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	34.9	1.4e-16
WP_011078212.1|85886_87047_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1B2LRR3	Wolbachia_phage	39.3	1.0e-70
WP_011078214.1|87479_89810_-|tail	phage tail protein	tail	A0A2I7RNJ3	Vibrio_phage	68.6	1.2e-51
WP_011078215.1|89814_90465_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	37.3	1.9e-21
WP_011078216.1|90461_91322_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	33.4	5.6e-34
WP_011078217.1|91318_91666_-	dTDP-glucose pyrophosphorylase	NA	NA	NA	NA	NA
WP_017788792.1|91669_91957_-	PAAR domain-containing protein	NA	G3MBI0	Bacillus_virus	43.0	3.1e-13
WP_011078218.1|91931_92417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078219.1|92418_93042_-|plate	phage baseplate assembly protein V	plate	D4HTV0	Vibrio_phage	38.3	4.5e-09
WP_011078220.1|93041_93575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078221.1|93574_94075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078222.1|94067_94673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078223.1|94681_94978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078224.1|94967_95564_-	hypothetical protein	NA	A0A1D9CA16	Salinivibrio_phage	57.7	9.5e-57
WP_011078225.1|95613_96204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078226.1|96278_98855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078227.1|98964_99402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078228.1|99407_99983_-	SocA family protein	NA	I6R0L8	Salmonella_phage	37.8	2.6e-19
WP_043920897.1|100190_100520_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011078230.1|100488_100725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133295493.1|100703_101093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078232.1|101321_101861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011078233.1|101865_102054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078234.1|102150_103239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078235.1|103244_104624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043921070.1|104620_106219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078237.1|106211_107177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078238.1|107173_107869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078239.1|108169_108412_-	co-chaperone GroES	NA	NA	NA	NA	NA
WP_011078240.1|108408_109455_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_043920898.1|110094_110658_+	N-acetylmuramidase	NA	A0A286N2Q6	Klebsiella_phage	52.5	5.5e-46
WP_011078242.1|110907_112164_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
110788:110847	attR	ACCGTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCAGTCCGACCATACACCTAA	NA	NA	NA	NA
WP_011078243.1|112135_112804_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	1.2e-26
WP_011078244.1|112895_114089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011078245.1|114277_115477_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_011078246.1|115701_116646_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011078247.1|116691_117663_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011078248.1|117713_117995_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_011078249.1|118170_118833_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_011078251.1|119672_119936_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_123772747.1|120018_121134_-	ribonuclease D	NA	NA	NA	NA	NA
WP_011078253.1|121221_122919_-	long-chain-fatty-acid--CoA ligase FadD	NA	Q75ZG1	Hepacivirus	26.3	1.3e-42
WP_011078254.1|123040_123895_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011078255.1|123894_124449_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011078256.1|124490_124796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078257.1|124821_125523_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	38.5	8.1e-07
WP_011078258.1|125523_127443_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	6.6e-91
WP_011078259.1|127540_127741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011078260.1|127936_128770_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.2	1.9e-15
WP_011078261.1|128833_129430_-	VOC family protein	NA	NA	NA	NA	NA
WP_011078262.1|129650_131384_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.9	7.5e-86
>prophage 2
NC_004459	Vibrio vulnificus CMCP6 chromosome I, complete sequence	3281866	427789	434844	3281866		Powai_lake_megavirus(16.67%)	9	NA	NA
WP_011078529.1|427789_428215_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.4	5.1e-20
WP_011078530.1|428278_429577_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	32.8	6.5e-34
WP_011078531.1|429729_429924_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_011078532.1|430005_430344_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011078533.1|430355_432209_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.0	1.1e-106
WP_011078534.1|432230_432746_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_011078535.1|432806_433130_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	53.3	1.4e-25
WP_011078536.1|433202_433586_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	2.0e-52
WP_011078537.1|433629_434844_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.1	3.7e-31
>prophage 3
NC_004459	Vibrio vulnificus CMCP6 chromosome I, complete sequence	3281866	1552919	1568161	3281866	tRNA	uncultured_Mediterranean_phage(22.22%)	14	NA	NA
WP_011079513.1|1552919_1554221_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.5	1.5e-131
WP_011079514.1|1554465_1554747_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_011079515.1|1554746_1555460_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011079516.1|1555456_1555933_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_011079517.1|1555968_1557012_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_011079518.1|1557017_1557785_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	2.4e-68
WP_011079519.1|1557787_1558414_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.6	2.1e-38
WP_011079520.1|1558457_1559354_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.1	1.5e-13
WP_011079521.1|1559434_1560427_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.8	1.2e-35
WP_011079522.1|1560502_1563064_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.2	1.3e-30
WP_011079523.1|1563147_1563651_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	43.9	1.4e-24
WP_011079524.1|1563784_1564834_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.1	1.4e-111
WP_011079525.1|1564937_1565399_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011079526.1|1565578_1568161_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	6.6e-78
