The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010545	Corynebacterium urealyticum DSM 7109, complete genome	2369219	16955	82344	2369219	transposase,integrase,protease	Pandoravirus(15.38%)	52	16761:16810	28594:28643
16761:16810	attL	CATCTGCTTTGCAAGCAGAAGGTCAGGAGTTCGATTCTCCTATGCTCCAC	NA	NA	NA	NA
WP_081477605.1|16955_18119_+|integrase	tyrosine-type recombinase/integrase	integrase	Q1WDJ5	Streptomyces_phage	24.3	1.1e-11
WP_012359279.1|18630_19635_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012359280.1|19631_20303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359283.1|23002_23485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359284.1|23901_24762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359285.1|25056_25629_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012359286.1|25646_27146_-	MFS transporter	NA	NA	NA	NA	NA
WP_012359287.1|27417_27957_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	47.2	1.1e-32
WP_012359288.1|28107_28431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081477606.1|28775_29753_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
28594:28643	attR	CATCTGCTTTGCAAGCAGAAGGTCAGGAGTTCGATTCTCCTATGCTCCAC	NA	NA	NA	NA
WP_012359290.1|29755_30559_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012359291.1|30771_31110_+	transglycosylase family protein	NA	A0A1I9SA30	Rhodococcus_phage	60.6	1.4e-28
WP_012359292.1|31565_32750_-|transposase	IS256-like element IS3503 family transposase	transposase	NA	NA	NA	NA
WP_012359293.1|32933_33845_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012359294.1|33968_35336_+	MFS transporter	NA	NA	NA	NA	NA
WP_012359295.1|35361_35859_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_012359296.1|35977_36325_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012359297.1|36405_37524_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012359298.1|37520_37940_+	low molecular weight phosphatase family protein	NA	A0A2H4PQT9	Staphylococcus_phage	31.9	2.6e-08
WP_012359300.1|40631_41981_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	9.4e-36
WP_012359301.1|42100_42448_+	hypothetical protein	NA	Q6NE04	Leptospira_phage	39.1	5.8e-14
WP_012359302.1|42649_43828_+|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
WP_012359303.1|44104_44785_+	Abi family protein	NA	NA	NA	NA	NA
WP_012359307.1|46243_46903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041628436.1|47355_47649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359308.1|47797_48502_-	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_012359309.1|48671_49154_-	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
WP_012359312.1|50647_51778_+	alanine--glyoxylate aminotransferase family protein	NA	A0A0N9QIZ2	Chrysochromulina_ericina_virus	41.0	1.2e-76
WP_012359313.1|51894_52242_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012359314.1|52304_54377_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	40.9	2.5e-56
WP_012359315.1|54385_56083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359316.1|56266_56791_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.3	6.7e-22
WP_012359317.1|56798_57491_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012359318.1|57535_57814_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_012359319.1|57958_58645_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	42.2	4.3e-37
WP_012359320.1|58675_60853_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8JE84	Murine_leukemia_virus	30.5	2.7e-16
WP_012359321.1|61030_62674_-	serine/threonine protein kinase	NA	S4W2F5	Pandoravirus	29.6	5.4e-17
WP_012359322.1|62676_64125_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_012359323.1|64121_65507_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_012359324.1|65508_67077_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_012359325.1|67073_67589_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_012359326.1|67773_69006_-	DUF3662 domain-containing protein	NA	NA	NA	NA	NA
WP_012359327.1|69517_70144_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012359328.1|70186_71857_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	30.3	7.1e-09
WP_012359330.1|73576_74542_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012359331.1|74538_76254_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012359332.1|76489_77053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012359333.1|77191_77992_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_012359334.1|78068_79331_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_012359335.1|79275_80412_+	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_012359336.1|80534_81527_-	asparaginase	NA	NA	NA	NA	NA
WP_012359337.1|81714_82344_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_010545	Corynebacterium urealyticum DSM 7109, complete genome	2369219	1629142	1687487	2369219	capsid,portal,protease,integrase	Corynebacterium_phage(22.22%)	58	1652954:1652994	1687627:1687667
WP_012360626.1|1629142_1630417_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.8	1.1e-134
WP_012360627.1|1630585_1631206_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.5	1.2e-38
WP_173362360.1|1631209_1631782_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.7	2.9e-42
WP_041628496.1|1632031_1633594_-	trigger factor	NA	NA	NA	NA	NA
WP_012360630.1|1634315_1634789_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_012360631.1|1634794_1635499_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_012360632.1|1635587_1638254_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.0	2.3e-41
WP_081477612.1|1638479_1638842_+	globin	NA	NA	NA	NA	NA
WP_012360634.1|1638838_1639654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360635.1|1639664_1639856_-	RtcB family protein	NA	G8I4I6	Mycobacterium_phage	74.6	3.1e-17
WP_012360636.1|1639926_1640952_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_012360637.1|1641009_1642680_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	26.8	3.3e-46
WP_012360638.1|1642898_1643552_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012360639.1|1643745_1646046_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_012360640.1|1646394_1647240_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012360641.1|1647270_1647900_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	38.8	7.8e-25
WP_012360644.1|1649736_1650003_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012360645.1|1649999_1650209_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_012360646.1|1650312_1651344_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_012360647.1|1651353_1652577_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
1652954:1652994	attL	CAGTGGGTCCGGGGTTCGAATCCCTGATGGCCCACCACTGA	NA	NA	NA	NA
WP_012360649.1|1653378_1653597_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012360650.1|1653593_1654040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360651.1|1654026_1654449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095075326.1|1654472_1654856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360653.1|1654852_1655302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360654.1|1655301_1655607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360655.1|1655603_1655867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360657.1|1656478_1657426_+	HNH endonuclease	NA	A0A1W6JRD2	Corynebacterium_phage	52.8	1.6e-69
WP_148264200.1|1657887_1658418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157727788.1|1659299_1659461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628498.1|1659941_1660343_+	bifunctional DNA primase/polymerase	NA	A0A220NQN1	Corynebacterium_phage	58.0	8.1e-36
WP_041628499.1|1660418_1660661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360660.1|1660623_1662066_+	hypothetical protein	NA	A0A0S1S2I3	Propionibacterium_phage	39.5	7.4e-79
WP_012360661.1|1662062_1663466_+|portal	phage portal protein	portal	S5XYN1	Mycobacterium_phage	41.7	4.8e-91
WP_012360662.1|1663440_1664715_+	EndoU domain-containing protein	NA	A0A2H4PEX4	Gordonia_phage	39.1	1.9e-06
WP_148264202.1|1664720_1665002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360664.1|1665188_1665725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360665.1|1665776_1666685_+|capsid	phage major capsid protein	capsid	A0A142KBU3	Gordonia_phage	55.7	1.3e-89
WP_041628500.1|1666698_1666884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360666.1|1666905_1667376_+	hypothetical protein	NA	A0A2H4IYA5	uncultured_Caudovirales_phage	53.7	2.0e-33
WP_012360668.1|1667732_1667915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360669.1|1667914_1668154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360670.1|1668222_1668522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628503.1|1668595_1669261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360672.1|1669333_1669612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360673.1|1669680_1670028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360674.1|1670058_1676364_+	tape measure protein	NA	A0A1W6JQH4	Corynebacterium_phage	32.3	5.7e-75
WP_012360675.1|1676388_1677165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360676.1|1677188_1678070_+	immunity-specific protein	NA	A0A1L6BZG4	Pasteurella_phage	25.0	3.6e-12
WP_012360677.1|1678076_1679417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360678.1|1679416_1680595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360679.1|1680599_1681961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360680.1|1682199_1682352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360683.1|1684073_1684535_+	hypothetical protein	NA	A0A220NQQ7	Corynebacterium_phage	45.6	1.6e-27
WP_012360684.1|1684524_1684872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360685.1|1684930_1685788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360686.1|1685790_1686597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360687.1|1686689_1687487_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1CCU8	Gordonia_phage	47.4	2.5e-52
1687627:1687667	attR	CAGTGGGTCCGGGGTTCGAATCCCTGATGGCCCACCACTGA	NA	NA	NA	NA
>prophage 3
NC_010545	Corynebacterium urealyticum DSM 7109, complete genome	2369219	1700917	1743800	2369219	transposase,protease,tRNA	Bacillus_phage(25.0%)	37	NA	NA
WP_148264203.1|1700917_1702152_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	43.3	3.8e-60
WP_141759501.1|1702353_1702686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360704.1|1703035_1704553_-	hypothetical protein	NA	A0A1I9SA50	Rhodococcus_phage	37.9	3.6e-36
WP_012360705.1|1704769_1706119_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	7.2e-36
WP_148264203.1|1707207_1708442_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	43.3	3.8e-60
WP_012360708.1|1708912_1709356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360709.1|1709410_1709791_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_012360710.1|1709819_1711175_-	amidohydrolase	NA	NA	NA	NA	NA
WP_012360711.1|1711257_1711896_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_012360712.1|1711930_1712704_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_012360713.1|1712725_1713520_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012360714.1|1713687_1714554_-	glutamate racemase	NA	NA	NA	NA	NA
WP_012360715.1|1714663_1715248_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012360716.1|1715316_1716513_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_012360717.1|1716487_1717237_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_173362319.1|1717206_1717512_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_050816668.1|1717714_1719052_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012360720.1|1719133_1721137_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.5	3.5e-63
WP_012360721.1|1721286_1722858_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	31.2	6.6e-57
WP_012360722.1|1722937_1723735_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012360723.1|1723803_1725192_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_012360724.1|1725290_1726988_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_012360725.1|1727294_1728290_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	75.3	4.1e-137
WP_041628508.1|1728539_1729031_+	ferritin	NA	NA	NA	NA	NA
WP_012360727.1|1729160_1731320_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.4	9.9e-213
WP_012360728.1|1731410_1731845_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.4	2.5e-14
WP_012360729.1|1731852_1733187_-	MFS transporter	NA	NA	NA	NA	NA
WP_012360730.1|1733513_1733744_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	60.5	1.5e-18
WP_005288826.1|1734109_1734232_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_012360731.1|1734413_1735247_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.7	3.3e-79
WP_012360732.1|1735243_1735633_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_012360733.1|1735659_1736304_-	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_012360734.1|1736544_1738902_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_012360735.1|1738993_1739494_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173362320.1|1739756_1740947_+|transposase	IS256-like element ISCur3 family transposase	transposase	NA	NA	NA	NA
WP_081477615.1|1741061_1742441_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.9	2.5e-39
WP_012360738.1|1742621_1743800_+|transposase	IS256-like element ISCur2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_010545	Corynebacterium urealyticum DSM 7109, complete genome	2369219	1863856	1982703	2369219	transposase,protease,tRNA	Bacillus_phage(12.5%)	106	NA	NA
WP_012360833.1|1863856_1865206_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	7.2e-36
WP_041628514.1|1865299_1866208_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_012360835.1|1866273_1867653_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.9	2.5e-39
WP_041628515.1|1868147_1868561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158307922.1|1868756_1869890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360838.1|1869786_1870140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360841.1|1872144_1873650_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_148264206.1|1873885_1875064_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_012360843.1|1875138_1875696_-	gluconokinase	NA	NA	NA	NA	NA
WP_012360844.1|1875754_1876906_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_012360845.1|1876958_1877978_-	mycothiol synthase	NA	NA	NA	NA	NA
WP_012360846.1|1878090_1878987_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_012360847.1|1878997_1879744_+	FABP family protein	NA	NA	NA	NA	NA
WP_041628516.1|1879756_1880647_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_012360849.1|1880833_1882009_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_012360850.1|1882226_1882400_+	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_012360851.1|1882639_1883818_+|transposase	IS256-like element ISCur2 family transposase	transposase	NA	NA	NA	NA
WP_012360852.1|1883961_1885029_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FK46	Synechococcus_phage	40.6	2.2e-59
WP_173362363.1|1885079_1886630_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.0	1.6e-47
WP_081477632.1|1886705_1887089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173362364.1|1887345_1888362_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012360855.1|1888411_1889722_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_012360856.1|1889792_1890452_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012360857.1|1890491_1892954_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	55.7	8.9e-234
WP_012360858.1|1893012_1893681_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012360859.1|1893677_1893923_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012360860.1|1894081_1896298_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_012360861.1|1896679_1897495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360862.1|1897707_1898601_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.9	2.0e-42
WP_012360863.1|1898668_1899886_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_173362322.1|1899931_1900360_-	NfeD family protein	NA	NA	NA	NA	NA
WP_012360865.1|1900399_1901842_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_012360866.1|1901897_1902800_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_041628517.1|1902818_1904096_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_173362323.1|1904188_1904626_+	HIT family protein	NA	NA	NA	NA	NA
WP_012360869.1|1904648_1905512_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012360870.1|1905450_1907040_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.3	3.1e-22
WP_070759720.1|1907052_1907760_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	2.8e-31
WP_012360872.1|1908043_1908850_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012360873.1|1908950_1909481_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012360874.1|1909511_1911275_-	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_012360875.1|1911274_1911700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157727790.1|1911680_1911821_+	plantazolicin family RiPP	NA	NA	NA	NA	NA
WP_012360876.1|1911928_1912525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360877.1|1912526_1913234_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012360878.1|1913236_1913938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360879.1|1913944_1914916_+	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_012360880.1|1914917_1916312_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_012360881.1|1916323_1917157_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_012360882.1|1917153_1917732_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_095075328.1|1919196_1919409_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012360886.1|1919431_1920781_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	4.2e-36
WP_081477620.1|1920717_1921320_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.7	7.4e-17
WP_095075329.1|1922468_1923696_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.9	5.7e-64
WP_041628620.1|1923995_1925186_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_012360892.1|1925428_1927156_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_173362365.1|1927250_1927646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360894.1|1927700_1929260_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_012360895.1|1929259_1929772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360896.1|1929835_1930789_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_012360897.1|1930878_1932009_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012360898.1|1932116_1933157_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012360899.1|1933153_1933855_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	29.6	1.1e-11
WP_012360900.1|1933851_1934859_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012360901.1|1934944_1935898_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_012360902.1|1935992_1936583_-	thiamine biosynthesis protein X	NA	NA	NA	NA	NA
WP_012360903.1|1936682_1937732_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012360904.1|1937721_1938909_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012360905.1|1938908_1939685_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.3e-16
WP_012360906.1|1939707_1940379_+	biliverdin-producing heme oxygenase	NA	Q58M64	Prochlorococcus_phage	38.6	2.0e-31
WP_012360907.1|1940433_1941897_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L4N2	Tupanvirus	32.7	8.6e-43
WP_012360908.1|1942095_1942926_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012360910.1|1943297_1943786_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_012360911.1|1943831_1944629_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012360912.1|1944691_1945264_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_012360913.1|1945586_1946159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360914.1|1946294_1947695_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_012360915.1|1947698_1948466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173362366.1|1948615_1949230_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_012360917.1|1949517_1950501_+	DNA glycosylase	NA	NA	NA	NA	NA
WP_012360918.1|1950690_1952082_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_012360919.1|1952166_1953540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360920.1|1953768_1956453_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	39.8	2.0e-130
WP_012360921.1|1956854_1958630_+	bile acid CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	6.0e-30
WP_012360922.1|1958773_1960381_-	inorganic phosphate transporter	NA	V5LQA0	Emiliania_huxleyi_virus	28.6	1.2e-37
WP_012360923.1|1960619_1961825_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012360924.1|1961890_1963291_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012360925.1|1963483_1965031_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	33.4	7.9e-71
WP_012360926.1|1965217_1966426_-	hemoglobin flavoprotein	NA	NA	NA	NA	NA
WP_012360927.1|1966463_1966958_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_012360928.1|1967101_1967521_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_012360929.1|1967540_1968533_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_012360930.1|1968538_1969486_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_012360931.1|1969533_1970751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360932.1|1970777_1971254_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_012360933.1|1971264_1971933_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_012360934.1|1971937_1972315_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_173362367.1|1972307_1973162_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	34.3	1.1e-24
WP_012360936.1|1973333_1973948_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	56.0	8.3e-48
WP_012360937.1|1973968_1976482_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	49.4	3.8e-107
WP_012360938.1|1976560_1977163_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	26.1	1.6e-11
WP_095075342.1|1977155_1978316_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_012360940.1|1978468_1979845_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_012360941.1|1979988_1980471_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	47.0	8.6e-32
WP_012360942.1|1980719_1981424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360943.1|1981524_1982703_+|transposase	IS256-like element ISCur2 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_010545	Corynebacterium urealyticum DSM 7109, complete genome	2369219	2118874	2180189	2369219	transposase,holin,protease	Tupanvirus(14.29%)	45	NA	NA
WP_095075332.1|2118874_2120067_-|transposase	IS3-like element IS3502 family transposase	transposase	U5P429	Shigella_phage	29.8	2.9e-20
WP_012361064.1|2123288_2124317_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.7	2.2e-29
WP_012361068.1|2126060_2126927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173362369.1|2126999_2128217_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_012361070.1|2128300_2129755_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.1	1.9e-66
WP_041628532.1|2129829_2130396_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	71.3	1.3e-74
WP_012361072.1|2130866_2132318_+	LssY C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_041628629.1|2132525_2133968_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012361074.1|2134057_2135329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361075.1|2135415_2136840_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	5.5e-42
WP_012361076.1|2137231_2138356_+	esterase family protein	NA	NA	NA	NA	NA
WP_012361077.1|2138435_2139764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012361079.1|2139760_2141107_-	MFS transporter	NA	NA	NA	NA	NA
WP_012361078.1|2141062_2143210_+	acyl-CoA dehydrogenase family protein	NA	A0A2K9L6M4	Tupanvirus	35.2	3.3e-51
WP_012361080.1|2143326_2145162_+	FUSC family protein	NA	NA	NA	NA	NA
WP_012361082.1|2145490_2146837_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.8	2.0e-09
WP_081477621.1|2146835_2148362_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.4	2.0e-21
WP_012361083.1|2148612_2151546_-	type I DNA topoisomerase	NA	H2EFW7	Moumouvirus	35.8	1.6e-96
WP_012361084.1|2151850_2152054_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.1	2.8e-16
WP_012361085.1|2152282_2154721_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_012361086.1|2155142_2156606_+	secretory lipase	NA	NA	NA	NA	NA
WP_012361087.1|2156799_2157105_-	flp pilus-assembly TadE/G-like family protein	NA	NA	NA	NA	NA
WP_012361088.1|2157082_2157403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050816671.1|2157403_2157595_-	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_012361090.1|2157830_2158991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361091.1|2158987_2160286_-	TadA family conjugal transfer-associated ATPase	NA	NA	NA	NA	NA
WP_012361092.1|2160272_2161391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361093.1|2161629_2162526_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_173362325.1|2162555_2163350_-	oxidoreductase	NA	NA	NA	NA	NA
WP_012361095.1|2163461_2163980_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012361096.1|2164068_2164938_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012361097.1|2164980_2166174_-|protease	MarP family serine protease	protease	NA	NA	NA	NA
WP_012361098.1|2166185_2166998_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_158307923.1|2167002_2167533_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_012361101.1|2167856_2168726_-	endonuclease III	NA	NA	NA	NA	NA
WP_012361100.1|2168712_2169396_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_041628534.1|2169572_2170436_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012361103.1|2170470_2170959_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	34.4	6.2e-14
WP_095075344.1|2170961_2171117_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_158307924.1|2171301_2171622_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	47.8	4.7e-10
WP_012361106.1|2172209_2174390_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_141759404.1|2174493_2175567_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_169847096.1|2175863_2176895_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	1.2e-38
WP_012360835.1|2177566_2178946_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.9	2.5e-39
WP_012361109.1|2179010_2180189_-|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_010545	Corynebacterium urealyticum DSM 7109, complete genome	2369219	2235355	2255281	2369219	transposase,tRNA	uncultured_virus(50.0%)	18	NA	NA
WP_012361150.1|2235355_2236705_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	9.4e-36
WP_012361151.1|2236953_2238138_+|transposase	IS256-like element IS3503 family transposase	transposase	NA	NA	NA	NA
WP_012361152.1|2238359_2239538_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_005323424.1|2239728_2240907_+|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
WP_071569110.1|2240957_2241023_+	erythromycin resistance leader peptide	NA	NA	NA	NA	NA
WP_011117480.1|2241122_2241977_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(X)	NA	E4ZFQ0	Streptococcus_phage	27.6	7.1e-13
WP_011116966.1|2242141_2242714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005323424.1|2242868_2244047_+|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
WP_148264209.1|2244598_2244901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361151.1|2245028_2246213_-|transposase	IS256-like element IS3503 family transposase	transposase	NA	NA	NA	NA
WP_012361154.1|2246367_2247717_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	9.4e-36
WP_012361155.1|2247807_2247993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361156.1|2248125_2249013_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_050816653.1|2249009_2250068_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_081477624.1|2250060_2251416_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	33.9	8.8e-58
WP_012361159.1|2251453_2253859_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_012361160.1|2254200_2254797_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_012361161.1|2254711_2255281_-|tRNA	tRNA adenosine deaminase-associated protein	tRNA	NA	NA	NA	NA
