The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014032	Salinibacter ruber M8, complete genome	3619447	219813	289804	3619447	transposase,protease	uncultured_Caudovirales_phage(14.29%)	58	NA	NA
WP_013060664.1|219813_220734_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_118827548.1|221861_222266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013060666.1|222295_223258_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_148278336.1|223482_223824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013060667.1|224068_225697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043551715.1|225727_226411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043551716.1|227205_227844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148278337.1|228032_228284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013060672.1|228988_229819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013060674.1|230508_231087_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_013060675.1|231209_231848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043551723.1|232359_233904_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_118827549.1|234228_235806_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	74.4	5.9e-05
WP_013060680.1|236292_236610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013060681.1|236674_237289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158442652.1|237408_237561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013060682.1|237779_238166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043551727.1|239447_240056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043551729.1|240442_240925_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_158442653.1|241090_241930_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_043551731.1|242108_243116_-	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_051010908.1|243150_245421_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_013060688.1|245920_246952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158442654.1|247777_249556_+	PAS domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	23.2	1.3e-05
WP_013060690.1|249569_250220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013060693.1|251166_251304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013060694.1|251538_252435_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	1.0e-22
WP_051010910.1|252602_256328_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_043551737.1|256918_257959_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148278338.1|260568_260844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158442655.1|261362_261650_+	PqqD family peptide modification chaperone	NA	NA	NA	NA	NA
WP_148278339.1|261658_262606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013060704.1|262602_264672_+	lasso peptide isopeptide bond-forming cyclase	NA	E5EQ62	Micromonas_sp._RCC1109_virus	30.4	1.5e-08
WP_158442656.1|264931_265036_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013060705.1|265684_266023_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013060706.1|266126_266660_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_013060707.1|266628_266895_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_013060708.1|266978_268442_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013060710.1|269843_270233_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.7	6.7e-19
WP_118825850.1|270229_270697_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_118827550.1|270774_273519_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_013060712.1|273701_274808_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_013060713.1|274797_275382_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_043551747.1|275540_277643_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_013060715.1|277733_278222_-	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_013060716.1|278623_278920_-	UPF0175 family protein	NA	NA	NA	NA	NA
WP_118825851.1|279121_279298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013060718.1|280642_281056_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_013060719.1|281097_282297_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	29.3	2.4e-35
WP_118825853.1|282300_282681_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_013060720.1|282881_283181_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_013060721.1|283416_283794_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013060724.1|284883_285291_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_013060725.1|285306_285528_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_013060726.1|285580_286039_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_013060729.1|287206_287530_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013060731.1|287933_288362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013060732.1|288541_289804_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	I7II68	Campylobacter_virus	29.0	3.2e-09
>prophage 2
NC_014032	Salinibacter ruber M8, complete genome	3619447	833234	897775	3619447	integrase,transposase	Bacillus_phage(20.0%)	58	858814:858835	900738:900759
WP_148278478.1|833234_833642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081580656.1|833683_834007_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013061126.1|836642_837950_+	chain-length determining protein	NA	NA	NA	NA	NA
WP_013061127.1|838270_839512_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013061128.1|839582_840977_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.8	3.3e-84
WP_013061130.1|841252_843052_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	5.1e-29
WP_013061131.1|843115_844114_+	SDR family NAD(P)-dependent oxidoreductase	NA	M4QPK0	Synechococcus_phage	31.0	1.7e-26
WP_051010766.1|844145_845372_+	LegC family aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	25.8	1.2e-16
WP_158442673.1|845429_846389_+	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_013061134.1|846416_847223_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_013061135.1|847223_848138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013061136.1|848134_849211_+	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_013061137.1|849248_849878_+	acetyltransferase	NA	NA	NA	NA	NA
WP_013061138.1|849889_850939_+	CBS domain-containing protein	NA	H9NC64	Sphingomonas_phage	28.9	2.0e-09
WP_013061143.1|854008_855418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013061144.1|855972_856698_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_081580657.1|856685_857384_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_148278479.1|858192_858333_+	hypothetical protein	NA	NA	NA	NA	NA
858814:858835	attL	CAACTAAGTTTGCATTTACGCC	NA	NA	NA	NA
WP_158442674.1|859253_860066_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_081580659.1|860074_861325_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_081580660.1|863239_864445_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_158442675.1|864522_865347_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013061149.1|865357_866143_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_043551943.1|866225_867311_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_043551945.1|867413_868265_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013061152.1|868338_869316_+	GDP-mannose 4,6-dehydratase	NA	A0A0E3FNQ3	Synechococcus_phage	33.5	1.6e-37
WP_013061153.1|869395_870538_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0K0KWL2	Prochlorococcus_phage	43.0	1.5e-66
WP_013061154.1|870557_871817_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_043552997.1|872242_873604_+	nucleotide sugar dehydrogenase	NA	M1HKZ1	Paramecium_bursaria_Chlorella_virus	26.3	5.4e-31
WP_013061156.1|873726_874320_+	archaeosortase/exosortase family protein	NA	NA	NA	NA	NA
WP_148278367.1|874461_874866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158442676.1|874919_875093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013061159.1|875459_876578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013061162.1|877717_878059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043552999.1|878321_878636_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_148278480.1|878614_878962_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_148278369.1|879934_880186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043551952.1|881670_882018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081580662.1|882665_883055_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013061170.1|883051_883336_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_148278370.1|883423_883615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013061172.1|884021_885263_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_158442677.1|885444_885600_-	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_013061174.1|885996_886263_-	UPF0175 family protein	NA	NA	NA	NA	NA
WP_013061175.1|886629_887487_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013061176.1|887530_888580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043551956.1|888722_889430_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043551958.1|889671_889950_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_013061179.1|890356_890692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013061180.1|890970_891252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043551960.1|891320_891770_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_051010768.1|891971_892322_-	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	42.5	1.1e-09
WP_051010769.1|892516_892723_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013061184.1|893357_893855_-	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_013061185.1|893954_894218_-	UPF0175 family protein	NA	NA	NA	NA	NA
WP_081580663.1|894691_894838_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_013061186.1|895108_896299_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.0e-35
WP_013061188.1|896770_897775_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
900738:900759	attR	CAACTAAGTTTGCATTTACGCC	NA	NA	NA	NA
>prophage 3
NC_014032	Salinibacter ruber M8, complete genome	3619447	901794	934231	3619447	integrase,transposase	Enterococcus_phage(16.67%)	43	898041:898066	932590:932615
898041:898066	attL	CCCGAACCGACAGGTTCATATCCCCC	NA	NA	NA	NA
WP_118841017.1|901794_902512_+|transposase	IS1-like element ISSru2 family transposase	transposase	NA	NA	NA	NA
WP_013061195.1|902626_902902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013061196.1|902905_903277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013061198.1|903844_904165_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_013061199.1|904175_904529_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_013061200.1|904652_904802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158442679.1|904792_904969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043551965.1|905569_905803_+	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_013061203.1|905799_906171_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_148278373.1|906480_906768_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_081580720.1|906826_907048_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_051010771.1|907278_907650_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013061207.1|907858_908098_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_173387059.1|908094_908235_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_118828477.1|908292_909011_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_013061211.1|909027_909186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013061212.1|909645_909942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013061213.1|910179_911943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013061215.1|912205_912448_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_013061216.1|912444_912792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043551967.1|913123_913816_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_013061218.1|914221_914797_+|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_051010773.1|914985_915438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013061221.1|915646_917704_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_158442680.1|918101_919115_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081580721.1|920252_920948_+	sugar transferase	NA	NA	NA	NA	NA
WP_081580666.1|920913_921339_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	57.6	2.6e-24
WP_013061225.1|921837_922773_+	NAD-dependent epimerase/dehydratase family protein	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	34.1	2.8e-39
WP_013061228.1|923549_923858_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081580667.1|925411_925594_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	51.8	8.5e-09
WP_043551974.1|925610_925895_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_011403402.1|926005_926695_-	UpxY family transcription antiterminator	NA	NA	NA	NA	NA
WP_013061231.1|927161_927326_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_043551976.1|927410_927644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081580668.1|927585_927837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013061233.1|927882_928185_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_043551980.1|928944_929928_+	GDP-mannose 4,6-dehydratase	NA	A0A1V0SAI6	Catovirus	32.2	4.8e-37
WP_013061235.1|930113_930401_+	UPF0175 family protein	NA	NA	NA	NA	NA
WP_118826138.1|930400_930592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043551984.1|931202_931502_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_011403410.1|932179_932425_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_043551986.1|932695_933094_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	34.4	2.6e-18
932590:932615	attR	GGGGGATATGAACCTGTCGGTTCGGG	NA	NA	NA	NA
WP_013061241.1|933097_934231_+|transposase	transposase	transposase	G9CU70	Helicobacter_phage	40.1	3.4e-63
>prophage 1
NC_014157	Salinibacter ruber M8 plasmid pSR84, complete sequence	84340	0	11673	84340	transposase	Pelagibacter_phage(100.0%)	8	NA	NA
WP_081580620.1|1008_1713_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_158442644.1|3964_5203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013124648.1|5411_6059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043551551.1|6283_6895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118841017.1|7599_8317_+|transposase	IS1-like element ISSru2 family transposase	transposase	NA	NA	NA	NA
WP_043551553.1|9181_9490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013124653.1|9570_10011_+	curli production assembly/transport component CsgF precursor	NA	NA	NA	NA	NA
WP_051010719.1|10383_11673_+	hypothetical protein	NA	M1ICK2	Pelagibacter_phage	45.9	5.1e-39
>prophage 2
NC_014157	Salinibacter ruber M8 plasmid pSR84, complete sequence	84340	33011	38589	84340		Escherichia_phage(80.0%)	5	NA	NA
WP_013124663.1|33011_33800_-	DUF3435 domain-containing protein	NA	A0A142F1N9	Bacillus_phage	32.4	7.2e-12
WP_013124665.1|34951_35860_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	35.4	7.0e-27
WP_043551565.1|35872_36433_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	45.5	1.6e-42
WP_043551567.1|36462_37380_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.7	1.2e-95
WP_013124668.1|37521_38589_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.4	4.9e-88
>prophage 3
NC_014157	Salinibacter ruber M8 plasmid pSR84, complete sequence	84340	57294	61800	84340		Hokovirus(100.0%)	1	NA	NA
WP_013124686.1|57294_61800_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.2	2.3e-46
>prophage 4
NC_014157	Salinibacter ruber M8 plasmid pSR84, complete sequence	84340	71552	74661	84340		uncultured_virus(50.0%)	3	NA	NA
WP_051010733.1|71552_72524_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.7	4.4e-11
WP_013124700.1|73435_73717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081580623.1|73773_74661_-	ParA family protein	NA	A0A240F4U1	Ochrobactrum_phage	29.2	1.9e-08
>prophage 5
NC_014157	Salinibacter ruber M8 plasmid pSR84, complete sequence	84340	82934	83426	84340		Pseudomonas_phage(100.0%)	1	NA	NA
WP_158442647.1|82934_83426_+	reverse transcriptase-like protein	NA	A0A0U4J920	Pseudomonas_phage	43.0	2.4e-13
