The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	601872	670745	5697240	head,integrase,portal,tRNA,tail,terminase,protease,transposase,lysis,capsid	Enterobacteria_phage(55.36%)	77	612033:612079	662219:662265
WP_000912342.1|601872_603258_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|603293_603815_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|603922_604135_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|604136_605003_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|605483_606026_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|606245_606938_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|606968_609578_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|609556_610597_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|610607_611123_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|611125_611758_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
612033:612079	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|612092_613256_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|613454_613733_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|613780_613999_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|614097_614379_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|614389_614581_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|614553_614736_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|614732_615413_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|615409_616195_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|616200_616497_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|616572_616863_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|617329_617650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|617785_618049_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|618130_618820_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|618924_619155_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|619224_619764_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147885.1|619760_620780_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.8e-109
WP_000788789.1|620776_621478_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|621682_622030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|622782_623391_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|623690_624107_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|624085_624487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|624610_624712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|624708_625164_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|625163_625334_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|625326_625617_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|625613_625976_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|625972_626113_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|626198_626582_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|626770_627853_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|628441_628657_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|628656_629154_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|629370_629553_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|629643_629937_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_165963871.1|630277_631491_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.0e-166
WP_001427981.1|631608_631803_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|632191_632737_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027297.1|632711_634637_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|634633_634840_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001375452.1|634836_636438_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
WP_000381395.1|636910_638482_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|638501_638849_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|638848_639526_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001345004.1|640454_640787_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063244.1|640842_641868_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|641909_642305_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|642316_642691_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|642681_643260_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|643256_643652_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|643659_644400_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|644415_644838_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|644819_645254_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|645246_647808_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000847347.1|647804_648134_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152557.1|648133_648832_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000090884.1|649517_650150_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000515439.1|650210_653624_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|653694_654294_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000268807.1|654358_657319_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
WP_000885569.1|657318_657903_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|657957_658626_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226384.1|659171_660656_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|660842_661796_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|662308_663070_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
662219:662265	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|663252_664143_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001375368.1|664143_667116_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383941.1|667102_669340_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|669608_670745_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	890273	940783	5697240	head,integrase,portal,tail,terminase,holin,protease,transposase,lysis	Enterobacteria_phage(52.38%)	67	886021:886036	893092:893107
886021:886036	attL	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000533654.1|890273_891344_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|891321_891540_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|891646_891991_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|892019_892187_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|892259_892544_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|892536_892839_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|892835_893453_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
893092:893107	attR	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000034231.1|893454_894012_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|894008_894566_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|894562_894727_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|894737_895031_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|895054_895438_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|895437_896043_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_085948186.1|896232_897388_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000010963.1|897429_897570_-	hypothetical protein	NA	A0A088CPT7	Enterobacteria_phage	100.0	3.7e-20
WP_001243354.1|897566_897719_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|897703_897835_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001341800.1|897859_898720_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000788880.1|900464_901166_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|901162_901453_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|901749_902106_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|902077_902488_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|902484_902661_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_162830411.1|902903_904117_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	5.8e-170
WP_000221847.1|904207_904378_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	5.1e-24
WP_001341811.1|904337_904547_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|904539_905262_+	phage antirepressor KilAC domain-containing protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|905261_905552_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|905548_905911_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|905907_906096_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|906307_907267_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|907605_907728_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|907742_908432_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|908616_909360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|909445_909604_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_024164617.1|912205_912421_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|912420_912918_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092330.1|912914_913352_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.1e-70
WP_000881326.1|913501_914119_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|914306_914501_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|914896_915406_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_009442816.1|915377_917306_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|917289_917496_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001432013.1|917492_919085_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_000839179.1|919328_919733_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612622.1|919729_920077_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000099160.1|920125_921664_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|921660_922029_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143027.1|922036_922789_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
WP_000479086.1|922802_923234_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|923260_923674_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082321.1|923654_926234_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
WP_000847304.1|926230_926560_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|926559_927258_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_001429308.1|927263_928007_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_096844540.1|927952_928585_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_000515142.1|928830_932307_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001230449.1|932374_932974_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000268998.1|933038_934253_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|934254_934524_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|934629_935511_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|935734_936562_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_021351651.1|936685_937057_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|937531_939103_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|939122_939470_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|939469_940147_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|940207_940783_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
>prophage 3
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	1155889	1292373	5697240	head,integrase,portal,tail,terminase,holin,protease,transposase,capsid	Escherichia_phage(37.39%)	164	1200649:1200664	1298727:1298742
WP_000156528.1|1155889_1157650_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877167.1|1157835_1158288_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1158362_1159403_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1159759_1160269_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1160487_1161117_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1161079_1163242_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1163251_1163698_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1163820_1165875_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1165906_1166365_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1166460_1167123_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1167295_1167709_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1167753_1168071_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116301.1|1168128_1169319_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1169413_1169692_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1169688_1170018_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1170108_1170768_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299351.1|1171175_1172195_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1172172_1172415_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048583.1|1172482_1174933_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_001098307.1|1175026_1175218_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1175214_1175403_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1175970_1176180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394543.1|1176180_1176819_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_000380316.1|1176830_1176983_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001303876.1|1177259_1177547_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1177546_1177738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1177765_1178167_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1178275_1178548_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1178531_1178957_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1179163_1179619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205821.1|1179697_1180813_+	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
WP_000788742.1|1180819_1181566_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_000451007.1|1181587_1182358_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|1182373_1182787_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_162829202.1|1183377_1184591_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000955173.1|1185589_1185727_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000813254.1|1185828_1185984_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001341388.1|1186151_1186430_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265141.1|1186431_1187481_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_001217436.1|1187493_1187865_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1187854_1188226_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1188377_1189196_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1189482_1189680_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261902.1|1189817_1190531_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874350.1|1191298_1193149_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_024182511.1|1193587_1193803_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000138558.1|1194058_1194331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1194490_1195024_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1195244_1195358_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1195579_1195765_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1196291_1196606_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1196687_1196912_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453587.1|1197308_1197854_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1197828_1199754_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1199750_1199957_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|1199953_1201555_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
1200649:1200664	attL	GTTCATTCACGTCTTT	NA	NA	NA	NA
WP_000123251.1|1201535_1202855_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1202864_1203197_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1203252_1204278_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1204319_1204715_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1204726_1205080_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|1205091_1205670_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|1205666_1206062_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1206069_1206822_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479045.1|1206835_1207258_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533442.1|1207284_1207698_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081792.1|1207678_1210291_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|1210287_1210617_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001443841.1|1210616_1211315_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000194707.1|1211325_1212069_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_126347159.1|1212014_1212647_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	91.4	5.0e-96
WP_000514815.1|1212882_1216359_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.9	0.0e+00
WP_001216290.1|1216427_1217051_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000268933.1|1217115_1218429_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	4.8e-77
WP_001023445.1|1218430_1218700_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_012817749.1|1218824_1219577_-	type III effector	NA	NA	NA	NA	NA
WP_000273151.1|1221378_1221621_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048500.1|1221688_1224139_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|1224233_1224422_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1224418_1224607_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|1225007_1225172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|1225175_1225394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817750.1|1225465_1225765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|1226100_1226403_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|1226405_1226765_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|1226811_1227204_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|1227330_1227591_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|1227587_1228025_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|1228111_1229122_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|1229033_1229576_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|1229609_1230335_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|1230350_1230743_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|1230739_1231036_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|1231032_1231494_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|1231471_1231828_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|1231878_1232091_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|1232124_1232307_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753069.1|1232299_1232476_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	100.0	4.6e-28
WP_001289353.1|1232472_1233108_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|1233195_1233414_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|1233415_1233781_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000350274.1|1233888_1234122_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000220601.1|1234326_1234626_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|1234631_1234889_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|1235024_1235297_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|1235298_1236345_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|1236357_1236717_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|1236725_1237256_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|1237497_1237695_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|1237829_1238543_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1238992_1239424_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000023291.1|1239901_1241839_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.4	0.0e+00
WP_000143463.1|1241974_1242154_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|1242194_1242440_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1242517_1242733_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|1242737_1243271_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056882.1|1243545_1244115_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
WP_000455402.1|1244114_1244264_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|1244491_1244677_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1245202_1245517_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|1245598_1245823_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_000279807.1|1245864_1246230_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
WP_000958402.1|1246520_1247084_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|1247080_1248742_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173097.1|1248805_1250737_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.2	0.0e+00
WP_001063025.1|1250781_1251003_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1253529_1253856_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1253866_1254217_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1254213_1254660_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1254656_1255001_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|1255066_1255783_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030067.1|1255788_1256163_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1256258_1256468_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212962.1|1256515_1259758_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
WP_000807964.1|1259750_1260092_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001448747.1|1260091_1260790_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_001302649.1|1260806_1261127_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1261234_1261408_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001432327.1|1261478_1262402_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	6.6e-174
WP_001375566.1|1262456_1263194_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
WP_064721023.1|1263139_1263772_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.6e-105
WP_000514816.1|1264007_1267484_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.0	0.0e+00
WP_001230400.1|1267550_1268150_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
WP_000268971.1|1268214_1269528_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	4.8e-77
WP_001023986.1|1269529_1269799_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_122988840.1|1269909_1269987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273658.1|1271354_1271528_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|1271610_1272939_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|1272959_1273454_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001171.1|1273464_1274055_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001341462.1|1274064_1274865_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126777.1|1274872_1275259_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307708.1|1275270_1275963_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001297176.1|1275962_1277054_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191700.1|1277341_1277980_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001341463.1|1278019_1281982_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979516.1|1282036_1282246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018496.1|1282404_1283913_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497942.1|1284578_1285409_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154411.1|1285466_1286594_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199164.1|1286599_1287871_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000533522.1|1288489_1289278_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_000009226.1|1289858_1290545_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279869.1|1291170_1292373_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
1298727:1298742	attR	AAAGACGTGAATGAAC	NA	NA	NA	NA
>prophage 4
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	1473272	1528503	5697240	head,integrase,tail,terminase,holin,protease,transposase,capsid	Stx2-converting_phage(36.0%)	64	1468043:1468057	1475391:1475405
1468043:1468057	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_001113310.1|1473272_1473740_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000074974.1|1473816_1474935_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|1474903_1475173_-	excisionase	NA	NA	NA	NA	NA
WP_000048520.1|1475234_1477706_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
1475391:1475405	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1477798_1477990_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1477986_1478175_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000367376.1|1478664_1478817_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444615.1|1479092_1479737_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1479834_1480062_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1480058_1480484_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262408.1|1480552_1481590_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000373320.1|1481621_1482044_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450612.1|1482078_1482777_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000702797.1|1482798_1483023_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1483019_1483376_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001375713.1|1483408_1483561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273106.1|1483557_1483869_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137957.1|1483995_1484559_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
WP_001278460.1|1484668_1484773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1484959_1485172_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001341382.1|1485339_1485618_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265089.1|1485619_1486675_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.5e-89
WP_000140011.1|1486675_1487041_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_000640023.1|1487049_1487592_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_000917767.1|1487904_1488102_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611213.1|1488252_1489302_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
WP_000466957.1|1489773_1490205_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143048.1|1490775_1492626_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_053897820.1|1492907_1493123_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000138558.1|1493378_1493651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|1493810_1494344_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|1494990_1495197_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1495261_1495486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1495842_1495983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001341372.1|1496112_1496298_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000279807.1|1496339_1496705_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
WP_000958380.1|1496995_1497559_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|1497555_1499217_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000173071.1|1499280_1501218_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.7	0.0e+00
WP_001063025.1|1501262_1501484_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1504010_1504337_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1504347_1504698_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1504694_1505141_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1505137_1505482_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|1505547_1506264_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030067.1|1506269_1506644_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1506739_1506949_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212962.1|1506996_1510239_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
WP_000807964.1|1510231_1510573_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152214.1|1510572_1511271_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	99.1	1.2e-132
WP_012817760.1|1511281_1512025_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.2e-146
WP_096844540.1|1511970_1512603_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_000515075.1|1512848_1516322_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.8	0.0e+00
WP_001230532.1|1516388_1516988_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_000279108.1|1517052_1518366_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
WP_001339397.1|1518421_1519099_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1519098_1519446_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381371.1|1519465_1521037_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.4e-168
WP_001023483.1|1521074_1521344_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000938122.1|1521798_1523160_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
WP_001058323.1|1524284_1525403_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|1525399_1527193_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|1527211_1527919_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1527915_1528503_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	1558997	1636009	5697240	head,integrase,tRNA,tail,terminase,holin,protease,capsid	Escherichia_phage(30.23%)	106	1587532:1587548	1622741:1622757
WP_000013656.1|1558997_1560308_-	DUF3596 domain-containing protein	NA	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
WP_001208773.1|1560360_1560645_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497812.1|1560690_1560942_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1560929_1561163_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000994787.1|1561306_1561669_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	96.7	1.7e-56
WP_042357761.1|1561704_1561920_-	DUF1382 family protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
WP_000628762.1|1561852_1562764_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
WP_000224734.1|1563277_1563475_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000206782.1|1563480_1563939_-	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
WP_001014298.1|1563941_1564133_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|1564134_1564542_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000812200.1|1564538_1565168_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
WP_001214439.1|1565164_1565329_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_001111290.1|1565339_1565636_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	98.0	2.3e-48
WP_000073098.1|1565659_1566247_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
WP_000536228.1|1566243_1566924_-	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000613346.1|1566932_1567121_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|1567117_1567231_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_001198866.1|1567223_1567364_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000167595.1|1567557_1568028_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|1568086_1568470_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000687675.1|1568977_1569382_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|1569378_1570035_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|1570031_1570319_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|1570455_1571160_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1571273_1571507_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438542.1|1571645_1571942_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185454.1|1571974_1572913_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788927.1|1572909_1573611_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
WP_000145907.1|1573607_1573898_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|1573968_1574247_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1574379_1574595_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1574605_1574842_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1574798_1575245_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1575241_1575769_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1575765_1575948_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|1576222_1576957_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|1577031_1577754_+	phage antirepressor KilAC domain-containing protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|1577753_1578359_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|1578355_1578550_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1578542_1578977_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1579483_1580431_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1580440_1580710_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000142998.1|1581209_1583147_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000143462.1|1583282_1583462_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290217.1|1583502_1583775_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284518.1|1583851_1584067_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731236.1|1584071_1584416_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_001092890.1|1584466_1585000_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
WP_001056806.1|1585270_1585840_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1585839_1585986_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1586213_1586399_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|1586823_1587051_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1587092_1587458_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
1587532:1587548	attL	AAAATTCCTGTTTCAGG	NA	NA	NA	NA
WP_000958402.1|1587747_1588311_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|1588307_1589969_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173033.1|1590032_1591970_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|1592014_1592236_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1594762_1595089_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1595099_1595450_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1595446_1595893_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1595889_1596234_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275459.1|1596299_1597016_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030060.1|1597021_1597396_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1597491_1597701_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212983.1|1597748_1600991_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807940.1|1600983_1601325_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|1601324_1602023_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001429308.1|1602033_1602777_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122993493.1|1602722_1603355_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_000515141.1|1603600_1607077_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.7	0.0e+00
WP_001216290.1|1607145_1607769_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279008.1|1607834_1609157_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.5	1.2e-75
WP_001023435.1|1609158_1609428_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_001131642.1|1609541_1610117_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|1610407_1610989_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|1611056_1611692_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|1611819_1612878_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|1612952_1613603_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|1613785_1614376_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|1614649_1615513_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1615496_1616633_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|1616882_1618112_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1618257_1619379_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085258.1|1619627_1620857_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000953272.1|1621222_1621411_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_012816761.1|1621468_1622497_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336167.1|1622486_1622951_+	hypothetical protein	NA	NA	NA	NA	NA
1622741:1622757	attR	CCTGAAACAGGAATTTT	NA	NA	NA	NA
WP_001204981.1|1622943_1623177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|1623182_1623482_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833619.1|1623478_1624879_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
WP_000192401.1|1625079_1625331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1625327_1625738_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1625748_1626021_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1626147_1626372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|1626630_1626837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|1626836_1627892_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|1627904_1628240_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|1628252_1628666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001432354.1|1628871_1629414_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000133424.1|1629669_1629951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1630552_1632013_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1632012_1632684_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1632851_1634222_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1634225_1634867_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1634902_1636009_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	1740093	1788494	5697240	integrase,tail,holin,protease,transposase	Escherichia_phage(26.92%)	53	1739930:1739957	1774689:1774716
1739930:1739957	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1740093_1741224_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1741201_1741450_-	excisionase	NA	NA	NA	NA	NA
WP_000048478.1|1741514_1743986_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|1744081_1744270_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1744266_1744455_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1744854_1745022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1745015_1745249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1745226_1745634_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1745656_1745875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1745947_1746247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1746511_1746919_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1746995_1747223_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|1747206_1747758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1747729_1748770_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1748681_1749224_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|1749987_1750152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1750850_1751609_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1751887_1752100_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1752320_1752578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1752647_1752926_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265290.1|1752927_1753983_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|1753983_1754349_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1754345_1755035_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023141.1|1756559_1758413_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|1758562_1758778_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1758782_1759127_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|1759177_1759711_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056807.1|1759981_1760500_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.0e-94
WP_085948186.1|1760556_1761712_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001023357.1|1761815_1762085_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_106409364.1|1766030_1766153_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1766259_1767171_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1767236_1767806_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|1768973_1769252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1769679_1769826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1769962_1770610_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1770793_1771384_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|1772890_1773541_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079509.1|1774866_1775373_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1774689:1774716	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1775418_1775919_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1776004_1776184_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1776564_1777371_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1777370_1778564_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983926.1|1778575_1779937_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	1.9e-36
WP_000763511.1|1779937_1781533_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|1781532_1783095_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1783186_1783231_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1783368_1784250_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001342101.1|1784246_1784867_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1784967_1785840_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1785879_1786470_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559253.1|1786466_1787225_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.2e-05
WP_000422045.1|1787444_1788494_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	1865035	1919910	5697240	head,portal,tRNA,tail,terminase,holin,lysis,capsid	Escherichia_phage(44.62%)	67	NA	NA
WP_000628065.1|1865035_1866268_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1866522_1867506_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1867983_1869357_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1869485_1870421_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040851.1|1870472_1871708_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_000079604.1|1871709_1871925_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1872024_1872213_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1872250_1872400_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1872455_1873265_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105151.1|1873257_1875858_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	2.6e-247
WP_000632297.1|1875959_1876235_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1876309_1876480_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1876479_1876701_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001427316.1|1877121_1877274_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000233320.1|1877572_1877992_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072343.1|1878071_1878326_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1878322_1878745_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000899746.1|1878757_1879615_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788968.1|1879621_1880368_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450672.1|1880390_1881152_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.8e-119
WP_001151124.1|1881167_1881590_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_001266134.1|1881586_1881883_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1881879_1882341_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1882318_1882675_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1882725_1882938_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1883189_1883453_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1883463_1884333_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1884448_1884553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1884742_1884955_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341382.1|1885122_1885401_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265080.1|1885402_1886452_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001217413.1|1886464_1886839_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|1886835_1887657_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143049.1|1888827_1890678_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_024164617.1|1891116_1891332_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|1891331_1891829_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|1891825_1892263_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|1892412_1893030_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|1893217_1893412_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1893800_1894346_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1894320_1896246_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1896242_1896449_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|1896445_1898047_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000123251.1|1898027_1899347_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1899356_1899689_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1899744_1900770_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1900811_1901207_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1901218_1901572_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|1901583_1902162_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|1902158_1902554_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1902561_1903314_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479086.1|1903327_1903759_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|1903785_1904199_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082321.1|1904179_1906759_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
WP_000847304.1|1906755_1907085_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|1907084_1907783_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_001375575.1|1907788_1908532_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_122993493.1|1908477_1909110_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_000515144.1|1909355_1912832_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001233130.1|1912899_1913499_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_000268927.1|1913563_1914877_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001023379.1|1914878_1915148_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_001131657.1|1915260_1915836_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001443810.1|1915908_1916538_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1916619_1917261_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1918201_1918636_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837943.1|1918776_1919910_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
>prophage 8
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	2120979	2220759	5697240	head,portal,tail,terminase,holin,protease,transposase,lysis,capsid	Enterobacteria_phage(46.32%)	125	NA	NA
WP_120795384.1|2120979_2121093_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2121161_2121395_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|2121711_2122302_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|2122399_2122975_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001448491.1|2122974_2125935_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.1	4.0e-55
WP_001233114.1|2125999_2126599_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_000515505.1|2126669_2130083_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000741589.1|2130143_2130791_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140707.1|2130688_2131432_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_001152371.1|2131436_2132135_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000447251.1|2132144_2132474_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_000372024.1|2132473_2135539_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|2135510_2135840_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|2135848_2136235_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|2136295_2137039_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|2137049_2137451_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677128.1|2137447_2138026_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
WP_001283148.1|2138037_2138313_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097041.1|2138305_2138629_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001136588.1|2138715_2140743_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985929.1|2140687_2142196_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|2142195_2142408_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507036.1|2142404_2144504_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_000421825.1|2144512_2145052_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031435.1|2145612_2145819_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000035577.1|2146119_2146530_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|2146681_2146855_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2147026_2147182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|2147261_2147327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2147329_2147518_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2147528_2147741_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2148103_2148601_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2148597_2149131_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|2149127_2149439_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2149443_2149659_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066483.1|2150412_2150628_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_000087756.1|2150928_2151141_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2151195_2151285_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047133.1|2151562_2152315_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_001265198.1|2152328_2153378_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2153379_2153658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2153724_2153976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2154192_2154348_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2154419_2154707_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2154706_2154946_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2154970_2155276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|2155478_2155811_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589012.1|2156247_2157588_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|2157621_2158041_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000054507.1|2158081_2159047_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_000705349.1|2159027_2159549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2159532_2159760_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2159837_2160245_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|2160437_2160593_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000347171.1|2160594_2161170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2161656_2161845_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|2161841_2162033_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048369.1|2162126_2164598_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000381395.1|2164793_2166365_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2166384_2166732_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2166731_2167409_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000877010.1|2167663_2168728_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	60.1	8.6e-117
WP_085948186.1|2168724_2169881_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001120551.1|2170388_2170631_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_136719992.1|2171001_2172015_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2172229_2172307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023433.1|2172417_2172687_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_000279009.1|2172688_2174002_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001456919.1|2174066_2174690_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	5.1e-69
WP_000515131.1|2174758_2178235_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_133253573.1|2178480_2179113_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	3.1e-106
WP_000194802.1|2179058_2179802_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_001357740.1|2179812_2180511_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2180510_2180840_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081787.1|2180836_2183449_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.4	0.0e+00
WP_000533440.1|2183429_2183843_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2183869_2184292_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2184305_2185058_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000975020.1|2185456_2185990_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000752969.1|2186004_2186358_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
WP_000158901.1|2186369_2186765_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
WP_000063258.1|2186806_2187832_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001295978.1|2187887_2188220_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2188229_2189549_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2189529_2191131_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2191127_2191334_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2191330_2193256_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2193230_2193776_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001431375.1|2194162_2194387_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
WP_001303878.1|2194468_2194783_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2195310_2195496_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000992045.1|2196047_2196581_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_001041949.1|2197092_2197884_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_024165672.1|2197887_2198103_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000023191.1|2198541_2200392_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001299632.1|2200870_2201302_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000498121.1|2201491_2201701_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_000735807.1|2201753_2201978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047111.1|2202822_2203575_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_001375683.1|2203588_2204638_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_012817785.1|2204639_2204909_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|2204962_2205190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|2205413_2205785_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|2205777_2206095_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|2206197_2206410_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|2206624_2207176_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|2207527_2207713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|2207772_2208534_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|2208563_2209304_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000054520.1|2209310_2210276_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000705368.1|2210256_2210778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|2210761_2210992_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379972.1|2211075_2211483_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000380321.1|2211649_2211802_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000394548.1|2211813_2212452_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2212452_2212662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2213226_2213415_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2213411_2213600_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102117.1|2213692_2216155_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	4.0e-125
WP_000005551.1|2216227_2216479_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_001206147.1|2216498_2217794_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
WP_072095801.1|2217813_2217924_-	transporter	NA	NA	NA	NA	NA
WP_000836079.1|2217981_2219001_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|2219012_2220227_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2220432_2220759_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 9
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	2237044	2253827	5697240	head,integrase,portal,tail,terminase,protease,capsid	uncultured_Caudovirales_phage(90.91%)	21	2242668:2242683	2265007:2265022
WP_001260840.1|2237044_2237866_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|2237904_2238234_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|2238220_2238586_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000133422.1|2239899_2240181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127891.1|2240194_2241856_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000113645.1|2241839_2242196_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|2242484_2242925_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
2242668:2242683	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|2242924_2243221_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|2243217_2243556_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000267608.1|2243552_2244764_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504055.1|2244765_2245338_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|2245377_2246535_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|2246826_2247051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|2247176_2247449_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126691.1|2247459_2247870_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|2247866_2248112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710169.1|2248399_2250217_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
WP_001261490.1|2250213_2250513_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113154.1|2250519_2250840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817788.1|2252034_2252223_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	62.3	3.8e-12
WP_000085277.1|2252597_2253827_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
2265007:2265022	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 10
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	2372586	2432762	5697240	head,integrase,portal,tRNA,tail,terminase,holin,transposase,plate,capsid	Enterobacteria_phage(80.0%)	72	2374989:2375013	2410629:2410653
WP_000029479.1|2372586_2373336_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|2373335_2373887_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|2373949_2374930_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2374989:2375013	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000416304.1|2375119_2375515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247208.1|2375525_2376461_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000094527.1|2376549_2376861_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_000163908.1|2376952_2377231_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917799.1|2377245_2377584_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	2.5e-46
WP_000159459.1|2377594_2377873_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|2377884_2378127_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021664.1|2378123_2378237_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	3.1e-09
WP_000985152.1|2378324_2378528_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000091213.1|2378524_2378743_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	50.8	8.6e-08
WP_000564221.1|2378851_2379241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288341.1|2379237_2382078_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.8	0.0e+00
WP_000686516.1|2382154_2383114_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	6.4e-180
WP_000211275.1|2383118_2383430_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	2.7e-47
WP_001080495.1|2383528_2383936_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	91.7	5.2e-22
WP_000087812.1|2384420_2385467_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613782.1|2385466_2387218_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262657.1|2387372_2388209_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
WP_001055104.1|2388232_2389285_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632332.1|2389330_2390131_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
WP_000063101.1|2390232_2390727_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	2.7e-89
WP_000864901.1|2390726_2390927_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2390929_2391253_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2391249_2391642_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780553.1|2391638_2392046_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	5.9e-66
WP_000920580.1|2392183_2392651_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000361966.1|2392643_2393279_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_012817790.1|2393290_2393857_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.3	4.7e-98
WP_001067552.1|2393874_2394204_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	1.1e-54
WP_001111960.1|2394207_2395104_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	6.0e-156
WP_000071720.1|2395096_2395627_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108500.1|2395629_2397762_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	57.7	2.1e-130
WP_000144019.1|2397761_2398340_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	8.5e-95
WP_000954206.1|2398383_2398956_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2399112_2399601_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000853428.1|2399613_2402421_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.6	0.0e+00
WP_000333503.1|2402407_2402563_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2402571_2402946_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290450.1|2403001_2403514_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005408.1|2403513_2404698_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	1.5e-223
WP_000132781.1|2404855_2405959_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.5	2.9e-192
WP_012817792.1|2406123_2406759_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005564.1|2406755_2407868_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_000422317.1|2407860_2409249_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
WP_000004182.1|2409248_2409521_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_001781539.1|2409773_2410034_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2410224_2410365_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2410670_2410970_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2410629:2410653	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672359.1|2410974_2413362_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2413376_2414360_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2414643_2414688_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2414810_2415167_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2415219_2415417_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2415513_2416056_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2416059_2417988_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001142445.1|2420582_2420690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771393.1|2420742_2421501_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251735.1|2421787_2422717_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|2422817_2423108_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267654.1|2423213_2424074_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222172.1|2424114_2424651_-	YniB family protein	NA	NA	NA	NA	NA
WP_000106834.1|2424797_2425466_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001295408.1|2425628_2426219_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010707.1|2426351_2427743_+	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_001326039.1|2427746_2428124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001443869.1|2428194_2428563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001241561.1|2428839_2429103_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_000077839.1|2429285_2431547_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	2.5e-142
WP_000399648.1|2431781_2432762_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	2487179	2584374	5697240	head,integrase,portal,tRNA,tail,terminase,holin,protease,transposase,lysis,capsid	Escherichia_phage(30.88%)	112	2526686:2526700	2585821:2585835
WP_000826412.1|2487179_2488388_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_000604932.1|2488395_2488827_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|2488842_2489031_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|2489034_2489394_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|2489566_2490205_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|2490331_2491255_-	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000978494.1|2491357_2492443_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|2492693_2494304_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067805.1|2494335_2495460_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|2495515_2496481_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|2496534_2497650_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|2497731_2499417_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2499621_2500203_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|2500242_2500938_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2500995_2502906_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2503037_2503382_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2503744_2504104_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2504223_2504403_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|2504476_2505838_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|2505841_2506420_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|2506603_2507968_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|2508098_2509697_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|2509700_2511257_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|2511719_2512691_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|2512753_2513554_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|2513566_2514418_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|2514472_2514931_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|2515359_2515926_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|2515922_2516732_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|2516897_2517107_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|2517119_2517263_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|2517931_2518219_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|2518293_2518437_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|2518595_2518835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|2518977_2519769_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|2519945_2521319_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|2521364_2522246_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001431407.1|2522437_2524486_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
WP_000431370.1|2524505_2525204_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2525300_2525798_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|2525927_2527211_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
2526686:2526700	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
WP_001299674.1|2527179_2529813_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|2529892_2531332_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2531449_2531686_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2531790_2531982_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2531982_2532639_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|2533593_2534244_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|2534468_2535344_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|2535484_2535754_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000268926.1|2535755_2537069_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001230428.1|2537133_2537733_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000099160.1|2537788_2539327_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2539375_2539723_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839165.1|2539719_2540124_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000514713.1|2540262_2543658_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.6	0.0e+00
WP_050439450.1|2544000_2544633_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194723.1|2544578_2545322_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001357740.1|2545332_2546031_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2546030_2546360_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081762.1|2546356_2548969_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
WP_000533442.1|2548949_2549363_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2549389_2549812_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235099.1|2549825_2550578_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
WP_000683137.1|2550585_2550981_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|2550977_2551556_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|2551567_2551921_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|2551932_2552328_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|2552369_2553395_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|2553450_2553783_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|2553792_2555112_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|2555092_2556694_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|2556690_2556897_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|2556893_2558819_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|2558793_2559339_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|2559727_2559922_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|2560109_2560727_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|2560876_2561314_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|2561310_2561808_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|2561807_2562023_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000143049.1|2562461_2564312_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|2565482_2566304_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|2566300_2566675_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|2566687_2567737_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2567738_2568011_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2568132_2568477_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2568596_2568809_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2569042_2569600_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2569601_2569820_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2569947_2570259_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2570251_2570479_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2570475_2570757_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|2570789_2571551_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|2572324_2573287_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|2573309_2573735_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2573731_2574034_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|2574131_2574503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|2574523_2574715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001448501.1|2574716_2574995_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|2575281_2575434_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|2575854_2576076_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_000245534.1|2576069_2576246_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_001307773.1|2576319_2576595_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000105101.1|2576693_2579345_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_000166317.1|2579337_2580147_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|2580203_2580398_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2580390_2580579_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|2580685_2580967_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189089.1|2580932_2582048_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.8	4.6e-97
WP_000976492.1|2582400_2582742_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2582754_2583627_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2583630_2584005_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2584143_2584374_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
2585821:2585835	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 12
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	2630647	2704570	5697240	head,integrase,portal,tRNA,tail,terminase,holin,plate,capsid	Enterobacteria_phage(75.56%)	82	2668182:2668241	2705513:2705633
WP_000564746.1|2630647_2631619_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176770.1|2631783_2634213_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2634237_2635338_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|2635725_2636472_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|2636485_2637052_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|2637267_2639001_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|2639177_2639666_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|2639785_2640178_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067000.1|2640177_2642256_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|2642248_2643397_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|2643598_2644243_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2644253_2644643_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|2644657_2645707_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|2645709_2646570_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|2646588_2648193_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|2648238_2649900_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2650044_2650548_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|2650568_2652533_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2652537_2653464_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906335.1|2653460_2654348_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2654474_2655053_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2655055_2655406_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|2656185_2656614_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_012817797.1|2656620_2658045_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|2658019_2658820_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2658986_2659973_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|2659987_2661502_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|2661571_2662561_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2663357_2663861_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082123.1|2663939_2664191_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2664305_2664392_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|2664654_2664978_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|2665148_2665646_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2665683_2665923_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|2666113_2667325_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|2667386_2668052_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2668182:2668241	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|2668408_2669410_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_000865208.1|2669415_2669763_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|2669792_2670443_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|2670458_2670863_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2670952_2671090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2671161_2671365_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|2671386_2671737_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|2671747_2672026_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|2672037_2672280_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021647.1|2672276_2672390_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000985152.1|2672476_2672680_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000564224.1|2673003_2673393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272083.1|2673389_2676230_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|2676306_2677266_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|2677270_2677582_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289969.1|2677645_2678236_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000087812.1|2678725_2679772_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613774.1|2679771_2681523_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262641.1|2681677_2682514_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_001055094.1|2682537_2683590_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632311.1|2683635_2684436_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|2684537_2685032_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|2685031_2685232_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_001342221.1|2685234_2685558_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|2685554_2685947_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|2685943_2686351_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202151.1|2686489_2688367_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_001342220.1|2688390_2688858_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000356339.1|2688850_2689486_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001342219.1|2689497_2690064_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_001067548.1|2690081_2690411_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111967.1|2690414_2691311_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|2691303_2691834_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_000108514.1|2691836_2693969_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000144010.1|2693968_2694547_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000954196.1|2694590_2695163_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979950.1|2695319_2695808_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000853455.1|2695820_2698628_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000333495.1|2698614_2698770_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|2698778_2699144_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2699198_2699711_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005439.1|2699710_2700895_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000132847.1|2701052_2702153_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_001317900.1|2702552_2703692_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|2703978_2704239_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078921.1|2704429_2704570_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
2705513:2705633	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 13
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	2824294	2829612	5697240	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_000099148.1|2824294_2825833_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_000612626.1|2825881_2826229_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2826225_2826630_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_072097794.1|2826718_2827060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|2827138_2827372_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|2827471_2828290_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849582.1|2828344_2828830_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001186725.1|2828845_2829322_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2829390_2829612_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 14
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	2863248	2869550	5697240		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100797.1|2863248_2863791_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
WP_000857547.1|2863795_2864674_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001023633.1|2864731_2865631_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000699427.1|2865630_2866716_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_000183038.1|2867087_2867981_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001116073.1|2868155_2869550_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 15
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	2960992	2970920	5697240	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001292774.1|2960992_2962129_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001342301.1|2962125_2964126_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|2964457_2964838_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2964834_2965182_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|2965231_2966617_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|2967048_2967519_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|2967565_2968285_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2968281_2969967_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2970188_2970920_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 16
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	3041747	3143904	5697240	head,integrase,portal,tail,terminase,holin,protease,transposase,lysis,capsid	Enterobacteria_phage(37.04%)	119	3078897:3078915	3153120:3153138
WP_000101718.1|3041747_3042989_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|3043485_3043692_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|3044375_3044936_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_001342316.1|3044925_3045168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|3045140_3045362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204970.1|3045363_3045597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|3045602_3045902_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|3045898_3047299_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|3047500_3047746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|3047876_3048071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|3048074_3048236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|3048363_3048852_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000006074.1|3048863_3049025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624042.1|3049014_3049938_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|3053316_3053964_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|3053998_3055051_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|3055047_3055605_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|3055601_3057545_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|3057541_3058021_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|3058017_3058227_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|3058223_3058961_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|3059002_3059665_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|3059661_3060279_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|3060297_3060900_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|3060909_3061359_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|3061355_3062219_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|3062205_3062901_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|3062907_3065394_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|3065390_3065654_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|3065643_3066138_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001296837.1|3066246_3066411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849214.1|3066546_3067035_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|3067183_3068830_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|3069047_3070691_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|3070766_3071417_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|3071416_3072481_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|3072554_3073610_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|3073721_3074813_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|3075551_3078224_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|3078240_3078891_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
3078897:3078915	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876007.1|3078976_3081826_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
WP_001225855.1|3082100_3082877_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|3082881_3084531_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|3084531_3088926_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|3089727_3091050_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001448330.1|3091743_3092391_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001023380.1|3092600_3092870_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_000279018.1|3092871_3094185_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001228241.1|3094249_3094849_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001230644.1|3094916_3095132_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_000099190.1|3095194_3096733_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_000612626.1|3096781_3097129_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839165.1|3097125_3097530_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_001375477.1|3097558_3100858_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000090884.1|3100918_3101551_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_012817801.1|3101487_3102231_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
WP_001152619.1|3102236_3102935_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|3102934_3103264_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_000082375.1|3103260_3105822_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|3105802_3106216_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|3106242_3106674_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|3106687_3107440_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|3107447_3107843_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|3107839_3108415_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|3108429_3108783_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|3108775_3109150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|3109201_3110086_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|3110143_3110491_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|3110527_3112033_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000827572.1|3112022_3113615_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_000258991.1|3113611_3113818_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001238637.1|3113801_3114008_-|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_024262528.1|3114020_3115730_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	4.9e-239
WP_000235436.1|3115701_3116211_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|3116605_3116800_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|3117159_3117453_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3117543_3117726_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|3117942_3118440_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|3118439_3118655_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3118797_3119196_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3119276_3119435_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3119520_3120264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|3120516_3121140_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|3121136_3121802_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|3121798_3122401_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|3122375_3122942_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_000612805.1|3123504_3125277_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.8	0.0e+00
WP_001254228.1|3125780_3125963_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|3125959_3126487_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|3126483_3126930_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|3126937_3127144_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|3127216_3127507_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|3127503_3128205_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185462.1|3128201_3129140_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000035947.1|3129172_3129469_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|3129578_3129764_-	Cro/Cl family transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|3129844_3130495_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|3130809_3131115_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|3131117_3131456_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|3131589_3132060_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|3132209_3132578_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|3132650_3132815_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|3132783_3132948_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|3133002_3133299_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3133304_3134090_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3134086_3134764_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3134763_3134946_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3134918_3135110_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3135120_3135402_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|3135500_3135722_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|3135718_3136324_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|3136320_3136671_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|3136745_3136988_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|3137106_3137451_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|3137556_3137775_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|3137752_3138823_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|3138837_3139443_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|3139439_3141128_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|3141276_3143904_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
3153120:3153138	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 17
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	3232578	3306233	5697240	head,integrase,portal,tRNA,terminase,holin,lysis	Enterobacteria_phage(51.56%)	92	3289595:3289610	3310624:3310639
WP_001283577.1|3232578_3233391_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3233390_3234404_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|3234469_3235606_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|3235704_3236700_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127748.1|3236696_3237875_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3238158_3239379_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683823.1|3239537_3241544_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3241664_3241943_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|3241976_3242525_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|3242524_3243334_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|3243333_3244158_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|3244161_3245247_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|3245281_3246214_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3246379_3246931_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|3247003_3247855_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|3247856_3248396_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|3248392_3248881_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|3248877_3249387_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482751.1|3249402_3250155_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001375769.1|3250174_3252820_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|3252901_3253465_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3254148_3254634_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|3254836_3256981_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|3256980_3258291_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|3258470_3258755_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|3259126_3260467_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|3260831_3261890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3262071_3262827_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3263120_3264053_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958687.1|3264364_3265522_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
WP_000440209.1|3265766_3266909_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_001280420.1|3266979_3269103_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
WP_000287055.1|3269224_3269491_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_000749290.1|3269561_3270047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868968.1|3270061_3271906_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
WP_000246938.1|3271905_3273312_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_000964882.1|3273321_3274014_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614047.1|3274016_3274472_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000785546.1|3274471_3275320_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_001122374.1|3275319_3276738_-	packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000246750.1|3276746_3277229_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375639.1|3277203_3277389_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_001133481.1|3277431_3278703_-|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
WP_000426731.1|3278714_3279599_-	hypothetical protein	NA	Q716H1	Shigella_phage	98.6	3.4e-143
WP_000852339.1|3279612_3281739_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
WP_000200776.1|3281741_3283154_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000179910.1|3283150_3283576_-	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000807788.1|3283655_3283898_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999682.1|3284001_3284373_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_001016387.1|3284656_3285175_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
WP_000092296.1|3285380_3285818_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_000229392.1|3285814_3286291_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|3286274_3286598_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|3287670_3288294_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_001271146.1|3288290_3288956_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
WP_000144614.1|3288933_3289140_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001107956.1|3289136_3289742_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
3289595:3289610	attL	CTGCTTTTTCCGCTTT	NA	NA	NA	NA
WP_072189684.1|3289734_3289944_-	protein ninF	NA	G9L691	Escherichia_phage	95.6	2.2e-29
WP_000924601.1|3289903_3290305_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|3290307_3290484_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|3290480_3290891_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|3290862_3291219_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000103674.1|3291684_3291900_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
WP_001248395.1|3291986_3293363_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
WP_000539347.1|3293359_3294181_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
WP_000166961.1|3294167_3294329_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001375758.1|3294364_3294643_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
WP_001054987.1|3294752_3294977_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_001375774.1|3295088_3295796_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	84.7	8.8e-110
WP_000394868.1|3295836_3296133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817806.1|3296566_3296839_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_001198630.1|3296757_3297204_+	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	7.6e-59
WP_000382838.1|3297234_3297729_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_000167585.1|3297929_3298400_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000776959.1|3298543_3298855_+	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
WP_000972063.1|3298930_3299065_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|3299049_3299202_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|3299277_3299448_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031004.1|3299458_3300064_+	ERF family protein	NA	O48415	Enterobacteria_phage	100.0	2.4e-108
WP_000951323.1|3300063_3300447_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_001111303.1|3300470_3300764_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000812180.1|3300935_3301523_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
WP_000052365.1|3301519_3302188_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
WP_000060377.1|3302189_3302378_+	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
WP_001375782.1|3302381_3302999_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
WP_000156090.1|3302995_3303583_+	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
WP_000376716.1|3303582_3303861_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|3304018_3304318_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|3304353_3304521_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001163428.1|3304578_3304779_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001131471.1|3305042_3305708_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	53.2	3.2e-61
WP_165957972.1|3305741_3306233_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.1	8.1e-54
3310624:3310639	attR	CTGCTTTTTCCGCTTT	NA	NA	NA	NA
>prophage 18
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	3560964	3664529	5697240	head,integrase,tRNA,tail,terminase,holin,capsid	Stx2-converting_phage(27.27%)	101	3642327:3642342	3672595:3672610
WP_001298974.1|3560964_3561702_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3561833_3563168_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|3563376_3564258_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3564360_3564948_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3565003_3565387_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3565691_3566381_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3566428_3567466_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3567672_3568092_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3568160_3568859_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3568890_3571551_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3571664_3573020_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3573065_3573389_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3573385_3574684_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3580537_3583111_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3583240_3583972_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|3583968_3584949_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3585083_3585821_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178457.1|3586091_3586442_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3586545_3586593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3586691_3587852_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3587894_3589016_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3589026_3590097_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3590306_3590672_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3590821_3591340_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|3591329_3592556_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3592571_3593054_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3593130_3593478_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3593519_3594287_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3594317_3594866_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3594884_3595133_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3595381_3596743_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3596909_3597701_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3597721_3599008_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3599062_3599656_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3599778_3600657_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3600742_3602404_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3602552_3602894_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3602955_3603246_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3603235_3603712_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3603843_3604326_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938109.1|3606080_3607442_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	1.2e-51
WP_001370486.1|3607818_3611220_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001301673.1|3611812_3614161_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3614180_3614270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|3614376_3614646_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|3614647_3615961_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001427270.1|3616025_3616625_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000514836.1|3616692_3620166_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
WP_122996338.1|3620404_3621037_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_000194787.1|3620982_3621726_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001341641.1|3621736_3622435_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|3622434_3622776_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_000212961.1|3622768_3626011_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.9	0.0e+00
WP_001513217.1|3626058_3626268_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030067.1|3626363_3626738_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001275471.1|3626743_3627460_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|3627525_3627870_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3627866_3628313_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3628309_3628660_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3628670_3628997_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|3631523_3631745_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173097.1|3631789_3633721_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.2	0.0e+00
WP_001341975.1|3633784_3635446_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|3635442_3636006_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001375434.1|3636298_3636664_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
WP_032321890.1|3636705_3636930_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
WP_001303878.1|3637011_3637326_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|3637853_3638039_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|3638255_3638753_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|3638752_3638968_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000874360.1|3639406_3641257_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_001339373.1|3642074_3642227_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
3642327:3642342	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
WP_001047129.1|3642536_3643289_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
WP_001428967.1|3643302_3644292_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
WP_001061413.1|3644299_3645097_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767136.1|3645116_3645506_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_000210170.1|3645502_3645829_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001341555.1|3645825_3646479_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001447903.1|3646478_3646973_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
WP_000061518.1|3646969_3647788_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
WP_000620696.1|3647784_3648009_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087342.1|3648005_3649157_-	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
WP_000521508.1|3649153_3649705_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|3649748_3649949_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|3650039_3650714_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135680.1|3651380_3651743_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|3651808_3652633_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000008174.1|3652761_3653298_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000335005.1|3653288_3654167_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000158004.1|3654163_3654367_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000476199.1|3654359_3654599_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000034210.1|3654595_3654925_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000206753.1|3654926_3655790_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000457722.1|3655874_3656117_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|3656120_3656267_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|3656439_3657615_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_001431537.1|3658097_3659006_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_001341819.1|3659304_3660534_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|3660572_3660989_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214985.1|3661060_3662809_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000577251.1|3662810_3664529_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
3672595:3672610	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 19
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	3737320	3744460	5697240		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3737320_3739882_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3739987_3740644_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3740694_3741462_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3741657_3742566_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3742562_3743825_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3743821_3744460_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 20
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	3896515	3904464	5697240	transposase,integrase	Stx2-converting_phage(42.86%)	7	3894472:3894488	3903557:3903573
3894472:3894488	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000381395.1|3896515_3898087_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3898106_3898454_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3898453_3899131_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000082600.1|3899525_3900254_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000852869.1|3901162_3901822_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000935135.1|3901814_3903422_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_001272558.1|3903708_3904464_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3903557:3903573	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 21
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	4953079	4966412	5697240	transposase,integrase	Enterobacteria_phage(66.67%)	15	4952573:4952595	4966573:4966595
4952573:4952595	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_000783645.1|4953079_4955413_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|4955427_4955748_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001339397.1|4955903_4956581_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4956580_4956928_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4956947_4958519_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000459320.1|4958594_4959050_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_001244665.1|4959042_4959330_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980227.1|4959322_4959922_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001149160.1|4959918_4960185_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283024.1|4960736_4961471_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_000638629.1|4961467_4961968_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4962041_4962614_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000186475.1|4962941_4963367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119815.1|4963363_4965223_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_001218979.1|4965242_4966412_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
4966573:4966595	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 22
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	5382783	5430706	5697240	transposase,tRNA,protease,integrase	Vibrio_phage(20.0%)	45	5363754:5363768	5390100:5390114
5363754:5363768	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_001375513.1|5382783_5384403_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|5384399_5385971_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|5386087_5387353_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|5387732_5388308_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|5388344_5390042_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|5390017_5390356_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
5390100:5390114	attR	TATGGATGATGAGAC	NA	NA	NA	NA
WP_000961959.1|5390471_5391773_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|5391890_5393327_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|5393663_5394140_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|5394155_5395412_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|5395687_5395981_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|5396024_5397671_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|5397808_5398162_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399685.1|5398414_5399395_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008073.1|5399643_5400513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|5400902_5401931_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|5401972_5402539_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|5402590_5402716_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|5402826_5402973_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|5403154_5403472_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|5403468_5404002_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|5404090_5405224_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|5405286_5405646_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|5405656_5406052_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|5406062_5406797_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192991.1|5406789_5408598_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|5408922_5409900_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|5410118_5411621_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|5411672_5411987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|5411983_5412298_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|5412326_5415650_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|5415671_5416640_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|5416736_5417789_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|5417883_5418429_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_100699686.1|5419292_5419346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294203.1|5419328_5420468_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|5420466_5422014_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|5421985_5422447_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|5422465_5423803_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122519.1|5423812_5425660_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|5425652_5426603_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|5426688_5426997_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460361.1|5427073_5428354_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|5428439_5429699_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5429701_5430706_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 23
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	5442418	5502925	5697240	transposase,protease	Stx2-converting_phage(25.0%)	57	NA	NA
WP_000811566.1|5442418_5442694_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|5442842_5443172_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569731.1|5443353_5444103_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5444099_5444855_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5444962_5446027_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001341647.1|5446381_5447779_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|5447794_5448100_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000056760.1|5448587_5449238_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5449247_5450102_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5450101_5450788_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5450916_5451192_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5451518_5451914_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5451920_5452235_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5452239_5452467_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5452508_5452958_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001341645.1|5453028_5453823_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072097616.1|5454262_5454877_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_000440544.1|5454884_5456093_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_001119478.1|5456227_5456866_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5457084_5457705_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228344.1|5458013_5459417_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001062220.1|5459683_5460118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345317.1|5460216_5461284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331456.1|5461530_5462193_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|5462300_5463266_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560553.1|5463373_5464234_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5464322_5464703_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|5464831_5466775_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|5466964_5467705_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|5467694_5468252_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5468576_5468783_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|5468844_5470188_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|5470510_5471149_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5471354_5473088_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060926.1|5473084_5476864_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5476866_5477208_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|5477419_5477671_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5477664_5478015_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5478094_5478625_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|5478934_5479891_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|5480030_5481533_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|5481546_5482569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|5482555_5483551_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|5483583_5484582_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|5484757_5486131_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166267.1|5486286_5486838_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5486931_5488284_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000099148.1|5488588_5490127_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_000612626.1|5490175_5490523_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|5490519_5490924_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001106238.1|5491359_5491824_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|5491982_5494121_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001341327.1|5494514_5496170_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001181312.1|5497694_5498642_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|5498826_5498880_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|5499020_5501717_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000399685.1|5501944_5502925_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NC_013361	Escherichia coli O26:H11 str. 11368, complete genome	5697240	5513382	5566722	5697240	transposase,tRNA,integrase	Stx2-converting_phage(46.15%)	48	5510740:5510755	5548455:5548470
5510740:5510755	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000416407.1|5513382_5516238_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|5516237_5516681_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|5517035_5518547_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|5518813_5519914_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|5519913_5520996_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|5521114_5522617_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|5522746_5523766_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000772685.1|5524209_5525472_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000356577.1|5525715_5526555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091133.1|5526693_5528280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|5528569_5529247_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5529246_5529594_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5529613_5531185_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|5531494_5531767_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|5531768_5532323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|5532319_5533072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|5533986_5534247_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|5534243_5534792_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|5534791_5535016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|5535012_5535336_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|5535350_5537684_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|5538589_5539414_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000916596.1|5539462_5539843_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	60.8	1.1e-37
WP_085948186.1|5539976_5541133_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177060.1|5542655_5542913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|5543470_5544238_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|5544238_5545195_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125190.1|5545191_5546190_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|5546186_5547089_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|5547133_5549458_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
5548455:5548470	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|5549544_5550498_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|5550494_5551016_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|5552766_5553024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|5553756_5555115_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|5555353_5556739_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|5556788_5557136_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|5557132_5557513_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|5557867_5558302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|5558289_5558691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|5558856_5559426_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|5560165_5561737_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5561756_5562104_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5562103_5562781_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001344112.1|5562848_5563025_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_077221339.1|5563658_5563937_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000839179.1|5564386_5564791_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|5564787_5565135_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|5565183_5566722_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
>prophage 1
NC_013369	Escherichia coli O26:H11 str. 11368 plasmid pO26_1, complete sequence	85167	8065	74869	85167	transposase,integrase	Stx2-converting_phage(38.89%)	53	NA	NA
WP_001164205.1|8065_8848_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465041.1|8849_9263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|9822_10053_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|10049_10466_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001165114.1|10627_11173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|11240_12396_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000955366.1|12437_12587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704534.1|13201_14062_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|14189_14576_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|14629_15304_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|15300_15648_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_000154135.1|17879_18545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335839.1|18685_19327_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000907857.1|20035_21067_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000581688.1|22026_31527_-	toxin B	NA	NA	NA	NA	NA
WP_001443774.1|31641_31872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000937603.1|39454_40642_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|40641_41007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631725.1|43402_43750_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|43746_44421_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|44474_44702_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|44864_45842_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_162908515.1|46647_47860_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_000592771.1|48033_50244_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|50287_50677_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445934.1|51637_52033_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000921957.1|52032_52992_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_077249722.1|53264_54167_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_012680995.1|54163_54475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086167.1|54550_55234_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_001443814.1|55233_55452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|55463_55898_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001276261.1|56421_57141_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|57417_57735_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000117628.1|58196_58697_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_162137195.1|58698_59319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|59424_59859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|59951_60218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|60282_61173_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_012605149.1|61172_61418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|61448_61700_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001341408.1|62278_63127_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157095.1|63212_63548_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291056.1|63779_64112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991399.1|64123_66844_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001341409.1|67064_67385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|67423_68579_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000955366.1|68620_68770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704534.1|69384_70245_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|70372_70759_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|70812_71487_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|71483_71831_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_000937603.1|73681_74869_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
