The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_003062	Agrobacterium fabrum str. C58 chromosome circular, complete sequence	2841580	433830	457882	2841580	tail,integrase,plate,holin	Sinorhizobium_phage(38.89%)	35	430704:430750	460936:460982
430704:430750	attL	AGCTTCCCAAGCTGAATACGAGGGTTCGATTCCCTTCACCCGCTCCA	NA	NA	NA	NA
WP_010970894.1|433830_434859_-|integrase	tyrosine-type recombinase/integrase	integrase	F8TUV0	EBPR_podovirus	34.5	5.0e-37
WP_161597236.1|434845_435013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010972629.1|435141_436047_-	DUF2303 family protein	NA	A0A291AUR3	Sinorhizobium_phage	63.2	7.3e-109
WP_035256169.1|436106_436439_-	hypothetical protein	NA	A0A291AUR5	Sinorhizobium_phage	73.4	1.4e-36
WP_142794440.1|436469_436670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035256174.1|436729_437041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035256176.1|437096_437288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155276033.1|437345_437492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010972631.1|437494_437917_-	tellurite resistance TerB family protein	NA	A0A1Y0T181	Sinorhizobium_phage	47.2	4.1e-22
WP_010970895.1|438415_439111_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_051883805.1|439196_439418_+	helix-turn-helix domain-containing protein	NA	W6MWX8	Pseudomonas_phage	55.4	5.3e-05
WP_010970897.1|439627_440125_+	hypothetical protein	NA	R9TQJ7	Rhizobium_phage	63.0	2.3e-48
WP_035256178.1|440121_440373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035256180.1|440372_441758_+	hypothetical protein	NA	A0A068C9F4	Rhizobium_phage	63.1	6.1e-123
WP_155276034.1|441754_441913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010972614.1|441916_442468_+	hypothetical protein	NA	A0A291AUS3	Sinorhizobium_phage	41.6	4.3e-27
WP_035256182.1|442464_443106_+	hypothetical protein	NA	A0A291AUS8	Sinorhizobium_phage	40.2	1.3e-32
WP_010970900.1|443102_443396_+	hypothetical protein	NA	A0A068C9G0	Rhizobium_phage	50.0	4.6e-20
WP_010970901.1|443395_444616_+	helix-turn-helix domain-containing protein	NA	A0A291AUK7	Sinorhizobium_phage	29.9	4.5e-21
WP_035256184.1|444605_445292_+	antitermination protein	NA	NA	NA	NA	NA
WP_010972632.1|445536_446106_+	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	39.6	1.9e-22
WP_162180292.1|446266_447001_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035256187.1|447297_447621_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_035256189.1|447622_448000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010970904.1|448011_448758_+	hypothetical protein	NA	A0A0A8IKZ7	Aurantimonas_phage	43.6	1.8e-41
WP_010970905.1|448757_449309_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_035256191.1|449319_449517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010972633.1|449517_450183_+|tail	phage tail protein I	tail	A0A0A8IL57	Aurantimonas_phage	63.6	1.9e-77
WP_010970907.1|454246_454615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010972635.1|454648_455113_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_010970908.1|455117_455330_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	53.2	2.1e-11
WP_010970909.1|455332_456493_+	phage late control D family protein	NA	A0A1X9SGQ9	Bradyrhizobium_phage	24.9	5.0e-09
WP_010970910.1|456536_457178_+	M15 family metallopeptidase	NA	A0A2L0V0S8	Agrobacterium_phage	64.4	4.5e-44
WP_035256200.1|457177_457423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010970912.1|457558_457882_+|holin	phage holin family protein	holin	A0A291AUN9	Sinorhizobium_phage	62.9	1.8e-33
460936:460982	attR	AGCTTCCCAAGCTGAATACGAGGGTTCGATTCCCTTCACCCGCTCCA	NA	NA	NA	NA
>prophage 2
NC_003062	Agrobacterium fabrum str. C58 chromosome circular, complete sequence	2841580	943699	950403	2841580	protease,portal,tail,head,capsid	Geobacillus_phage(33.33%)	9	NA	NA
WP_010971283.1|943699_944866_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	37.0	3.3e-61
WP_010971284.1|945061_945382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010971285.1|945431_946004_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	42.8	2.0e-27
WP_010971286.1|946036_947305_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	43.1	2.1e-77
WP_035256436.1|947402_947972_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_035256438.1|947975_948311_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_010971288.1|948307_948703_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_035256735.1|948710_949907_-	MFS transporter	NA	NA	NA	NA	NA
WP_035214777.1|949995_950403_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
>prophage 3
NC_003062	Agrobacterium fabrum str. C58 chromosome circular, complete sequence	2841580	1684807	1693244	2841580	tRNA	uncultured_Mediterranean_phage(75.0%)	9	NA	NA
WP_035258613.1|1684807_1686376_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	30.6	1.4e-11
WP_035215918.1|1686721_1687375_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1J0MC37	Streptomyces_phage	35.1	1.0e-11
WP_010971810.1|1687371_1688142_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.3	1.9e-25
WP_010971811.1|1688354_1689638_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	1.1e-97
WP_006314395.1|1689737_1690541_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.6	8.9e-42
WP_010971812.1|1690537_1691278_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_006314389.1|1691331_1691544_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	69.8	2.2e-08
WP_006314387.1|1691671_1692406_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	48.2	7.6e-40
WP_006314385.1|1692398_1693244_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.3	6.5e-35
>prophage 1
NC_003063	Agrobacterium fabrum str. C58 chromosome linear, complete sequence	2075577	1758820	1769752	2075577		Enterobacteria_phage(50.0%)	9	NA	NA
WP_010974010.1|1758820_1761184_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.7	5.0e-08
WP_010974011.1|1761338_1762220_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010974012.1|1762306_1763173_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.6	1.4e-93
WP_010974013.1|1763169_1764063_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.5	6.2e-36
WP_010974014.1|1764067_1765123_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.5	4.4e-97
WP_010974015.1|1765125_1765695_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.0	2.8e-34
WP_010974016.1|1765839_1767906_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	30.8	2.7e-66
WP_010974017.1|1768172_1768910_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	5.0e-23
WP_010974018.1|1768906_1769752_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.0	1.9e-10
