The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NC_014212	Meiothermus silvanus DSM 9946, complete sequence	3249394	522490	554042	3249394	integrase,transposase	Erysipelothrix_phage(33.33%)	43	514315:514329	560131:560145
514315:514329	attL	CGATCCCCTATCGGG	NA	NA	NA	NA
WP_013157066.1|522490_523540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013157067.1|523663_523918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012838.1|523975_524476_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_015586363.1|524472_524871_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_013012840.1|524903_525137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013012841.1|525560_526961_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013157068.1|526957_527419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012843.1|527465_528122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012844.1|528185_529172_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.7e-16
WP_013012845.1|529174_529966_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_013012846.1|529966_530764_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_013012847.1|530799_531774_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_013012848.1|531807_532635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013012849.1|532653_533148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157413565.1|533601_534399_+	cytochrome P450	NA	NA	NA	NA	NA
WP_015586368.1|534524_534950_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_018465403.1|535167_535578_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_156941926.1|535630_535768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169307844.1|535937_536732_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013012852.1|537050_537578_+	hypothetical protein	NA	E5E454	Acinetobacter_phage	45.9	7.7e-34
WP_013157070.1|537615_537837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157071.1|537859_538081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157072.1|538077_538524_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_013157073.1|538633_539656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157074.1|539926_540106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157075.1|540129_540540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157076.1|540515_540773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157077.1|540848_541481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169307845.1|541471_541618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013157078.1|541616_541889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157079.1|541977_542433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157080.1|542432_542720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157081.1|542716_542926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157082.1|542976_543159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157083.1|543127_543358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157084.1|543326_544022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013157085.1|543994_544759_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013157086.1|544816_545944_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	46.2	1.2e-79
WP_013157087.1|546054_546372_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_013157088.1|546432_546942_+	RAD52/22 double-strand break repair protein	NA	A0A191ZDG3	Pseudoalteromonas_virus	42.4	6.3e-17
WP_013157089.1|547001_549677_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	37.1	1.6e-156
WP_013157090.1|549720_551610_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.5	4.4e-116
WP_013157091.1|553286_554042_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
560131:560145	attR	CGATCCCCTATCGGG	NA	NA	NA	NA
>prophage 4
NC_014212	Meiothermus silvanus DSM 9946, complete sequence	3249394	1629526	1747702	3249394	protease,transposase,integrase,tRNA	Mycobacterium_phage(18.75%)	104	1702141:1702156	1750722:1750737
WP_013158078.1|1629526_1629970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148225949.1|1630198_1632406_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.9	4.1e-12
WP_148226044.1|1632557_1632857_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_083771650.1|1634062_1634671_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013158081.1|1635016_1636252_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_013158082.1|1636348_1637992_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_013158083.1|1637988_1638684_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013158084.1|1638782_1640303_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	41.8	1.2e-92
WP_013158085.1|1640299_1641025_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_049777888.1|1641098_1641956_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013158087.1|1642202_1642397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013158088.1|1642414_1643260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013158089.1|1643375_1644350_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	46.7	4.4e-67
WP_013158090.1|1644461_1647458_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_013158091.1|1647745_1648495_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_013158092.1|1648491_1649229_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013158093.1|1649292_1650492_+	serine hydrolase	NA	NA	NA	NA	NA
WP_013158094.1|1650510_1651500_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_013158095.1|1651507_1652128_+	ComF family protein	NA	NA	NA	NA	NA
WP_041653294.1|1652401_1652800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041653296.1|1652820_1653708_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_013158098.1|1653697_1654189_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_013158099.1|1654319_1655753_+	amidohydrolase	NA	NA	NA	NA	NA
WP_013158100.1|1655806_1658485_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_013158101.1|1658597_1659185_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_083771659.1|1659199_1660267_-	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	35.3	2.0e-12
WP_041652451.1|1660154_1660892_+	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	27.7	5.7e-11
WP_041652453.1|1660967_1661828_+	signal peptidase I	NA	NA	NA	NA	NA
WP_013158105.1|1661945_1662494_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_013158106.1|1662534_1663791_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.7	1.0e-36
WP_169307852.1|1663852_1664920_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013158108.1|1664981_1665926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041653303.1|1666086_1667835_+	ATP-binding protein	NA	A0A139ZPI2	Marinitoga_camini_virus	24.8	4.7e-27
WP_013158110.1|1668003_1668558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148225951.1|1668632_1669208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049777889.1|1669214_1670567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013158113.1|1670904_1671396_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_013158114.1|1671473_1672538_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_013158115.1|1672552_1673794_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_041653308.1|1673790_1674411_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_013158117.1|1674511_1675336_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_049777802.1|1675367_1676690_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_013158119.1|1676755_1677829_-	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_049777803.1|1677825_1678917_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_013158121.1|1678913_1680185_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_041653314.1|1680181_1681045_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_013158123.1|1681047_1681866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041653317.1|1681855_1683139_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_013158125.1|1683155_1684526_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_041653320.1|1684522_1684783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013158127.1|1684797_1685682_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_013158128.1|1685683_1686118_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_041652885.1|1686533_1686707_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148226000.1|1686693_1686873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041652458.1|1686953_1687385_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.9	2.4e-09
WP_169307853.1|1687503_1687779_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013158129.1|1688129_1689407_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	62.1	1.4e-09
WP_083771717.1|1689516_1690017_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013158131.1|1690297_1690585_-	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_013158132.1|1690638_1691358_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_169307887.1|1691537_1693676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013158134.1|1694715_1697481_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_013158135.1|1697541_1698618_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013158136.1|1698599_1698848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013156564.1|1698911_1699943_-|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_013158138.1|1700622_1701888_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	38.3	9.7e-67
WP_083771660.1|1701824_1702283_+	RecX family transcriptional regulator	NA	NA	NA	NA	NA
1702141:1702156	attL	TAGAGCTGCTCGAGCG	NA	NA	NA	NA
WP_013158140.1|1703478_1703916_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_013158141.1|1704057_1705503_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	26.8	1.1e-42
WP_013158142.1|1705484_1705643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148226045.1|1705809_1706472_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_013158144.1|1706631_1706904_-	stage V sporulation protein S	NA	NA	NA	NA	NA
WP_013158145.1|1706941_1708036_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041653328.1|1708468_1712986_+	glutamate synthase	NA	NA	NA	NA	NA
WP_041652461.1|1713135_1713693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158148.1|1713859_1714642_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_013158149.1|1714829_1715411_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_013158150.1|1715422_1716193_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_148225956.1|1716189_1716687_-	DinB family protein	NA	NA	NA	NA	NA
WP_013158152.1|1716689_1717460_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_041653331.1|1717509_1717842_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013158154.1|1717944_1719165_+	aspartate kinase	NA	NA	NA	NA	NA
WP_049777805.1|1719219_1719735_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013158156.1|1719999_1720989_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_013158157.1|1721137_1721782_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_013158158.1|1721778_1722198_-	cobalamin B12-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013158159.1|1722224_1722878_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_013156567.1|1723068_1724331_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	40.7	7.4e-75
WP_013158161.1|1724717_1726373_-	methylmalonyl-CoA mutase family protein	NA	NA	NA	NA	NA
WP_013158162.1|1726588_1727257_-	recombination protein O N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013158163.1|1727560_1727800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158164.1|1727927_1729925_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013158165.1|1729943_1730705_+	YmdB family metallophosphoesterase	NA	NA	NA	NA	NA
WP_013158166.1|1730709_1730994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041652465.1|1731198_1732785_+	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_013158168.1|1732800_1733013_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_041653335.1|1733096_1734053_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013158170.1|1735476_1737144_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	45.6	1.4e-134
WP_013158171.1|1737166_1738240_-	DUF815 domain-containing protein	NA	NA	NA	NA	NA
WP_013156567.1|1739727_1740990_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	40.7	7.4e-75
WP_049777808.1|1743244_1743733_-	hypothetical protein	NA	Q859R3	Thermus_virus	50.7	1.7e-27
WP_013158173.1|1743835_1744066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158174.1|1744062_1744458_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_083771661.1|1746721_1747702_-|integrase	site-specific integrase	integrase	Q859R3	Thermus_virus	58.9	2.2e-87
1750722:1750737	attR	TAGAGCTGCTCGAGCG	NA	NA	NA	NA
>prophage 5
NC_014212	Meiothermus silvanus DSM 9946, complete sequence	3249394	1845024	1970053	3249394	integrase,tRNA,protease,capsid,plate,transposase	Bacillus_virus(12.5%)	119	1844948:1845007	1972257:1973396
1844948:1845007	attL	TGAACCCGGACAAACACATGTGAGACTCTAAGCTGGGATAAAAAGAGGGGAACCGACCAG	NA	NA	NA	NA
WP_013158287.1|1845024_1846182_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013158288.1|1846858_1848070_+	trigger factor	NA	NA	NA	NA	NA
WP_013158289.1|1848275_1848866_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.3	3.8e-50
WP_013158290.1|1848852_1850052_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.8	6.7e-118
WP_013158291.1|1850171_1850882_-	DsbA family protein	NA	NA	NA	NA	NA
WP_013158292.1|1850936_1851881_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.7	9.3e-14
WP_013158293.1|1851948_1852383_-	S-adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_013158294.1|1852389_1852848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013158295.1|1853035_1855828_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.7	1.4e-81
WP_013158296.1|1856000_1856495_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_013158297.1|1856629_1857118_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_013158298.1|1857366_1857810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158299.1|1857957_1858392_-	DMT family transporter	NA	NA	NA	NA	NA
WP_013158300.1|1858393_1858975_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	38.8	1.8e-20
WP_013158301.1|1859156_1860398_+	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
WP_013158302.1|1861719_1862430_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013158303.1|1862509_1863844_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_013158304.1|1863984_1864401_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_041653375.1|1864513_1866004_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013158306.1|1866040_1867453_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013158307.1|1867515_1868169_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_013158308.1|1868170_1868653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041653377.1|1868722_1869805_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_013158310.1|1869815_1871135_-	dihydroorotase	NA	NA	NA	NA	NA
WP_013158311.1|1871159_1872104_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	30.8	8.1e-26
WP_013158312.1|1872183_1872723_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_013158313.1|1873092_1873713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158314.1|1873760_1874921_+	exonuclease SbcCD subunit D	NA	A0A2H4UT91	Bodo_saltans_virus	25.4	1.8e-06
WP_013158315.1|1874960_1877675_+	SMC family ATPase	NA	G3MAB6	Bacillus_virus	26.3	8.3e-15
WP_013158316.1|1877746_1879225_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_013158317.1|1879214_1880486_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2K9L0E9	Tupanvirus	35.7	8.0e-61
WP_013158318.1|1880646_1881411_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_013158319.1|1881620_1882646_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_013158320.1|1882627_1883233_-	isoprenylcysteine carboxyl methyltransferase	NA	NA	NA	NA	NA
WP_013158321.1|1883236_1884349_-	stilbene synthase	NA	NA	NA	NA	NA
WP_013158322.1|1884341_1885127_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_013156567.1|1885435_1886698_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	40.7	7.4e-75
WP_013158324.1|1887815_1888556_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083771666.1|1888616_1888868_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148226050.1|1889528_1890983_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013158326.1|1890979_1891831_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013158327.1|1891909_1892269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158328.1|1892277_1892715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158329.1|1892884_1893196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158330.1|1893192_1893432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158331.1|1893579_1893810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158332.1|1893802_1894078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158333.1|1894070_1894289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158334.1|1894298_1894694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158335.1|1894779_1895259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158336.1|1895255_1895957_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013158337.1|1895946_1896387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158338.1|1896443_1896692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158339.1|1896701_1897043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158340.1|1897044_1897365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083771667.1|1897300_1897837_+	DUF3486 family protein	NA	NA	NA	NA	NA
WP_013158342.1|1897823_1899107_+	hypothetical protein	NA	A0A2P9JZI8	Alteromonadaceae_phage	48.1	4.4e-99
WP_013158343.1|1899106_1900642_+	DUF935 family protein	NA	A0A2K9VGW6	Faecalibacterium_phage	37.4	3.3e-77
WP_013158344.1|1900643_1901816_+|capsid	minor capsid protein	capsid	H7BVL6	unidentified_phage	30.0	5.5e-24
WP_013157655.1|1901827_1903027_-|transposase	transposase	transposase	I4AZM3	Saccharomonospora_phage	40.5	1.5e-53
WP_041652367.1|1903027_1903426_-|transposase	IS200/IS605 family transposase	transposase	A0A1L2BWN1	Bacteriophage	52.3	2.3e-35
WP_013158345.1|1903663_1904203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174263509.1|1904256_1904703_+	phage virion morphogenesis protein	NA	A0A2K9VH22	Faecalibacterium_phage	43.7	6.7e-15
WP_013158347.1|1904783_1905284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158348.1|1905294_1905507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158349.1|1905503_1906925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158350.1|1906935_1907367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158351.1|1907425_1907800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169307840.1|1907804_1907966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013158353.1|1907950_1910032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158354.1|1910031_1910610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158355.1|1910606_1911272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158356.1|1911273_1911750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158357.1|1911749_1912124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158358.1|1912116_1913199_+|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_013158359.1|1913199_1913811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158360.1|1913818_1914973_+	hypothetical protein	NA	I3VYV3	Thermoanaerobacterium_phage	41.3	1.9e-05
WP_013158361.1|1914987_1915164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013156564.1|1915689_1916721_-|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_013158363.1|1916871_1917153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013158364.1|1917167_1918559_-	phosphoglucomutase/phosphomannomutase family protein	NA	A0A1X9I671	Streptococcus_phage	27.0	2.2e-27
WP_041652509.1|1918914_1921074_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	40.1	6.2e-122
WP_013158366.1|1921335_1921779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158367.1|1921847_1922570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158368.1|1922644_1923034_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_013158369.1|1923033_1923462_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_013158370.1|1923648_1923945_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_013158371.1|1924002_1926762_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_013158372.1|1926960_1928229_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_013158373.1|1928288_1929668_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	1.7e-32
WP_013158374.1|1929791_1931342_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	38.1	1.5e-77
WP_041652511.1|1931435_1935185_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	48.2	2.8e-05
WP_013158376.1|1935376_1937107_-	DNA polymerase/3'-5' exonuclease PolX	NA	NA	NA	NA	NA
WP_013158377.1|1937170_1938184_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013158378.1|1938369_1938993_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013158379.1|1939147_1940758_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_013158380.1|1940857_1941994_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_013158381.1|1942402_1943221_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	8.0e-22
WP_013158382.1|1943288_1944116_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013158383.1|1944257_1944797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013158384.1|1944897_1945620_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	9.2e-22
WP_013158385.1|1945616_1946783_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013158386.1|1946848_1947988_-	dehypoxanthine futalosine cyclase	NA	NA	NA	NA	NA
WP_013158387.1|1948049_1948688_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013158388.1|1948866_1949913_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013158389.1|1949930_1951055_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_049777811.1|1951079_1951967_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013158391.1|1952094_1952652_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_013158392.1|1952748_1953453_-	UMP kinase	NA	NA	NA	NA	NA
WP_013158393.1|1953528_1954119_-	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_013158394.1|1954127_1954883_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_041652517.1|1956228_1957164_+	NAD(+)/NADH kinase	NA	NA	NA	NA	NA
WP_013158397.1|1957386_1958520_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_013158398.1|1958529_1962174_-	alpha-amylase	NA	NA	NA	NA	NA
WP_049777894.1|1962269_1963484_-	aminopeptidase	NA	NA	NA	NA	NA
WP_013158400.1|1963556_1964642_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013158401.1|1964634_1965798_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_013158402.1|1966046_1969013_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_013158403.1|1969129_1970053_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1972257:1973396	attR	TGAACCCGGACAAACACATGTGAGACTCTAAGCTGGGATAAAAAGAGGGGAACCGACCAGGAAAGGAGGTTCCCCAGGTGCAGTTTACCACCGTTGGCCGAGAGATATGGAGAGGCGCTAGACAAGCACAGAGGCTGGCCGAGGCCAACGCAAGCGACCCAGAGGTCCAGGAACGTCTGCGCAAGCTCCGACTGGTCAAAGCCCTGCGTGAAAGTAAAAAGAGCTGGAAGGAGATCCAGGACCTGGTCGGGATCAGCCGGGCCACCTACCACCGCTGGCAAAAAGCCCTAAAAGAAAAGGGCCTGGCTGGACTCAAACCCCGCTCCCGCCGCCCTAAGCACCTGCGCACAAAGGTCCACTGGACCCCAGGGCTGCTCATTAGAATAGAAACTCTCCGCAAGGAAAACCCCACCTGGGGACGCTGGTCCATCTGGCTTACCCTCCGCAAGGAGGGTTTCCAGATGAGCGAACGCACGGTGGGGCGCATCCTGGCCTACCTGGAGAAGCACCGACGTATCGAGAGCGTGGCCGGCTACCTGGCCCGGACTCAAAGAGGGAAGCTAAAGCGAAGGGTAAACCGGCCCTACGCCAAAAGGAAGCCCCGAGGATACGAGGCCAGGGCTCCTGGGGACCTGGTCCAGGTGGACACCCTCACCCTGACCTTAGGACCGGGAAGCATGGTCAAGCACTTCTCGGCGATTGACCTCCATAGCCGGTTTGTCCTGGCGGAGGTGCACAGCCGGGCCACGGCTAAGCTTTCTGAGGGGTTCTTGTCCTTGCTTCTGGCCAGGGCCCCTTTTCCCATCCGGGCCATCCAGGTGGATGGGGGCAGCGAGTTCATGGCCGAGTTTGAGGAGGCCTGCTGTGCTCTGGGGATTGCCTTGTTTGTGCTACCGCCGAGGAGTCCTAAACTCAATGGTCACGTGGAGCGGATGCAGCGGACCTTCAAGGAGGAGTTCTACACCCGGCCTTTGCCCACCCCGCTCAGCGAGCTGCAGGCAGAGCTGGATACCTACCTGGACTACTACAACCGCCGAAGGCCTCACATGGCCCTGGGGGGTCTTGCTCCGCTGGAGTTTTTGGCTAAGATGCAAGAGGAGTCGGTTCCTCAAAGAGTCTCAAATGTGTTGACCGATTACA	NA	NA	NA	NA
>prophage 6
NC_014212	Meiothermus silvanus DSM 9946, complete sequence	3249394	2488633	2498070	3249394	tRNA	Paramecium_bursaria_Chlorella_virus(25.0%)	8	NA	NA
WP_013158846.1|2488633_2490472_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	22.7	1.2e-17
WP_013158847.1|2490477_2491554_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	23.4	1.9e-15
WP_013158848.1|2491629_2492247_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	33.9	3.4e-25
WP_013158849.1|2492283_2492928_+	deoxynucleoside kinase	NA	A0A192GP17	Short-finned_eel_ranavirus	29.0	5.2e-08
WP_013158850.1|2493009_2494014_+	agmatine deiminase family protein	NA	M1HLE1	Paramecium_bursaria_Chlorella_virus	32.8	5.0e-58
WP_013158851.1|2494024_2494900_+	N-carbamoylputrescine amidase	NA	A7ITI3	Paramecium_bursaria_Chlorella_virus	46.6	6.1e-68
WP_013158852.1|2494971_2497008_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.6	1.2e-21
WP_013158853.1|2497038_2498070_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.6	1.3e-13
>prophage 7
NC_014212	Meiothermus silvanus DSM 9946, complete sequence	3249394	2690867	2753525	3249394	transposase	Streptococcus_phage(40.0%)	58	NA	NA
WP_013156564.1|2690867_2691899_-|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_013159040.1|2691971_2692778_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013159041.1|2692789_2693782_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013159042.1|2693788_2694766_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_049777908.1|2694831_2695635_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013159044.1|2695757_2696672_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013159045.1|2696740_2698009_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013159046.1|2698361_2700941_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	38.1	1.4e-99
WP_013159047.1|2700978_2701239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159048.1|2701226_2701802_+	LysE family transporter	NA	NA	NA	NA	NA
WP_013159049.1|2701757_2702303_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_013159050.1|2703637_2703907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159051.1|2703955_2704855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049777822.1|2704982_2705705_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041652639.1|2705722_2705950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159052.1|2706049_2706454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013156564.1|2706489_2707521_-|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_013157594.1|2707729_2709346_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_049777823.1|2709442_2710522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159054.1|2710820_2711972_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.0	7.7e-55
WP_013159055.1|2711990_2713244_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.4	6.6e-84
WP_013159056.1|2713452_2714253_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_013159057.1|2714409_2715651_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_013159058.1|2715731_2716865_+	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
WP_013159059.1|2717053_2717434_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_013159060.1|2717476_2718001_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_013159061.1|2718170_2719286_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013159062.1|2719369_2720305_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_013159063.1|2720327_2722625_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_013159064.1|2722621_2723452_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_013159065.1|2723558_2724674_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_013159066.1|2724670_2724967_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_013159067.1|2725131_2726106_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_013159068.1|2726178_2727102_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013159069.1|2727303_2727993_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_013159070.1|2727985_2728420_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_013159071.1|2728528_2729086_-	transcription termination/antitermination factor NusG	NA	NA	NA	NA	NA
WP_013159072.1|2729099_2729321_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_013159073.1|2729320_2729485_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_013159074.1|2729559_2730777_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.8e-06
WP_013159076.1|2732806_2734159_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041653557.1|2734231_2736007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159078.1|2736109_2736571_-	carbon monoxide dehydrogenase subunit G	NA	NA	NA	NA	NA
WP_013159079.1|2736654_2737263_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_013159080.1|2737569_2738064_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	37.1	5.3e-21
WP_013159081.1|2738144_2740514_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013159082.1|2740612_2741440_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_041652646.1|2741522_2742422_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_013159084.1|2742427_2743642_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_013159085.1|2743660_2744779_-	XdhC family protein	NA	NA	NA	NA	NA
WP_013159086.1|2744836_2745388_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_041653558.1|2745464_2747048_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013159088.1|2747119_2747437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159089.1|2747492_2748254_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_013159090.1|2748277_2750464_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_013159091.1|2750517_2750919_-	response regulator	NA	NA	NA	NA	NA
WP_013156564.1|2750999_2752031_+|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_083771679.1|2753360_2753525_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_014212	Meiothermus silvanus DSM 9946, complete sequence	3249394	2792790	2801373	3249394		Tupanvirus(16.67%)	7	NA	NA
WP_013159129.1|2792790_2795109_-	GDP-mannose 4,6-dehydratase	NA	A0A2K9KZK0	Tupanvirus	38.9	3.9e-29
WP_013159130.1|2795116_2796544_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.3	6.4e-67
WP_041652656.1|2796557_2797550_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.0	9.9e-67
WP_041652658.1|2797611_2798145_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_013159133.1|2798141_2798864_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	40.0	3.1e-17
WP_013159134.1|2798860_2799928_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	35.4	1.0e-40
WP_013159135.1|2799942_2801373_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.3	2.6e-44
>prophage 9
NC_014212	Meiothermus silvanus DSM 9946, complete sequence	3249394	3092720	3138042	3249394	transposase,tRNA	Burkholderia_virus(14.29%)	44	NA	NA
WP_148225922.1|3092720_3093843_+|transposase	IS3-like element ISMesi1 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.6	1.8e-16
WP_083771691.1|3094182_3094413_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_013159417.1|3094468_3095986_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_013159418.1|3096004_3097540_-	xylulokinase	NA	NA	NA	NA	NA
WP_169307872.1|3098036_3098783_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013159420.1|3098779_3099823_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_083771692.1|3099823_3101221_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013159422.1|3101309_3101870_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_013159423.1|3101872_3102745_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013159424.1|3102757_3103618_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013159425.1|3104127_3105060_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_169307873.1|3105148_3105589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013156567.1|3105669_3106932_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	40.7	7.4e-75
WP_013159427.1|3107083_3109249_-	glutamine synthetase III	NA	NA	NA	NA	NA
WP_013159428.1|3109471_3110239_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_013159429.1|3110600_3112019_-	xylulokinase	NA	NA	NA	NA	NA
WP_013159430.1|3112046_3113444_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041653695.1|3113564_3114191_-	membrane protein	NA	NA	NA	NA	NA
WP_049777847.1|3114234_3115005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159433.1|3115112_3116234_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049777918.1|3116230_3117124_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	2.8e-20
WP_013159435.1|3117134_3117767_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169307874.1|3117812_3117950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148226000.1|3117973_3118153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041652458.1|3118233_3118665_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.9	2.4e-09
WP_013159436.1|3118737_3119343_-	nitroreductase	NA	NA	NA	NA	NA
WP_013159437.1|3119475_3121341_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041652711.1|3121466_3121679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041653705.1|3121737_3122109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159440.1|3122113_3122998_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	5.4e-16
WP_049777919.1|3122990_3124031_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_013159442.1|3124030_3124906_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013159443.1|3125357_3126473_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169307875.1|3126783_3128004_+	RtcB family protein	NA	A0A1I9SAD2	Rhodococcus_phage	30.1	1.0e-33
WP_169307876.1|3128058_3128232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169307877.1|3128861_3129005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159446.1|3129008_3130961_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013159447.1|3131069_3131495_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_013159448.1|3131528_3132392_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_013159449.1|3132478_3133654_-	MFS transporter	NA	NA	NA	NA	NA
WP_013159450.1|3133658_3134534_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_013159451.1|3134562_3135069_-	metal-binding protein	NA	NA	NA	NA	NA
WP_013159452.1|3135290_3136511_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	46.6	4.3e-96
WP_013159453.1|3136965_3138042_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_014212	Meiothermus silvanus DSM 9946, complete sequence	3249394	3151861	3218288	3249394	transposase	Mycobacterium_phage(14.29%)	56	NA	NA
WP_013159465.1|3151861_3152932_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013156567.1|3153048_3154311_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	40.7	7.4e-75
WP_041652720.1|3156224_3156722_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_049777920.1|3156874_3157543_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_013159468.1|3157572_3158487_-	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_013159469.1|3158585_3158957_-	RidA family protein	NA	NA	NA	NA	NA
WP_013159470.1|3159024_3159219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159471.1|3159276_3160236_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_041653713.1|3160517_3163241_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_013159473.1|3163273_3164560_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_013159474.1|3164798_3166691_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_013159475.1|3166811_3167876_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_013159476.1|3167887_3169063_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	4.1e-128
WP_148226001.1|3169246_3171760_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_013159478.1|3171976_3172891_-	DUF4032 domain-containing protein	NA	NA	NA	NA	NA
WP_013159479.1|3173054_3174308_+	DUF4127 family protein	NA	NA	NA	NA	NA
WP_013159480.1|3174317_3174632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169307878.1|3174718_3174871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159482.1|3175182_3175842_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013159483.1|3175832_3176756_+	proline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013159484.1|3176830_3177235_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_013159485.1|3177276_3178824_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013159486.1|3178989_3179451_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013159235.1|3179592_3180414_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_049777849.1|3182414_3182981_+|transposase	transposase	transposase	A0A1I9KF42	Aeromonas_phage	38.5	1.2e-08
WP_083771696.1|3183216_3183327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049777850.1|3183348_3183606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169307879.1|3183565_3183811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159488.1|3183819_3184128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159489.1|3184115_3184958_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013159490.1|3184991_3185198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148226082.1|3185194_3185932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159493.1|3187096_3187456_-	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_013159494.1|3187452_3188295_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013159495.1|3188391_3189834_+	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	36.8	3.1e-77
WP_013159496.1|3189833_3192119_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
WP_013159497.1|3192124_3192745_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_013159498.1|3193551_3194862_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013159499.1|3194858_3195539_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013159500.1|3195603_3196923_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013159501.1|3196919_3197576_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013159502.1|3197579_3198236_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013159503.1|3198243_3198981_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041653720.1|3198977_3200138_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_013159505.1|3200840_3201251_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_013159506.1|3201501_3201714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159508.1|3202001_3203258_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.3	2.1e-13
WP_013159509.1|3203525_3204944_-	hypothetical protein	NA	A0A1L2BWY3	Bacteriophage	32.0	4.8e-14
WP_013159510.1|3205037_3206795_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_013159511.1|3207307_3207949_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	7.6e-28
WP_013159512.1|3207945_3209145_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_148226083.1|3209702_3210569_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013159516.1|3210563_3211247_+	aquaporin	NA	NA	NA	NA	NA
WP_013159517.1|3211262_3211928_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_013159519.1|3212274_3213840_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_013156869.1|3217166_3218288_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_014213	Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence	347854	36588	80653	347854	transposase	Shigella_phage(22.22%)	49	NA	NA
WP_013156564.1|36588_37620_+|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_013159579.1|37764_39036_-	GGDEF domain-containing protein	NA	A0A1B0Z064	Pseudomonas_phage	43.0	3.2e-09
WP_148225922.1|39078_40202_-|transposase	IS3-like element ISMesi1 family transposase	transposase	Q716C2	Shigella_phage	31.6	1.1e-26
WP_049777929.1|40256_40631_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_169307901.1|40747_41419_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013159581.1|41420_42347_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-11
WP_169307902.1|42417_42972_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.3	4.6e-13
WP_013159585.1|45790_46054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159586.1|46154_46553_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_013159587.1|46549_47050_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_013159589.1|47489_48224_-	2-phosphosulfolactate phosphatase	NA	NA	NA	NA	NA
WP_013159590.1|48248_49199_-	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_013159591.1|49179_49854_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013159592.1|49846_50815_-	phosphoribulokinase	NA	A0A2H4UUR3	Bodo_saltans_virus	34.2	2.3e-23
WP_013159593.1|50804_51743_-	CbbX protein	NA	G3MAX6	Bacillus_virus	40.4	7.7e-45
WP_013159594.1|51752_52175_-	ribulose bisphosphate carboxylase small subunit	NA	NA	NA	NA	NA
WP_013159595.1|52185_53628_-	form I ribulose bisphosphate carboxylase large subunit	NA	NA	NA	NA	NA
WP_013159596.1|53637_54627_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_013159597.1|54717_55611_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	31.2	5.7e-05
WP_013159598.1|55607_56087_-	DinB family protein	NA	NA	NA	NA	NA
WP_013159599.1|56097_56376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159600.1|56383_56671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159601.1|56667_56964_-	Dabb family protein	NA	NA	NA	NA	NA
WP_013159602.1|56960_57713_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_013159603.1|57709_59701_-	transketolase	NA	NA	NA	NA	NA
WP_013159604.1|59817_61182_-	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_013156564.1|61270_62302_+|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_013159605.1|62569_62827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159606.1|62877_63297_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_013159607.1|63293_63515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159608.1|63691_63997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083771738.1|64317_64755_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_013159610.1|64765_64942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159611.1|65632_66196_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148225922.1|66263_67386_+|transposase	IS3-like element ISMesi1 family transposase	transposase	Q716C2	Shigella_phage	31.6	1.1e-26
WP_013159612.1|67531_68734_+	CoA transferase	NA	NA	NA	NA	NA
WP_013159613.1|68715_69501_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	1.1e-31
WP_013159614.1|69487_70261_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013159615.1|70257_71256_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013159616.1|71255_72074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159617.1|72597_72750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159618.1|73571_74015_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_013159619.1|74011_74263_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013159620.1|74337_75423_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013159621.1|75774_76905_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_041653806.1|76913_78245_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_013159623.1|78261_79092_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_013159624.1|79088_79544_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013156564.1|79621_80653_-|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_014213	Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence	347854	118943	167765	347854	protease,transposase,tail	uncultured_Mediterranean_phage(50.0%)	29	NA	NA
WP_013159657.1|118943_120029_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013159658.1|120120_121191_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013159659.1|121203_122046_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013159660.1|122042_122801_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013159661.1|122800_123850_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	1.2e-30
WP_013156567.1|125888_127151_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	40.7	7.4e-75
WP_148226090.1|128039_128669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159664.1|128744_129023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159665.1|129053_130448_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.6	2.8e-22
WP_013159666.1|130529_130736_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_013159667.1|130751_130973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159668.1|131120_132596_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_013159669.1|132748_133825_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013159670.1|134196_134868_-	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_013159671.1|134884_136033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159673.1|136523_137891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159674.1|137906_138908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159675.1|138904_140209_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_013159677.1|141118_142522_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_013159678.1|143202_145224_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_013159679.1|145234_150751_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	24.6	3.6e-89
WP_013159680.1|150760_154777_-	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	26.8	6.0e-46
WP_041653769.1|154786_157537_-	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	31.2	9.8e-64
WP_148226091.1|157542_159072_-|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_013156564.1|159081_160113_-|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_013159683.1|160233_162294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041653835.1|162297_165027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049777934.1|165069_166635_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_013156564.1|166733_167765_-|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_014213	Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence	347854	297853	345349	347854	integrase,transposase	Tupanvirus(14.29%)	42	307731:307747	343366:343382
WP_013156564.1|297853_298885_+|transposase	IS701-like element ISMesi2 family transposase	transposase	NA	NA	NA	NA
WP_013159769.1|298898_299519_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_049777944.1|299531_301004_-	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	32.1	5.0e-06
WP_013159771.1|301027_301360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159772.1|301413_301617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083771740.1|301768_301849_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_013159773.1|301928_303638_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_013159774.1|303634_305686_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	29.2	6.2e-39
WP_013159775.1|306899_307442_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_013159776.1|307447_308560_+	sensor histidine kinase	NA	NA	NA	NA	NA
307731:307747	attL	GGCTGCTCGCGCGCCGC	NA	NA	NA	NA
WP_013159777.1|310401_311715_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.8	2.1e-32
WP_013159778.1|311744_313760_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013159779.1|314104_314410_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013159780.1|314523_314913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159781.1|315084_316179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013159782.1|316197_316371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041653779.1|316465_317071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041653780.1|316980_317517_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013159783.1|317544_317919_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_013159784.1|317899_318181_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_013159785.1|320098_320380_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_013159786.1|320389_321370_-	CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_013159787.1|321369_321942_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_013159788.1|322120_323089_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_013159789.1|323324_325877_+	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	25.9	1.1e-05
WP_013159790.1|325867_327259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159791.1|327255_328263_+	DevR family CRISPR-associated autoregulator	NA	NA	NA	NA	NA
WP_013159792.1|328271_329021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159793.1|329020_329827_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_148225922.1|330969_332093_-|transposase	IS3-like element ISMesi1 family transposase	transposase	Q716C2	Shigella_phage	31.6	1.1e-26
WP_013159795.1|332339_333428_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013159796.1|333991_334366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083771749.1|334728_334767_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013159797.1|335296_335671_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_013159798.1|336252_337020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159799.1|337576_338401_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_083771742.1|338417_340493_-	chorismate-binding protein	NA	A0A0P0IKJ1	Acinetobacter_phage	38.4	3.7e-31
WP_013159801.1|340618_341563_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013159802.1|342448_342706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083771743.1|342769_343057_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_041653874.1|343463_344264_+	alpha/beta hydrolase	NA	W0LK50	Mycobacterium_phage	30.3	1.8e-05
343366:343382	attR	GGCTGCTCGCGCGCCGC	NA	NA	NA	NA
WP_041653782.1|344479_345349_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_014214	Meiothermus silvanus DSM 9946 plasmid pMESIL02, complete sequence	124421	4113	32998	124421	transposase	Thermus_phage(15.38%)	40	NA	NA
WP_013157086.1|4113_5241_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	46.2	1.2e-79
WP_148226104.1|5593_6109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159811.1|6191_6767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159812.1|6763_7729_-	ribonuclease H family protein	NA	A0A0M4JP20	Mollivirus	41.4	2.8e-05
WP_013159813.1|7715_9188_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	1.7e-09
WP_013159814.1|9233_9746_-	RAD52/22 double-strand break repair protein	NA	A0A191ZDG3	Pseudoalteromonas_virus	44.1	5.7e-18
WP_013159815.1|9809_10106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159816.1|10099_10315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169307906.1|10719_10923_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013159819.1|10984_11386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159820.1|11386_11566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159821.1|11662_11815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159822.1|11880_12117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159823.1|12287_12509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159824.1|12520_12682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148226117.1|12736_13093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013159826.1|13140_13950_-	DeoR family transcriptional regulator	NA	A0A1L4BKI0	Thermus_phage	36.2	2.0e-09
WP_013159827.1|14091_15093_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_049777953.1|15183_15858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159829.1|16012_16153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148226118.1|16324_17599_-	hypothetical protein	NA	A0A2I7R0P0	Vibrio_phage	21.8	1.2e-08
WP_049777954.1|17790_18471_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	35.6	1.5e-05
WP_083771751.1|18476_19355_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013159832.1|19459_20089_-	PD-(D/E)XK nuclease family protein	NA	A0MN44	Thermus_phage	32.4	1.4e-26
WP_013159833.1|20098_20575_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	47.2	1.5e-20
WP_013159834.1|20615_21017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159835.1|21107_21875_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148226105.1|21892_23596_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013159837.1|23588_24023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041653892.1|24019_24625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148226106.1|24692_25550_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_049777955.1|25621_26695_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	30.8	1.7e-19
WP_013159839.1|26823_27027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013159840.1|27161_29102_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	33.3	2.7e-76
WP_013159841.1|29338_29755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148226107.1|29830_30184_+	DUF2227 family putative metal-binding protein	NA	NA	NA	NA	NA
WP_049777956.1|30236_30479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049777957.1|30469_31375_-	AAA family ATPase	NA	H6WG28	Cyanophage	26.5	2.7e-10
WP_049777958.1|31437_32649_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_148226109.1|32605_32998_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	66.1	8.2e-49
