The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014169	Bifidobacterium longum subsp. longum JDM301, complete sequence	2477838	368139	434483	2477838	protease,tRNA,transposase	Thermus_phage(15.38%)	58	NA	NA
WP_013140178.1|368139_369183_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013140179.1|369221_370019_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_013140180.1|370098_371532_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_013140181.1|371650_372382_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038425864.1|372472_373879_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_013140183.1|374200_374752_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	37.3	5.6e-19
WP_007057690.1|375216_375384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080515122.1|376063_377224_-|transposase	IS256-like element ISBlo16 family transposase	transposase	NA	NA	NA	NA
WP_007057699.1|377601_377826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080515123.1|378239_378449_-	Vacuole effluxer Atg22 like protein	NA	NA	NA	NA	NA
WP_007054783.1|378688_378853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013140188.1|378849_379035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013140189.1|379413_380484_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003829805.1|380502_380691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013140191.1|380950_381274_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013140192.1|381263_381653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013140193.1|381831_382575_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013140194.1|382755_384033_-	MFS transporter	NA	NA	NA	NA	NA
WP_013140195.1|384256_385273_-	sugar kinase	NA	NA	NA	NA	NA
WP_007051452.1|385643_385838_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_029680011.1|385949_388571_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_013140197.1|388705_389749_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.0	2.8e-27
WP_013140198.1|390107_391019_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013140199.1|391018_391996_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_038425867.1|392114_393506_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013140201.1|393596_394874_+	fuconate dehydratase	NA	Q6A202	Oenococcus_phage	23.7	1.8e-12
WP_013140202.1|394889_395681_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013140203.1|395824_396721_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_013140204.1|396756_397194_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_013140205.1|397213_398650_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_013140206.1|398665_401017_+	glycoside hydrolase family 95 protein	NA	NA	NA	NA	NA
WP_013140207.1|401160_401772_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013140209.1|401795_402611_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_038425868.1|402684_404331_+	U32 family peptidase	NA	Q6DW11	Phage_TP	35.8	3.8e-39
WP_013140210.1|404409_405390_+	laccase domain-containing protein	NA	NA	NA	NA	NA
WP_013140211.1|405469_406345_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013140212.1|406354_407032_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_013140213.1|407179_408748_+	cell division protein	NA	NA	NA	NA	NA
WP_013140214.1|408862_410206_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	31.8	2.5e-60
WP_179287629.1|410559_411648_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	44.4	2.3e-80
WP_185967054.1|411948_413010_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.1	8.6e-85
WP_013140218.1|413163_413751_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	37.6	2.8e-24
WP_013140219.1|413743_415048_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	35.5	1.1e-36
WP_013140220.1|415109_415823_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_013140221.1|416095_417409_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_013140222.1|417633_418965_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_029680021.1|419163_419868_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.3e-40
WP_013140224.1|420105_421239_+	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_007051435.1|421449_422403_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_010081151.1|422402_423401_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_007051433.1|423453_424233_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.3	1.3e-13
WP_013140225.1|424529_425108_+	LemA family protein	NA	NA	NA	NA	NA
WP_012471992.1|425171_427442_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_187287448.1|430071_430242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013140228.1|430449_431313_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_013140229.1|431404_432460_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_013140230.1|432598_433186_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	37.0	2.3e-23
WP_013140231.1|433178_434483_+|transposase	transposase	transposase	Q19ZT4	Mycobacterium_virus	33.9	3.6e-40
>prophage 2
NC_014169	Bifidobacterium longum subsp. longum JDM301, complete sequence	2477838	893095	906002	2477838	integrase,transposase	Gordonia_phage(33.33%)	12	894178:894237	897569:897667
WP_038425912.1|893095_893611_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
894178:894237	attL	TCCGATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCC	NA	NA	NA	NA
WP_013140284.1|894272_895328_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH95	Gordonia_phage	27.1	5.5e-07
WP_038425874.1|895324_896290_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013140282.1|896286_897489_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013140531.1|898044_899211_-	histidine kinase	NA	NA	NA	NA	NA
897569:897667	attR	GGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCGGAATTAAACCGACATCGGTTTAATTCCGACCGCGGCTGCCA	NA	NA	NA	NA
WP_012576686.1|899222_899825_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038425915.1|900360_901287_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.3	9.7e-16
WP_048349542.1|901283_902054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003828120.1|902055_902760_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	9.6e-24
WP_003828119.1|902785_903478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080515122.1|903986_905147_+|transposase	IS256-like element ISBlo16 family transposase	transposase	NA	NA	NA	NA
WP_038425912.1|905486_906002_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_014169	Bifidobacterium longum subsp. longum JDM301, complete sequence	2477838	2270899	2359419	2477838	integrase,tRNA,transposase	Bacillus_phage(25.0%)	57	2301381:2301397	2359672:2359688
WP_013141415.1|2270899_2271955_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH95	Gordonia_phage	27.1	9.4e-07
WP_038425874.1|2271951_2272917_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013140282.1|2272913_2274116_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_148217417.1|2274246_2275314_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	26.9	1.3e-08
WP_013141418.1|2276053_2277010_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_038841046.1|2277020_2278595_-	MFS transporter	NA	NA	NA	NA	NA
WP_013141420.1|2278631_2280992_-	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_038426200.1|2281057_2282428_-	glycoside hydrolase family 27 protein	NA	NA	NA	NA	NA
WP_013141422.1|2282732_2283803_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013141423.1|2283911_2284949_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_013141424.1|2285159_2285903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141425.1|2285931_2288088_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_013141426.1|2288134_2290198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141427.1|2290220_2291291_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_013141428.1|2291338_2292253_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_080515236.1|2292301_2295052_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_013141430.1|2295195_2296158_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_038426201.1|2296185_2297154_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013141432.1|2297227_2298844_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_148217418.1|2299154_2300270_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013141434.1|2300274_2300955_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_013141435.1|2301032_2302820_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.3	1.8e-13
2301381:2301397	attL	GTACCCGTCGGGCAGTT	NA	NA	NA	NA
WP_038426043.1|2302830_2304741_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.1e-48
WP_013141437.1|2305182_2306580_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013141439.1|2307440_2308421_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_025301488.1|2308541_2309375_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013141440.1|2309420_2310380_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013141441.1|2310542_2311790_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013141442.1|2312066_2313113_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_050569365.1|2313388_2315500_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_013141444.1|2315574_2316945_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_038426044.1|2317266_2318688_+	MFS transporter	NA	NA	NA	NA	NA
WP_013141446.1|2319057_2320791_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_013141447.1|2320822_2322961_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	1.8e-17
WP_038426205.1|2322978_2323929_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013141449.1|2324001_2324985_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013141450.1|2325278_2326808_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	30.9	6.4e-65
WP_038426045.1|2327084_2328170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141452.1|2328635_2328932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013141453.1|2329349_2331215_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	29.6	1.2e-65
WP_038426046.1|2331580_2332228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141455.1|2332224_2332596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013141456.1|2332622_2333633_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	36.7	6.6e-42
WP_013141458.1|2334179_2335598_-	MFS transporter	NA	NA	NA	NA	NA
WP_038426048.1|2335752_2336799_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_013141459.1|2336937_2338767_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	7.2e-47
WP_013141460.1|2338981_2340853_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.0e-32
WP_007052942.1|2341039_2341561_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007055052.1|2341922_2342486_+	hypothetical protein	NA	A0A2H4J297	uncultured_Caudovirales_phage	42.3	5.0e-23
WP_013141462.1|2342981_2346818_-	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013141463.1|2347029_2351571_-	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013141464.1|2351874_2353371_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_013141465.1|2353710_2355234_-	amino acid permease	NA	NA	NA	NA	NA
WP_013141466.1|2355559_2356765_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_187287445.1|2356956_2357478_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_050749730.1|2357648_2357975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080515312.1|2358108_2359419_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	23.0	8.1e-08
2359672:2359688	attR	AACTGCCCGACGGGTAC	NA	NA	NA	NA
