The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	764561	824283	3384766	tRNA,transposase,protease	Synechococcus_phage(29.41%)	48	NA	NA
WP_013074828.1|764561_765410_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_013074829.1|765409_767497_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_174260405.1|767654_768293_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_013074831.1|768312_769125_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_013074832.1|769121_771764_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	41.6	8.2e-92
WP_013074833.1|772133_774002_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.7	2.4e-66
WP_013074834.1|774001_775141_+	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.6	5.3e-40
WP_013074836.1|775290_776430_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_013074837.1|776521_778486_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	4.1e-80
WP_052300533.1|778646_779144_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013074838.1|779178_780294_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_052300535.1|781673_781961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013074841.1|783553_785260_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013074843.1|786471_786687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052300708.1|787355_788684_+	MFS transporter	NA	NA	NA	NA	NA
WP_052300536.1|788861_789710_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_013074846.1|790309_790606_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083780019.1|791490_791628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013074848.1|791939_792338_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013074849.1|792330_792639_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_083780021.1|793364_793649_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.3	8.1e-06
WP_013074851.1|793812_796818_-	MBL fold/beta-CASP domain-containing RNA metallo-hydrolase	NA	NA	NA	NA	NA
WP_013074852.1|797115_797946_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A1V0SCZ1	Indivirus	25.0	2.0e-12
WP_013074853.1|798066_798561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123809387.1|799071_800634_+	spore germination protein	NA	NA	NA	NA	NA
WP_013074855.1|800581_801712_+	endospore germination permease	NA	NA	NA	NA	NA
WP_052300537.1|801674_803039_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_013074857.1|803104_803314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174260406.1|803560_804055_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	6.5e-19
WP_013074859.1|804109_805426_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.1e-20
WP_013074860.1|805455_806166_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F226	Synechococcus_phage	44.1	1.1e-46
WP_013074861.1|806166_806421_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	36.6	2.9e-07
WP_013074862.1|806423_807104_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_083780294.1|807156_809508_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	45.4	8.7e-154
WP_013074864.1|809504_810992_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.8	5.7e-58
WP_013074865.1|810988_812149_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	43.5	3.6e-60
WP_013074866.1|812145_812796_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.8	1.7e-27
WP_013074867.1|812861_814400_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.0	1.7e-73
WP_013074868.1|814422_815751_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_169307932.1|815847_816825_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_041304936.1|817125_818352_+	MFS transporter	NA	NA	NA	NA	NA
WP_013074871.1|818503_819145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013074872.1|819422_820346_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.5	8.6e-81
WP_123809224.1|820452_820854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083780024.1|820959_821841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013074874.1|821859_822171_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_013074875.1|822236_822893_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	47.4	1.7e-46
WP_013074876.1|822954_824283_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	847831	906431	3384766	transposase	Tupanvirus(16.67%)	56	NA	NA
WP_013074898.1|847831_849124_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_169307992.1|849350_849917_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_013074900.1|850182_851064_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	34.5	2.4e-24
WP_013074901.1|851330_852314_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	33.4	6.6e-47
WP_013074902.1|852395_853418_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013074903.1|853860_854109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169307933.1|854441_854720_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013074904.1|855017_856040_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	46.6	2.3e-74
WP_013074905.1|856036_856897_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_013074906.1|856902_857469_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_013074907.1|857481_858375_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	57.5	1.4e-91
WP_013074908.1|858413_859388_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013074909.1|859368_860430_+	glycosyltransferase family 4 protein	NA	A0A0F7L8V0	uncultured_marine_virus	25.5	5.2e-05
WP_052300544.1|860688_861549_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_041303706.1|861559_862633_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_123809389.1|863258_864197_+	class I SAM-dependent methyltransferase	NA	A0A0E3FM84	Synechococcus_phage	30.1	1.5e-08
WP_123809390.1|865298_867215_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013074912.1|867276_868050_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041303710.1|868046_868796_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.5e-14
WP_013074914.1|869266_870538_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_052300710.1|870758_871721_+	SDR family oxidoreductase	NA	A0A1V0SKV4	Klosneuvirus	36.8	5.9e-48
WP_041304970.1|871847_873719_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	27.9	2.2e-22
WP_169307934.1|873814_874867_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013074918.1|874968_875595_+	sugar transferase	NA	NA	NA	NA	NA
WP_169307935.1|875647_876289_+	NeuD/PglB/VioB family sugar acetyltransferase	NA	NA	NA	NA	NA
WP_013074920.1|876278_877406_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.7	1.9e-37
WP_013074922.1|877821_878205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013074924.1|878405_879482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013074925.1|879941_881150_+	spore photoproduct lyase	NA	NA	NA	NA	NA
WP_013074926.1|881146_883102_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_013074928.1|883412_883649_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_013074929.1|883645_884032_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_013074930.1|884426_885434_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_013074931.1|885447_885786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013074932.1|885865_886750_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_013074933.1|886774_887740_-	asparaginase	NA	NA	NA	NA	NA
WP_013074934.1|887847_889587_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_013074935.1|889832_891170_+	MFS transporter	NA	NA	NA	NA	NA
WP_083780029.1|891691_891985_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169307936.1|891981_892482_-	Fic family protein	NA	NA	NA	NA	NA
WP_169307937.1|892473_892686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013074936.1|892776_893148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013074937.1|893172_894159_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_174260407.1|894312_894729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083780031.1|894682_895009_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_013074939.1|894974_895310_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013074940.1|895891_896110_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_123809391.1|896143_896623_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1L2JY34	Aeribacillus_phage	48.5	2.5e-31
WP_169307938.1|897012_897153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013074942.1|897643_899059_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_013074943.1|899055_899964_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_013074944.1|900587_901784_+	amidohydrolase	NA	NA	NA	NA	NA
WP_013074945.1|901873_902131_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013074946.1|902803_904039_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.6	9.2e-62
WP_123809227.1|904456_904726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013074942.1|905015_906431_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 3
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	1300538	1307366	3384766	transposase	Streptococcus_phage(33.33%)	10	NA	NA
WP_013075306.1|1300538_1301288_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	1.9e-14
WP_013075307.1|1301393_1302140_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_013075308.1|1302355_1302895_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_041305171.1|1302960_1303419_+	redoxin domain-containing protein	NA	A0A127AW88	Bacillus_phage	31.7	8.7e-18
WP_083780067.1|1303630_1303954_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	51.7	2.6e-24
WP_013075310.1|1303916_1304987_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	39.4	1.6e-54
WP_083780068.1|1305122_1305422_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_013075311.1|1305575_1305983_+	recombinase family protein	NA	A0A7Q0	Microcystis_virus	40.4	8.9e-06
WP_123809405.1|1306005_1306230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013075313.1|1306439_1307366_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	52.9	1.9e-83
>prophage 4
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	1357701	1411881	3384766	transposase	Streptococcus_phage(28.57%)	40	NA	NA
WP_013075361.1|1357701_1358136_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.2	1.2e-45
WP_013075362.1|1359508_1360891_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_123809251.1|1361458_1361743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013075363.1|1361739_1362093_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013075364.1|1362281_1364036_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	44.1	1.2e-126
WP_013075365.1|1364175_1364481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013075367.1|1365579_1366380_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013075369.1|1373639_1374743_-	endospore germination permease	NA	NA	NA	NA	NA
WP_013075370.1|1375504_1376773_+	type III-B CRISPR module RAMP protein Cmr1	NA	NA	NA	NA	NA
WP_013075371.1|1376769_1378593_+	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_013075372.1|1378589_1379771_+	type III-B CRISPR module-associated protein Cmr3	NA	NA	NA	NA	NA
WP_013075373.1|1379794_1380685_+	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_013075374.1|1380690_1381059_+	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_013075375.1|1381064_1381898_+	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_013075376.1|1381894_1383169_+	TIGR02221 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_013075377.1|1383151_1383298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013075378.1|1383407_1384607_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	48.0	6.5e-97
WP_013075379.1|1384794_1385706_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_013075380.1|1385820_1387191_-	APC family permease	NA	NA	NA	NA	NA
WP_041305218.1|1387257_1388625_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_052300723.1|1388978_1389950_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_052300724.1|1390301_1391474_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041305224.1|1391519_1392479_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_174260409.1|1392493_1393843_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013075386.1|1393839_1394610_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	24.3	4.4e-06
WP_013075387.1|1394661_1395369_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.7	1.5e-13
WP_013075388.1|1395584_1396892_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_013075389.1|1396913_1399739_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_013075390.1|1400513_1401731_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	31.4	1.6e-50
WP_013075391.1|1403547_1404111_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_013075392.1|1404358_1405030_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013075393.1|1405053_1406085_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013075394.1|1406104_1406752_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_013075395.1|1406816_1407473_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_041305228.1|1407475_1407904_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_013075397.1|1407900_1408500_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_013075398.1|1408512_1408821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041303877.1|1409059_1409401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013075400.1|1409834_1411163_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013075401.1|1411224_1411881_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	47.9	4.4e-47
>prophage 5
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	1623202	1685646	3384766	coat,tRNA,transposase	Microcystis_virus(20.0%)	55	NA	NA
WP_013075608.1|1623202_1623730_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_013075609.1|1623766_1625098_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_013075610.1|1625104_1626472_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_013075611.1|1626541_1627978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013075612.1|1628005_1629337_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_013075613.1|1629333_1630461_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_013075614.1|1630369_1631365_-	phospholipase D/transphosphatidylase	NA	NA	NA	NA	NA
WP_013075615.1|1631625_1631994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013074943.1|1632276_1633185_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_013075616.1|1633181_1634597_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_013075617.1|1634880_1636335_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_013075618.1|1636331_1636763_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_041305376.1|1636894_1639519_+	DNA mismatch repair protein MutS	NA	A0A2P0VN50	Tetraselmis_virus	23.1	2.3e-38
WP_013075620.1|1639515_1641501_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.9	1.4e-64
WP_013075621.1|1641513_1642317_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013075622.1|1642313_1643249_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_013075623.1|1643291_1643576_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_013075624.1|1643602_1645213_+	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_013075625.1|1645438_1645801_+	DUF3870 domain-containing protein	NA	NA	NA	NA	NA
WP_052300584.1|1645968_1646766_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013075626.1|1646956_1647826_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_052300585.1|1647867_1648863_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013075628.1|1648832_1650383_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	7.8e-18
WP_013075629.1|1650562_1651558_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013075630.1|1651584_1652217_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_013075631.1|1652213_1653227_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013075632.1|1653269_1654427_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_013075633.1|1654522_1655311_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_123809416.1|1655531_1656485_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	37.5	7.6e-48
WP_013075635.1|1656481_1657099_+	GTPase domain-containing protein	NA	NA	NA	NA	NA
WP_052300735.1|1657209_1658505_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_013075637.1|1658642_1659062_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	37.1	2.0e-05
WP_013075638.1|1659139_1660480_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_041303961.1|1661058_1661673_-	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	34.9	1.7e-16
WP_169307952.1|1662474_1662882_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013075642.1|1662997_1663603_-	DsbA family protein	NA	NA	NA	NA	NA
WP_013075643.1|1664637_1666011_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013075644.1|1666030_1666753_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	39.3	2.5e-27
WP_013075645.1|1666755_1667283_-	DUF542 domain-containing protein	NA	NA	NA	NA	NA
WP_013075646.1|1667413_1668175_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_013075647.1|1668212_1668842_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_013075648.1|1668834_1670337_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.8	6.6e-22
WP_013075649.1|1670326_1674013_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_013075650.1|1674017_1674290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013075651.1|1674286_1674748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013075652.1|1674823_1676026_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_013075653.1|1676374_1677488_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.1	1.5e-23
WP_013075654.1|1677761_1678016_-	nitrogen fixation protein NifZ	NA	NA	NA	NA	NA
WP_013075655.1|1678720_1680031_-	amino acid permease	NA	NA	NA	NA	NA
WP_013075656.1|1680054_1680678_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013075657.1|1680674_1681454_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.5	7.4e-17
WP_013075658.1|1681476_1681899_-	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
WP_013075659.1|1681933_1682608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013075660.1|1683242_1684646_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_052300587.1|1684905_1685646_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	1831897	1839085	3384766	protease	Staphylococcus_phage(66.67%)	8	NA	NA
WP_123809272.1|1831897_1832530_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	39.4	6.6e-16
WP_013075807.1|1832456_1833215_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_013075808.1|1833240_1833876_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013075809.1|1833859_1834366_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	62.0	6.0e-36
WP_013075810.1|1834440_1835637_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.2	1.5e-114
WP_013075811.1|1835694_1836297_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	5.1e-34
WP_041304020.1|1836303_1837425_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.5	9.5e-50
WP_013075813.1|1837873_1839085_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.7	6.5e-36
>prophage 7
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	2108239	2132630	3384766	integrase,transposase	Saccharomonospora_phage(25.0%)	24	2129943:2129959	2139794:2139810
WP_169307966.1|2108239_2108644_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013076076.1|2108678_2109419_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013076077.1|2109415_2109649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013076078.1|2109686_2110988_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	I4AZM3	Saccharomonospora_phage	37.7	7.9e-40
WP_013076079.1|2110984_2111563_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	40.9	3.3e-30
WP_013076080.1|2111605_2112049_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013076081.1|2112501_2114883_-	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_083780166.1|2116011_2116095_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013076083.1|2116234_2117314_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_052300611.1|2119088_2119244_+	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_123809288.1|2119393_2119714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013074454.1|2119814_2120927_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.1	1.5e-23
WP_013076085.1|2121079_2122618_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013076086.1|2122756_2123068_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_013076087.1|2123253_2124699_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_013076088.1|2124688_2125069_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013076089.1|2125180_2125849_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_013076090.1|2126408_2127410_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_083780312.1|2127546_2128425_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041304156.1|2128653_2128923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013076092.1|2129175_2129823_+	tellurium resistance protein TerC	NA	NA	NA	NA	NA
WP_169307967.1|2129891_2130065_-	hypothetical protein	NA	NA	NA	NA	NA
2129943:2129959	attL	TCGATCCCGCCGGGCTT	NA	NA	NA	NA
WP_013075662.1|2130628_2131510_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	34.7	1.6e-36
WP_013075663.1|2131502_2132630_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2139794:2139810	attR	TCGATCCCGCCGGGCTT	NA	NA	NA	NA
>prophage 8
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	2768764	2874571	3384766	integrase,tRNA,transposase	Streptococcus_phage(13.33%)	79	2815734:2815756	2823934:2823956
WP_013076653.1|2768764_2770000_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.6	9.2e-62
WP_013076654.1|2779064_2779328_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_013076655.1|2779520_2780516_-	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_013076656.1|2780533_2781037_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_013076657.1|2781076_2783497_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_013076658.1|2783490_2784195_-	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_013076659.1|2784210_2785188_-	type I CRISPR-associated protein Cas7	NA	NA	NA	NA	NA
WP_013076660.1|2785266_2787369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013076661.1|2787337_2788159_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_041306123.1|2788541_2789279_-	NAD-dependent deacylase	NA	A0A068EPD4	Bacillus_phage	34.7	9.4e-38
WP_013076663.1|2789599_2790064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041304350.1|2790341_2791583_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013076665.1|2791579_2794711_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	28.5	7.1e-119
WP_041304351.1|2794795_2795371_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013076667.1|2795982_2797242_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013076668.1|2797238_2798036_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	1.3e-21
WP_013076669.1|2798032_2799196_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041304353.1|2799356_2805308_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_123809325.1|2805522_2806353_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	2.6e-20
WP_013076672.1|2806349_2807126_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_052300766.1|2807154_2808024_-	EamA family transporter	NA	NA	NA	NA	NA
WP_052300644.1|2808134_2809523_-	amino acid permease	NA	NA	NA	NA	NA
WP_123809451.1|2809694_2810876_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013076676.1|2810957_2812304_-	amidase	NA	NA	NA	NA	NA
WP_013076677.1|2812537_2813839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083780215.1|2814061_2814358_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.2	1.8e-11
WP_013075663.1|2814350_2815478_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2815734:2815756	attL	ATTATGGGGAGCTGCAGGTTATG	NA	NA	NA	NA
WP_013076678.1|2815876_2817118_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013076679.1|2817104_2818085_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_052300645.1|2818081_2818651_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013076653.1|2818813_2820049_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.6	9.2e-62
WP_083780216.1|2820668_2821109_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013076680.1|2821293_2822709_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_013076681.1|2822705_2823614_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_013076683.1|2824298_2825540_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	32.8	8.9e-49
2823934:2823956	attR	CATAACCTGCAGCTCCCCATAAT	NA	NA	NA	NA
WP_013076684.1|2825624_2826161_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013076685.1|2826493_2827786_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013076686.1|2828246_2828969_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	7.6e-16
WP_013076687.1|2829070_2829826_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_123809326.1|2830081_2830504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013076689.1|2830524_2831259_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_052300767.1|2831687_2833079_-	dipeptidase	NA	NA	NA	NA	NA
WP_013076691.1|2833197_2833593_+	cytochrome c	NA	NA	NA	NA	NA
WP_013076692.1|2833961_2834687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013076693.1|2834973_2835444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041304357.1|2835462_2835807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083780325.1|2835930_2836608_+	XdhC family protein	NA	NA	NA	NA	NA
WP_013076696.1|2836707_2837064_+	carbon monoxide dehydrogenase subunit G	NA	NA	NA	NA	NA
WP_013076697.1|2837082_2837943_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_013076698.1|2837930_2839058_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_041306158.1|2839074_2840124_-	XdhC family protein	NA	NA	NA	NA	NA
WP_013076700.1|2840368_2840881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013076702.1|2841233_2841779_-	helix-turn-helix transcriptional regulator	NA	A0A0R8VBU2	Thermobifida_phage	40.4	7.7e-05
WP_041306161.1|2841975_2842743_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	3.3e-17
WP_013076704.1|2842820_2843810_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.9e-19
WP_013076705.1|2843824_2844697_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013076706.1|2844702_2845707_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_052300768.1|2845766_2847362_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_148224906.1|2847414_2848521_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_013076709.1|2849019_2850681_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	22.9	2.1e-13
WP_041306168.1|2850797_2852156_-	MFS transporter	NA	NA	NA	NA	NA
WP_041304361.1|2852416_2853913_-	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_123809327.1|2854304_2855162_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013076712.1|2856189_2857491_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013076713.1|2857933_2859592_-	mercury(II) reductase	NA	NA	NA	NA	NA
WP_013076714.1|2859891_2861274_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_052300647.1|2861470_2861833_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041306171.1|2861987_2862710_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	38.7	8.1e-26
WP_013076717.1|2862729_2864103_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013076718.1|2864767_2866213_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_041304366.1|2866202_2866583_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013076720.1|2866694_2867363_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_174260413.1|2867436_2867985_+	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_013076722.1|2868072_2868450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013076723.1|2868718_2870305_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	30.5	7.4e-64
WP_013076724.1|2870471_2871242_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013076725.1|2871373_2872801_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_013076726.1|2872790_2874275_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_013076727.1|2874280_2874571_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 9
NC_014098	Kyrpidia tusciae DSM 2912, complete sequence	3384766	2899987	2922552	3384766	transposase,protease	Bacillus_phage(66.67%)	17	NA	NA
WP_013076753.1|2899987_2901205_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.9	1.1e-96
WP_013076755.1|2905119_2905338_-	mersacidin/lichenicidin family type 2 lantibiotic	NA	NA	NA	NA	NA
WP_013076756.1|2905408_2905681_-	mersacidin family lantibiotic	NA	NA	NA	NA	NA
WP_083780220.1|2905705_2905936_-	mersacidin/lichenicidin family type 2 lantibiotic	NA	NA	NA	NA	NA
WP_169307983.1|2906065_2906545_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_041304376.1|2906560_2906833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013076757.1|2906877_2907483_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013076758.1|2907594_2908359_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013076759.1|2908355_2911700_-	type 2 lantipeptide synthetase LanM family protein	NA	NA	NA	NA	NA
WP_013076760.1|2911727_2913473_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.1	3.8e-21
WP_013076761.1|2913469_2916106_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	39.3	2.8e-23
WP_041306218.1|2916102_2916339_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013076763.1|2916832_2917291_-	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_013076764.1|2917448_2918651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013076765.1|2918776_2919031_-	mersacidin family lantibiotic	NA	NA	NA	NA	NA
WP_013076766.1|2919149_2920373_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013076767.1|2921223_2922552_+|transposase	transposase	transposase	NA	NA	NA	NA
