The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018290	Phaeobacter inhibens DSM 17395, complete sequence	3821831	1822911	1926725	3821831	plate,tRNA,head,tail,protease,terminase,capsid,portal,transposase	Escherichia_phage(33.33%)	101	NA	NA
WP_014880135.1|1822911_1823982_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_014880136.1|1824085_1827802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014874841.1|1827902_1828364_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_014880137.1|1828505_1829387_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_014874843.1|1829790_1831122_+	peptidoglycan DD-metalloendopeptidase family protein	NA	S5M424	Bacillus_phage	44.3	1.1e-17
WP_014880138.1|1831111_1831654_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_014880139.1|1831914_1833159_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_014880140.1|1833400_1834897_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_162894608.1|1834984_1835920_-	DUF3179 domain-containing protein	NA	NA	NA	NA	NA
WP_014874848.1|1836206_1836758_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	57.7	2.0e-40
WP_014874849.1|1836750_1837257_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.0	9.6e-42
WP_014880142.1|1837438_1838629_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_014880143.1|1838885_1839185_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_014880144.1|1839487_1840501_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_014880145.1|1840517_1841903_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_014880146.1|1841915_1843241_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_123585424.1|1843539_1845033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880150.1|1845889_1847011_-	alanine/ornithine racemase family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014880151.1|1847007_1848198_-	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_014880152.1|1848289_1848979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880153.1|1849034_1849388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044041496.1|1849433_1849700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880155.1|1850228_1850417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027246852.1|1850474_1851209_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014880157.1|1851359_1851596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880158.1|1852046_1852862_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_014880159.1|1853154_1853451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880160.1|1853463_1857432_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	37.4	8.7e-223
WP_044041499.1|1857431_1857902_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.4	5.6e-28
WP_014880162.1|1857898_1858849_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	36.1	1.5e-51
WP_014880163.1|1858848_1859481_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	49.5	4.5e-57
WP_014880164.1|1859496_1860153_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	33.5	1.5e-10
WP_014880165.1|1860145_1860403_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_014880166.1|1860399_1860804_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_014880167.1|1860817_1861231_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_014874866.1|1861332_1861740_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014880168.1|1861736_1862108_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_044041730.1|1862104_1862749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880170.1|1862931_1864116_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	39.3	5.7e-61
WP_014880171.1|1864164_1864782_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	53.3	4.9e-32
WP_014874871.1|1864817_1865036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880172.1|1865028_1866222_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.9	8.3e-60
WP_014880173.1|1866415_1867708_-	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	41.9	9.2e-73
WP_014880174.1|1867679_1868021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880175.1|1868312_1869467_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_014880176.1|1869466_1870732_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014880177.1|1870990_1872004_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_014874878.1|1872237_1872981_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
WP_005982462.1|1873145_1873379_-	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	52.1	7.3e-05
WP_014880178.1|1874014_1874752_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_014880179.1|1874838_1875771_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_014880180.1|1875956_1877261_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_014878821.1|1877566_1878601_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014880181.1|1879182_1880067_-	EamA family transporter	NA	NA	NA	NA	NA
WP_014880182.1|1880066_1880405_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_014880183.1|1880416_1881481_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_081497205.1|1881493_1882414_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014880184.1|1882527_1884057_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014878829.1|1884046_1884838_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.1	6.3e-32
WP_014880186.1|1885784_1886387_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_014874883.1|1886621_1887197_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_014880187.1|1887422_1888019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014874885.1|1888653_1889007_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005982441.1|1889035_1889263_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_014874886.1|1889275_1889893_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_027247172.1|1890122_1890305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014874887.1|1890618_1891089_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_014880189.1|1891238_1893197_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_014880190.1|1893495_1894764_+	hypothetical protein	NA	M4SNJ8	Pseudoalteromonas_phage	25.9	3.6e-05
WP_014874890.1|1894976_1896308_-	trigger factor	NA	NA	NA	NA	NA
WP_014880191.1|1896579_1897710_-	porin	NA	NA	NA	NA	NA
WP_014880192.1|1898115_1900320_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.1	1.7e-13
WP_014880193.1|1901089_1901506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880194.1|1902186_1905153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044041508.1|1905560_1906559_-	late control protein D	NA	A0A088FRU7	Escherichia_phage	44.4	1.3e-71
WP_014880196.1|1906558_1906780_-|tail	tail protein X	tail	A0A1W6JT40	Escherichia_phage	54.5	3.7e-14
WP_014880197.1|1906748_1907159_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	54.5	1.2e-31
WP_014880198.1|1907158_1909654_-|tail	phage tail tape measure protein	tail	A0A0U2BXT9	Paracoccus_phage	27.1	6.2e-17
WP_014880199.1|1909768_1910062_-|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	54.4	2.0e-07
WP_014880200.1|1910071_1910578_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.6	2.9e-46
WP_014880201.1|1910577_1911795_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	55.1	1.1e-136
WP_014880202.1|1911861_1912311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880203.1|1912311_1912722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880204.1|1912746_1913904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880205.1|1913903_1914461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102804109.1|1914453_1915068_-|tail	phage tail protein I	tail	A0A088FVH1	Escherichia_phage	38.7	7.6e-25
WP_014880207.1|1915048_1915948_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	56.8	1.2e-84
WP_027247866.1|1915947_1916286_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	66.7	9.9e-35
WP_044041510.1|1916335_1916626_-	PAAR domain-containing protein	NA	K4ICQ1	Acidithiobacillus_phage	58.6	1.1e-23
WP_014880209.1|1916625_1917051_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_014880210.1|1917047_1917581_-	hypothetical protein	NA	D5LGZ6	Escherichia_phage	47.5	3.1e-35
WP_014880211.1|1917584_1918136_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	44.1	1.8e-33
WP_014880212.1|1918138_1918450_-	hypothetical protein	NA	V5YTH3	Pseudomonas_phage	48.1	4.0e-22
WP_014880213.1|1918449_1918680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102804132.1|1918754_1920752_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	49.6	3.3e-170
WP_052309653.1|1920777_1922373_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.8	1.2e-133
WP_102804133.1|1922369_1922879_-	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	45.5	7.4e-34
WP_014880217.1|1922909_1924859_-|terminase	phage terminase large subunit family protein	terminase	D5LH04	Escherichia_phage	62.8	1.2e-222
WP_044041513.1|1924855_1925443_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	49.1	1.2e-35
WP_014880219.1|1925595_1925973_-	bacteriophage spanin2 family protein	NA	NA	NA	NA	NA
WP_014880220.1|1925972_1926725_-	hypothetical protein	NA	L7TMU6	Rhizobium_phage	35.8	2.4e-20
>prophage 2
NC_018290	Phaeobacter inhibens DSM 17395, complete sequence	3821831	2283551	2342780	3821831	head,tRNA,integrase,tail,protease,capsid,lysis,portal	Paracoccus_phage(15.38%)	58	2303063:2303084	2342908:2342929
WP_014880501.1|2283551_2284469_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_014880502.1|2284491_2285688_+	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_014880503.1|2285774_2286659_+	DUF2927 domain-containing protein	NA	NA	NA	NA	NA
WP_014880504.1|2286714_2287893_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_014880505.1|2287979_2288507_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_014880506.1|2288516_2289668_+	TFIIB-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_014880507.1|2289723_2290395_+	nitroreductase	NA	NA	NA	NA	NA
WP_014880508.1|2290423_2290870_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014880509.1|2291326_2292913_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014880510.1|2292927_2293884_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014880511.1|2293880_2294696_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014880512.1|2294692_2296330_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.2e-22
WP_014880513.1|2296455_2297292_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_014880514.1|2297348_2297912_+	DUF4453 domain-containing protein	NA	NA	NA	NA	NA
WP_014880515.1|2297920_2298847_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014880516.1|2298986_2300882_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.9	2.0e-23
WP_014880517.1|2301063_2302863_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.0	5.1e-61
2303063:2303084	attL	CTGGAGCGGGTAGCGGGAATCG	NA	NA	NA	NA
WP_014880518.1|2303615_2304308_+	SOS response-associated peptidase	NA	B7SYF4	Stenotrophomonas_phage	35.4	1.6e-18
WP_081497206.1|2304570_2304969_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_014880520.1|2305923_2306535_-	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_014880521.1|2307307_2311108_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_014880522.1|2311614_2311917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880523.1|2311913_2312579_-	peptidoglycan-binding protein	NA	A0A023NGR5	Dinoroseobacter_phage	39.9	7.4e-34
WP_014880524.1|2312768_2313146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102804115.1|2313155_2313521_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_014880526.1|2313480_2313954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880527.1|2313955_2314681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880528.1|2314680_2315016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880529.1|2315026_2315449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880530.1|2315448_2316333_-	hypothetical protein	NA	A0A2I7RQ81	Vibrio_phage	25.2	6.4e-17
WP_044041569.1|2316329_2320742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081497221.1|2320942_2321245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880533.1|2321382_2321853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880534.1|2321940_2322387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880535.1|2322451_2322787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880536.1|2323186_2323642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880537.1|2323658_2324015_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_014880538.1|2324011_2324617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044041574.1|2324631_2324922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880539.1|2324992_2326195_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	53.5	1.4e-107
WP_014880540.1|2326231_2326894_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	56.0	3.0e-59
WP_014880541.1|2326893_2328105_-|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	60.3	2.6e-138
WP_158525015.1|2328101_2329589_-	hypothetical protein	NA	Q8W631	Enterobacteria_phage	33.7	3.7e-73
WP_014880543.1|2329864_2330323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880544.1|2330913_2331669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880545.1|2331665_2332250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102804140.1|2332435_2333059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044041579.1|2333072_2333429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880547.1|2333428_2333863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102804141.1|2334518_2334719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081497207.1|2335050_2335470_+	helix-turn-helix transcriptional regulator	NA	A0A2L0V128	Agrobacterium_phage	48.3	1.4e-14
WP_044041581.1|2335627_2336398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880552.1|2337484_2337754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123585428.1|2337750_2338038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880553.1|2338135_2339272_+	DNA polymerase III subunit beta-like protein	NA	A0A0A8IL17	Aurantimonas_phage	30.5	5.2e-27
WP_014880554.1|2339336_2339564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880555.1|2339628_2341341_+	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	40.5	2.9e-90
WP_014880556.1|2341532_2342780_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2342908:2342929	attR	CTGGAGCGGGTAGCGGGAATCG	NA	NA	NA	NA
>prophage 3
NC_018290	Phaeobacter inhibens DSM 17395, complete sequence	3821831	2618105	2697312	3821831	head,integrase,holin,protease,portal,transposase	Tupanvirus(16.67%)	59	2694246:2694264	2697947:2697965
WP_014875419.1|2618105_2620427_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	4.5e-171
WP_014880760.1|2620431_2621397_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_014880761.1|2621597_2622182_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_014880762.1|2622192_2624160_-	peptidoglycan -binding protein	NA	NA	NA	NA	NA
WP_014880763.1|2624163_2625345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880764.1|2625422_2625953_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_014880765.1|2626017_2627022_+	DUF2125 domain-containing protein	NA	NA	NA	NA	NA
WP_014880766.1|2627018_2627882_-	extensin family protein	NA	NA	NA	NA	NA
WP_014880767.1|2627878_2628799_-	prephenate/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014880768.1|2628795_2629881_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.0	9.3e-18
WP_014875429.1|2630037_2630499_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_081497225.1|2630541_2631114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014875431.1|2631320_2631941_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_014880770.1|2632188_2633265_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_014880771.1|2633664_2635398_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	30.7	2.2e-29
WP_014880772.1|2635429_2636593_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_014880773.1|2636596_2638114_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014880774.1|2638148_2640224_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_014880775.1|2640305_2641172_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_014880776.1|2641277_2641889_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014880777.1|2642022_2643228_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_158525016.1|2643285_2643414_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_014878828.1|2643514_2645044_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014878829.1|2645033_2645825_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.1	6.3e-32
WP_102804144.1|2646851_2647757_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014880780.1|2647853_2649380_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	23.1	1.4e-14
WP_014880781.1|2649415_2651083_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014880782.1|2651188_2652595_+	amidase	NA	NA	NA	NA	NA
WP_044041608.1|2652842_2653166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880783.1|2653527_2654793_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_044041609.1|2654796_2655465_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_014880785.1|2655509_2656715_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	26.9	5.1e-17
WP_014880786.1|2656717_2657731_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_014880787.1|2657639_2658725_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014880788.1|2658732_2661168_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044041610.1|2661357_2662881_+	trimethylamine methyltransferase family protein	NA	NA	NA	NA	NA
WP_014880790.1|2662902_2663877_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014880791.1|2664069_2665032_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014880792.1|2665111_2666143_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_086002976.1|2666146_2667202_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.1	1.1e-26
WP_014880794.1|2667757_2668324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880795.1|2668320_2668767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880796.1|2668965_2669178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014880797.1|2669178_2670855_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	32.1	6.2e-61
WP_014880798.1|2677152_2679198_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_027246464.1|2679348_2680242_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014880800.1|2680337_2680619_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_014880801.1|2680880_2683655_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_014880802.1|2683658_2685389_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_014880803.1|2685440_2686418_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014875486.1|2686511_2687057_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_014880804.1|2688069_2689935_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	3.7e-14
WP_014880805.1|2690420_2691644_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_014880806.1|2691967_2693485_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	23.2	5.5e-24
WP_014880807.1|2693672_2694152_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
2694246:2694264	attL	GTCCTTCAGGGATCGCCAG	NA	NA	NA	NA
WP_014880808.1|2694271_2695384_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014880809.1|2695380_2695581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014880810.1|2695570_2696788_-|portal	phage portal protein	portal	A0A142K630	Streptomyces_phage	34.6	9.0e-54
WP_044041793.1|2696784_2697312_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	46.5	1.4e-24
2697947:2697965	attR	GTCCTTCAGGGATCGCCAG	NA	NA	NA	NA
