The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015730	Roseobacter litoralis Och 149, complete sequence	4505211	1116449	1173504	4505211	transposase,integrase,lysis,protease,tRNA	Burkholderia_phage(16.67%)	49	1129371:1129397	1133176:1133202
WP_044025215.1|1116449_1117442_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_044025216.1|1117494_1117995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013961023.1|1118255_1119233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044025217.1|1119229_1119835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044025546.1|1120303_1120915_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	42.6	1.9e-36
WP_013961027.1|1121096_1121687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013961028.1|1121840_1123055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013961029.1|1123054_1124629_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_013961030.1|1124792_1125845_-	Fic family protein	NA	NA	NA	NA	NA
WP_044025547.1|1126300_1126807_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_013961032.1|1126818_1127235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013961033.1|1127267_1127588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085977359.1|1127678_1128774_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.7	4.0e-53
WP_013961036.1|1128777_1129437_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
1129371:1129397	attL	TTATCATGAGAACGGCATAATGCGGAG	NA	NA	NA	NA
WP_013961037.1|1129514_1130753_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013961038.1|1130749_1132114_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_044025218.1|1132107_1133109_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	37.6	3.7e-05
WP_013961040.1|1133193_1133436_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
1133176:1133202	attR	CTCCGCATTATGCCGTTCTCATGATAA	NA	NA	NA	NA
WP_013961042.1|1133987_1134302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013961043.1|1134411_1135071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013961044.1|1135285_1136584_-	relaxase/mobilization nuclease-like protein	NA	NA	NA	NA	NA
WP_013961045.1|1136590_1137019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013961046.1|1137304_1137601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013961047.1|1138026_1140735_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_013961048.1|1140959_1141949_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013961049.1|1142137_1143532_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_013961050.1|1143616_1144384_+	DUF3299 domain-containing protein	NA	NA	NA	NA	NA
WP_013961051.1|1144380_1145274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013961052.1|1145283_1146465_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_013961053.1|1146624_1147755_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_148264311.1|1147805_1149119_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_044025221.1|1151407_1152907_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_158308139.1|1153227_1153392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013961059.1|1153909_1155721_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	9.0e-58
WP_013961060.1|1155835_1157719_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	9.8e-23
WP_013961061.1|1157775_1158612_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_013961062.1|1158853_1160491_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	4.7e-21
WP_013961063.1|1160487_1161300_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013961064.1|1161296_1162253_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013961065.1|1162266_1163862_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013961066.1|1163979_1165971_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_044025223.1|1166024_1167137_-	DUF4147 domain-containing protein	NA	NA	NA	NA	NA
WP_013961068.1|1167167_1167614_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_013961069.1|1167657_1168764_-	TFIIB-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_013961070.1|1168760_1169186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013961071.1|1169273_1170410_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_169315065.1|1170437_1171430_-	DUF2927 domain-containing protein	NA	NA	NA	NA	NA
WP_013961073.1|1171389_1172586_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_013961074.1|1172619_1173504_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
>prophage 2
NC_015730	Roseobacter litoralis Och 149, complete sequence	4505211	1440144	1445811	4505211	portal,tail,capsid,protease,head	Geobacillus_phage(33.33%)	10	NA	NA
WP_013961336.1|1440144_1441323_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.9	1.4e-59
WP_013961337.1|1441315_1441537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013961338.1|1441571_1442129_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	53.5	1.2e-32
WP_013961339.1|1442195_1443374_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	37.4	3.2e-64
WP_013961340.1|1443532_1444126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013961341.1|1444122_1444461_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_013961342.1|1444457_1444868_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013961343.1|1444896_1445310_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_013961344.1|1445311_1445629_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_148264319.1|1445625_1445811_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
>prophage 3
NC_015730	Roseobacter litoralis Och 149, complete sequence	4505211	3650066	3770178	4505211	transposase,integrase,tail,protease,tRNA	Tupanvirus(13.33%)	100	3708806:3708822	3749185:3749201
WP_013963424.1|3650066_3650753_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_013963425.1|3650833_3651847_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013963426.1|3651971_3653072_+	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	33.3	4.5e-36
WP_013963427.1|3653086_3653665_+	nitroreductase	NA	NA	NA	NA	NA
WP_013963428.1|3653661_3654381_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_013963429.1|3654316_3654613_-	DUF1467 family protein	NA	NA	NA	NA	NA
WP_013963430.1|3654636_3655041_-	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_013963431.1|3655528_3656248_+	response regulator	NA	NA	NA	NA	NA
WP_013963432.1|3656259_3656982_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013963433.1|3657037_3658813_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044025413.1|3659170_3659800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013963436.1|3660012_3660390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963437.1|3660386_3661448_+	ferric reductase-like transmembrane domain-containing protein	NA	NA	NA	NA	NA
WP_148264499.1|3661528_3662209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963440.1|3662933_3665930_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_013963441.1|3666139_3666367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044025723.1|3666460_3667375_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148264500.1|3667612_3669988_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.3	1.8e-10
WP_013963444.1|3671989_3672295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963445.1|3672381_3672624_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_148264393.1|3672620_3673034_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_013963447.1|3673376_3673748_+	GFA family protein	NA	NA	NA	NA	NA
WP_013963448.1|3673987_3675346_-|transposase	ISKra4-like element ISRli1 family transposase	transposase	NA	NA	NA	NA
WP_013963449.1|3675531_3676164_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_148264501.1|3676497_3677520_+	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_158308131.1|3678244_3678409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013960335.1|3678401_3680486_+	recombinase family protein	NA	NA	NA	NA	NA
WP_158308166.1|3680465_3681410_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_013963452.1|3681678_3681864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013963453.1|3682418_3683798_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_083825480.1|3684940_3685243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013960335.1|3687043_3689128_-	recombinase family protein	NA	NA	NA	NA	NA
WP_158308131.1|3689120_3689285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148264394.1|3690647_3693191_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_158308131.1|3693903_3694068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013960335.1|3694060_3696145_+	recombinase family protein	NA	NA	NA	NA	NA
WP_158308166.1|3696124_3697069_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_013963460.1|3697331_3698150_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	4.8e-51
WP_044025415.1|3700174_3701137_-	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_148264395.1|3701472_3701805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963463.1|3703535_3703820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158308167.1|3703776_3703938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963464.1|3705816_3705966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083825511.1|3706008_3706311_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148264396.1|3706419_3707548_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	26.6	2.9e-14
WP_013963469.1|3708702_3709347_-	autoinducer synthetase-like protein	NA	NA	NA	NA	NA
3708806:3708822	attL	AAATGACTGTAAATCTG	NA	NA	NA	NA
WP_013963470.1|3709724_3710864_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083825482.1|3711415_3712582_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0YZU7	Pseudomonas_phage	41.2	2.6e-05
WP_044025218.1|3712575_3713577_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	37.6	3.7e-05
WP_013963471.1|3713704_3713935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963472.1|3714046_3714226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013963473.1|3714282_3714468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044025419.1|3714918_3715107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013963475.1|3715193_3715499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083825483.1|3715649_3716258_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	31.2	1.7e-13
WP_013963479.1|3719788_3720325_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_013963481.1|3720727_3722017_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.9	1.3e-98
WP_044025732.1|3722057_3723029_-	D-glycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	29.1	1.9e-22
WP_013963483.1|3723028_3723916_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_013963484.1|3723912_3725112_-	malate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_013963485.1|3725145_3726384_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_044025733.1|3726632_3727256_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013963487.1|3727336_3728314_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_158308168.1|3728282_3728486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963489.1|3728715_3729435_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	2.0e-16
WP_013963490.1|3729431_3730223_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013963492.1|3730614_3732210_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013963493.1|3732220_3732901_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011567425.1|3732997_3733105_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_013963494.1|3733129_3734023_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_013963495.1|3734024_3734774_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_013963496.1|3734775_3735051_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_013963497.1|3735047_3736154_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_044025734.1|3736217_3737054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148264503.1|3737946_3739530_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_083825485.1|3739664_3741296_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_148264504.1|3741429_3742428_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013963502.1|3742778_3743135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148264397.1|3743109_3744387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963504.1|3744718_3745837_-	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	34.5	4.1e-45
WP_148264398.1|3747869_3748049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158308169.1|3748258_3748408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013963506.1|3749186_3749579_+	hypothetical protein	NA	NA	NA	NA	NA
3749185:3749201	attR	AAATGACTGTAAATCTG	NA	NA	NA	NA
WP_013963507.1|3749661_3750954_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	53.1	5.9e-128
WP_013963508.1|3750946_3751555_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	36.4	1.4e-23
WP_013963509.1|3751673_3752564_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_013963510.1|3752753_3753593_+	OmpA family protein	NA	NA	NA	NA	NA
WP_013963511.1|3753693_3755004_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_013963512.1|3755047_3756493_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_013963513.1|3756496_3757501_+	flagellar hook protein	NA	NA	NA	NA	NA
WP_013963514.1|3757497_3758601_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_044025737.1|3759572_3761636_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.2	3.7e-15
WP_013963517.1|3761828_3762482_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_013963518.1|3762846_3764142_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044025424.1|3764138_3764948_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_148264505.1|3765556_3766093_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_013963521.1|3766092_3766830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013963522.1|3766845_3769233_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4N7L3	Lake_Baikal_phage	28.4	7.8e-09
WP_013963523.1|3769258_3769717_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_013963524.1|3769722_3770178_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 1
NC_015729	Roseobacter litoralis Och 149 plasmid pRLO149_63, complete sequence	63532	14344	22440	63532		Enterobacteria_phage(33.33%)	6	NA	NA
WP_013959942.1|14344_15235_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	4.2e-93
WP_013959943.1|15248_16094_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	41.7	5.3e-37
WP_044025838.1|16090_17167_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	48.6	2.5e-87
WP_013959945.1|17171_17735_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.0	1.5e-35
WP_013959946.1|17952_18936_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	31.2	8.7e-39
WP_013959949.1|20727_22440_+	bifunctional sulfate adenylyltransferase/adenylylsulfate kinase	NA	A0A2P1ELS9	Moumouvirus	42.2	3.3e-118
