The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	0	6863	1770419		Natrialba_phage(25.0%)	5	NA	NA
WP_009228404.1|381_1146_+	ParA family protein	NA	Q8JL10	Natrialba_phage	36.3	5.7e-22
WP_009228405.1|1216_2125_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	42.4	2.8e-15
WP_009228406.1|2307_3009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044045564.1|3016_4378_+	lytic transglycosylase domain-containing protein	NA	A0A218M4G6	Pasteurella_phage	44.8	2.7e-14
WP_009228408.1|4601_6863_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	39.4	4.2e-12
>prophage 2
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	10827	12870	1770419		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_044045565.1|10827_12870_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	39.4	1.3e-100
>prophage 3
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	27195	35875	1770419	protease	Staphylococcus_phage(20.0%)	6	NA	NA
WP_009228424.1|27195_28017_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	8.9e-21
WP_009228425.1|28221_29580_+	trigger factor	NA	NA	NA	NA	NA
WP_009228426.1|29772_30441_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	45.1	4.1e-40
WP_009228427.1|30516_31770_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.5	7.5e-112
WP_009228428.1|31866_34044_+	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.3	1.4e-89
WP_009228429.1|34390_35875_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.8	9.2e-101
>prophage 4
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	40891	46018	1770419		Wolbachia_phage(50.0%)	3	NA	NA
WP_009228434.1|40891_42706_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.4	1.2e-57
WP_009228435.1|42882_44067_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009228436.1|44632_46018_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	23.3	4.4e-20
>prophage 5
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	69598	81281	1770419	tRNA	Staphylococcus_phage(20.0%)	8	NA	NA
WP_020967116.1|69598_70375_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	2.8e-16
WP_009228453.1|70613_71837_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_009228454.1|71954_72896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228455.1|72901_75721_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	29.3	6.4e-18
WP_009228456.1|75962_77324_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	33.7	1.0e-50
WP_009228457.1|77331_78609_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	34.6	1.0e-60
WP_009228458.1|78717_79335_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_009228459.1|79331_81281_-	dihydrofolate reductase	NA	A0A1V0SKM1	Klosneuvirus	23.3	1.4e-24
>prophage 6
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	93075	106645	1770419		Streptococcus_phage(28.57%)	11	NA	NA
WP_009228468.1|93075_95133_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	26.8	1.5e-53
WP_044045691.1|95720_96365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228470.1|96417_97374_-	D-2-hydroxyacid dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	32.9	1.2e-32
WP_009228471.1|97441_98719_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	45.3	6.1e-93
WP_009228472.1|98951_99743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009228473.1|100200_100839_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_009228474.1|101285_102353_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	42.4	1.4e-71
WP_009228475.1|102431_103769_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	43.6	8.9e-95
WP_009228476.1|103815_104733_+	3-phosphoglycerate dehydrogenase	NA	A0A285PXZ1	Cedratvirus	26.2	1.9e-16
WP_009228477.1|104802_106050_+	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_020967118.1|106060_106645_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	46.6	2.2e-21
>prophage 7
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	119556	129304	1770419		Cyanophage(25.0%)	8	NA	NA
WP_009228490.1|119556_120420_-	RNA polymerase sigma factor RpoD/SigA	NA	M4SMP8	Cyanophage	32.4	3.4e-31
WP_009228491.1|120664_122131_-	Do family serine endopeptidase	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	32.1	3.7e-09
WP_009228492.1|122905_124231_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_009228493.1|124356_124764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156860583.1|124862_125660_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	28.0	7.6e-09
WP_020967123.1|125743_126874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156860584.1|127014_128133_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_009228497.1|128209_129304_-	DNA polymerase IV	NA	D0R0A3	Streptococcus_phage	27.8	3.6e-17
>prophage 8
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	150905	153257	1770419		Acinetobacter_phage(100.0%)	1	NA	NA
WP_009228513.1|150905_153257_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.2	1.9e-07
>prophage 9
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	159488	169055	1770419	integrase	unidentified_phage(50.0%)	4	156932:156952	185387:185407
156932:156952	attL	ACGGGTGTCCCATCTGTCCCA	NA	NA	NA	NA
WP_020967131.1|159488_160808_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.4	6.6e-18
WP_009228522.1|160821_162075_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	29.5	1.3e-26
WP_020967132.1|162332_166877_-	DUF2958 domain-containing protein	NA	I3PUW5	Vibrio_phage	31.0	6.0e-26
WP_009228524.1|166973_169055_-	type IA DNA topoisomerase	NA	A0A076FM50	Aureococcus_anophage	25.7	2.5e-19
185387:185407	attR	ACGGGTGTCCCATCTGTCCCA	NA	NA	NA	NA
>prophage 10
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	204535	205768	1770419	integrase	unidentified_phage(100.0%)	1	200297:200311	219867:219881
200297:200311	attL	AGCAATGTTTTGTTA	NA	NA	NA	NA
WP_009227187.1|204535_205768_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	39.4	3.4e-32
WP_009227187.1|204535_205768_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	39.4	3.4e-32
219867:219881	attR	AGCAATGTTTTGTTA	NA	NA	NA	NA
>prophage 11
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	218009	222502	1770419		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_009227194.1|218009_218897_-	carbon-nitrogen hydrolase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	37.3	9.8e-50
WP_020967142.1|218923_219997_-	agmatine deiminase family protein	NA	M1I5R4	Acanthocystis_turfacea_Chlorella_virus	28.9	1.7e-40
WP_009227196.1|220119_220740_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_020967143.1|220840_221605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227198.1|221608_222502_+	nuclease (Endonuclease)	NA	X2KR27	Campylobacter_phage	28.5	6.1e-15
>prophage 12
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	225677	230144	1770419		Escherichia_phage(50.0%)	4	NA	NA
WP_009227201.1|225677_226823_+	acyltransferase	NA	G9L6E5	Escherichia_phage	23.5	1.4e-08
WP_009227202.1|226914_227745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009227203.1|227746_228535_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_009227204.1|228809_230144_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	41.0	6.2e-64
>prophage 13
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	235428	237678	1770419		Tetraselmis_virus(100.0%)	1	NA	NA
WP_009227209.1|235428_237678_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	1.4e-164
>prophage 14
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	243779	245207	1770419		Mycobacterium_phage(100.0%)	1	NA	NA
WP_009227214.1|243779_245207_-	HD domain-containing protein	NA	B5LJ39	Mycobacterium_phage	27.1	2.4e-29
>prophage 15
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	249191	253208	1770419		Acinetobacter_phage(33.33%)	5	NA	NA
WP_009227219.1|249191_249773_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	45.0	1.3e-39
WP_009227220.1|249991_250744_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.5	3.9e-63
WP_051148196.1|251553_251874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156860556.1|252108_252327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009227222.1|252644_253208_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.3	1.0e-12
>prophage 16
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	259643	260246	1770419		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009227226.1|259643_260246_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.5	3.8e-21
>prophage 17
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	263406	266631	1770419		Leptospira_phage(100.0%)	1	NA	NA
WP_009227229.1|263406_266631_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	9.1e-53
>prophage 18
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	274364	274835	1770419		Pandoravirus(100.0%)	1	NA	NA
WP_009227238.1|274364_274835_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	39.8	7.6e-17
>prophage 19
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	284859	290393	1770419		Bacillus_phage(66.67%)	5	NA	NA
WP_009227244.1|284859_285558_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.9e-27
WP_009227245.1|285563_287123_-	HAMP domain-containing histidine kinase	NA	Q6XLU9	Feldmannia_irregularis_virus	20.5	1.5e-05
WP_009227246.1|287424_288030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227247.1|288067_289261_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009227248.1|289361_290393_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.8	2.0e-118
>prophage 20
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	298631	300593	1770419		Pseudomonas_phage(100.0%)	1	NA	NA
WP_020967155.1|298631_300593_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	38.8	8.3e-49
>prophage 21
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	306489	307323	1770419		Geobacillus_phage(100.0%)	1	NA	NA
WP_009227260.1|306489_307323_+	glycosyl hydrolase family 25	NA	A0A1U9WQS3	Geobacillus_phage	36.7	2.3e-24
>prophage 22
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	316841	318248	1770419		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_009227266.1|316841_318248_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	30.6	9.5e-55
>prophage 23
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	327818	330850	1770419		Bacillus_virus(50.0%)	3	NA	NA
WP_009227277.1|327818_329381_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.2	1.1e-38
WP_009227278.1|329498_330065_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_009227279.1|330238_330850_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.7	5.9e-38
>prophage 24
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	333970	339685	1770419		Ostreococcus_lucimarinus_virus(50.0%)	5	NA	NA
WP_020967160.1|333970_335683_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	20.9	8.1e-08
WP_009227284.1|335689_336514_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_009227285.1|336592_337633_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_009227286.1|337611_338604_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_009227287.1|338632_339685_-	3-dehydroquinate synthase	NA	A9YVT7	Ostreococcus_tauri_virus	27.4	6.9e-26
>prophage 25
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	351165	363101	1770419	tRNA	Pneumococcus_phage(16.67%)	10	NA	NA
WP_009227302.1|351165_351636_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.8	1.5e-49
WP_009227303.1|351801_352734_-	DMT family transporter	NA	NA	NA	NA	NA
WP_009227304.1|353045_354779_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	39.1	2.2e-93
WP_009227305.1|354869_355865_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_009227306.1|355883_357242_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_009227307.1|357379_358099_+	HAD-IA family hydrolase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.4	2.0e-08
WP_009227308.1|358301_358865_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.4	1.3e-23
WP_009227309.1|358926_360000_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_009227310.1|360155_361931_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.9	9.2e-47
WP_009227311.1|362063_363101_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.5	1.0e-58
>prophage 26
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	375471	376221	1770419		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_009227322.1|375471_376221_+	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	34.8	5.2e-28
>prophage 27
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	383235	384865	1770419		Orpheovirus(50.0%)	2	NA	NA
WP_009227326.1|383235_384183_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	46.7	5.2e-65
WP_009227327.1|384310_384865_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	1.1e-19
>prophage 28
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	407652	408273	1770419		Catovirus(100.0%)	1	NA	NA
WP_009227346.1|407652_408273_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.4	5.7e-36
>prophage 29
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	414071	415729	1770419		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_009227352.1|414071_414950_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	30.9	1.9e-21
WP_009227353.1|414931_415729_-	hypothetical protein	NA	A0A1D8KNT5	Synechococcus_phage	33.3	3.7e-24
>prophage 30
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	424494	425220	1770419		Bacteroides_phage(100.0%)	1	NA	NA
WP_009227363.1|424494_425220_+	hypothetical protein	NA	B5TRA3	Bacteroides_phage	53.4	1.3e-63
>prophage 31
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	430118	452721	1770419	protease,head,terminase,tail,portal,capsid	Clostridium_phage(18.18%)	21	NA	NA
WP_020967182.1|430118_431336_+	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	40.7	7.6e-69
WP_020967183.1|431361_431964_+	DUF2815 family protein	NA	A0A2I7QIM8	Bacillus_phage	49.0	4.6e-43
WP_051148208.1|432497_434441_+	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	51.2	8.7e-176
WP_009227381.1|434446_436957_+	putative virulence-associated protein E	NA	A0A1S7FZ15	Listeria_phage	45.7	1.1e-197
WP_009227382.1|436961_437294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227383.1|437278_437581_+	VRR-NUC domain-containing protein	NA	A0A1W6JQA8	Corynebacterium_phage	43.2	1.0e-11
WP_009227384.1|437567_438944_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	56.0	6.1e-139
WP_009227385.1|438964_439405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227386.1|439414_439756_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	38.6	1.4e-07
WP_009227387.1|440557_440947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227388.1|441021_442731_+|terminase	terminase large subunit	terminase	A0A2I6PDP8	Staphylococcus_phage	29.0	8.8e-47
WP_009227389.1|442742_443987_+|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	28.5	7.9e-29
WP_156860587.1|444052_444721_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	35.4	7.5e-18
WP_009227391.1|444777_445971_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_084704718.1|445995_446379_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_009227393.1|446381_446702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227394.1|446698_447187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227395.1|447196_447601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227396.1|447696_448182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227397.1|448341_448941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227398.1|448947_452721_+|tail	phage tail tape measure protein	tail	F4YXU1	Roseobacter_phage	30.2	1.0e-34
>prophage 32
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	458513	461384	1770419	integrase	uncultured_Mediterranean_phage(33.33%)	4	454970:454983	462707:462720
454970:454983	attL	GCTATTGGCTTAAG	NA	NA	NA	NA
WP_009227405.1|458513_458945_+	hypothetical protein	NA	A0A1B1IRB1	uncultured_Mediterranean_phage	42.0	2.7e-21
WP_156860559.1|458965_459784_+	DNA adenine methylase	NA	A0A0R6PH56	Moraxella_phage	40.2	4.2e-47
WP_156860560.1|459908_460304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227408.1|460295_461384_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	29.4	1.6e-09
462707:462720	attR	GCTATTGGCTTAAG	NA	NA	NA	NA
>prophage 33
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	464605	465325	1770419		Planktothrix_phage(100.0%)	1	NA	NA
WP_009227412.1|464605_465325_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.2	1.2e-26
>prophage 34
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	470748	472017	1770419		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_020967187.1|470748_472017_+	DNA (cytosine-5-)-methyltransferase	NA	E5EQN8	Micromonas_sp._RCC1109_virus	34.5	1.9e-46
>prophage 35
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	476876	496811	1770419	tRNA	Catovirus(40.0%)	16	NA	NA
WP_020967189.1|476876_478268_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.8	3.2e-55
WP_020967190.1|478354_479584_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_009227424.1|479618_480746_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.9e-78
WP_009227425.1|480761_483236_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	39.3	1.6e-150
WP_009227426.1|484146_484866_+	methyltransferase	NA	NA	NA	NA	NA
WP_009227427.1|484911_485940_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.9	1.2e-09
WP_009227428.1|486146_487334_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	34.5	2.9e-49
WP_009227429.1|487995_489132_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	58.0	5.5e-130
WP_009227430.1|489133_490573_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_009227431.1|490569_491499_+	LicD family protein	NA	A0A1V0SAS8	Catovirus	49.0	9.8e-08
WP_020967193.1|491488_492487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227433.1|492476_492905_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	34.7	3.8e-15
WP_009227434.1|492911_493922_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009227435.1|493914_494739_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_009227436.1|494719_495691_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.4	7.8e-08
WP_009227437.1|495836_496811_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.5	1.0e-07
>prophage 36
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	499976	500588	1770419		Streptococcus_phage(100.0%)	1	NA	NA
WP_020967194.1|499976_500588_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.3	1.2e-14
>prophage 37
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	512839	524507	1770419		Cyanophage(25.0%)	8	NA	NA
WP_009227455.1|512839_513712_+	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	29.2	9.4e-29
WP_009227456.1|514083_515577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227457.1|515775_516192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009227458.1|516660_517884_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	41.2	1.2e-13
WP_009227459.1|517920_520062_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_009227460.1|520369_522847_+	bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.0	7.6e-23
WP_009227461.1|522928_523711_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_020967197.1|523856_524507_+	endonuclease III	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	28.7	8.9e-16
>prophage 38
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	544527	545196	1770419		Campylobacter_virus(100.0%)	1	NA	NA
WP_009227478.1|544527_545196_-	7-cyano-7-deazaguanine synthase QueC	NA	H6SUQ0	Campylobacter_virus	47.2	1.4e-48
>prophage 39
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	554555	559153	1770419		Tupanvirus(50.0%)	4	NA	NA
WP_009227485.1|554555_555593_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	43.5	8.5e-77
WP_009227486.1|555776_556307_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_051148199.1|556516_557332_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_009227488.1|557494_559153_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.8	3.4e-27
>prophage 40
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	564641	569389	1770419		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_009227493.1|564641_565388_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	2.2e-18
WP_009227494.1|565577_566246_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_156860562.1|566459_566630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051148211.1|566832_568008_+	lipid A 3-O-deacylase	NA	NA	NA	NA	NA
WP_009227497.1|568108_569389_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	47.4	1.2e-88
>prophage 41
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	581002	582574	1770419		Vibrio_phage(33.33%)	3	NA	NA
WP_009227507.1|581002_581590_-	GTP cyclohydrolase I	NA	A0A2I7S8W4	Vibrio_phage	38.3	2.4e-28
WP_009227508.1|581544_582123_-	radical SAM protein	NA	A5A3S6	Burkholderia_phage	41.8	1.0e-18
WP_009227509.1|582130_582574_-	6-carboxytetrahydropterin synthase	NA	A0A0S0MVM4	Pseudomonas_phage	58.6	3.2e-41
>prophage 42
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	586985	594502	1770419		uncultured_virus(40.0%)	6	NA	NA
WP_009227513.1|586985_587264_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	57.0	7.4e-20
WP_009227514.1|587296_588925_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	62.9	1.3e-185
WP_009227515.1|589137_589941_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	29.5	4.2e-23
WP_009227516.1|589915_590818_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009227517.1|590851_592759_-	RecQ family ATP-dependent DNA helicase	NA	G5CQD7	Megavirus	40.7	9.8e-63
WP_009227518.1|592762_594502_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.1	1.5e-73
>prophage 43
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	612596	614345	1770419		Streptococcus_phage(100.0%)	1	NA	NA
WP_009227530.1|612596_614345_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	41.4	3.7e-117
>prophage 44
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	618643	619882	1770419		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_044045726.1|618643_619882_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	31.9	2.1e-13
>prophage 45
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	636661	637363	1770419		Geobacillus_phage(100.0%)	1	NA	NA
WP_020967221.1|636661_637363_-	hypothetical protein	NA	A0A1U9WQS3	Geobacillus_phage	37.6	1.7e-25
>prophage 46
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	657268	657760	1770419		Streptococcus_phage(100.0%)	1	NA	NA
WP_009227565.1|657268_657760_-	3'-5' exonuclease	NA	M1PFD8	Streptococcus_phage	37.4	1.6e-22
>prophage 47
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	661204	662302	1770419		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_009227568.1|661204_662302_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	27.8	3.8e-35
>prophage 48
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	674864	676334	1770419		uncultured_marine_virus(100.0%)	1	NA	NA
WP_009227582.1|674864_676334_+	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	41.9	2.0e-92
>prophage 49
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	679441	685211	1770419		uncultured_phage(33.33%)	6	NA	NA
WP_009227586.1|679441_680401_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	38.6	4.8e-18
WP_009227587.1|680474_681770_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_009227588.1|681774_682068_+	HU family DNA-binding protein	NA	Q2A099	Sodalis_phage	33.3	1.2e-07
WP_009227589.1|682060_683437_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_009227590.1|684199_684754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227591.1|684791_685211_+	single-stranded DNA-binding protein	NA	Q6V7S6	Burkholderia_virus	40.6	1.4e-17
>prophage 50
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	690180	694688	1770419		Staphylococcus_phage(50.0%)	3	NA	NA
WP_009227596.1|690180_691098_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	26.0	2.2e-12
WP_020967232.1|691290_693507_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_009227598.1|693758_694688_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	24.5	1.6e-13
>prophage 51
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	713783	729926	1770419	tRNA	Cafeteria_roenbergensis_virus(16.67%)	16	NA	NA
WP_009227613.1|713783_714545_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	47.8	2.1e-56
WP_009227614.1|714541_715516_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.0	1.3e-39
WP_009227615.1|715543_716809_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_044045658.1|716955_717573_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009227617.1|717736_718135_-	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_009227618.1|718354_720121_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	24.4	7.5e-25
WP_009227619.1|720248_720509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227620.1|720571_720904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009227621.1|721051_722158_-	aminotransferase class V-fold PLP-dependent enzyme	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.0	5.9e-36
WP_009227622.1|722154_723093_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009227623.1|723085_723487_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_009227624.1|723619_724780_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_009227625.1|724793_725942_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	42.7	8.8e-75
WP_009227626.1|725997_726627_-	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_009227627.1|726616_727990_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_009227628.1|728615_729926_+	exodeoxyribonuclease VII large subunit	NA	A0A2P1EMK6	Moumouvirus	33.5	3.1e-15
>prophage 52
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	733867	738303	1770419		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_009227633.1|733867_736030_-	elongation factor G	NA	A0A2K5B2A5	Erysipelothrix_phage	23.8	3.0e-31
WP_009227634.1|736189_737329_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_009227635.1|737481_738303_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	37.7	5.4e-42
>prophage 53
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	745836	754289	1770419		Vibrio_phage(33.33%)	5	NA	NA
WP_009227643.1|745836_748560_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.6	1.3e-89
WP_009227644.1|748864_750409_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.8e-14
WP_020967242.1|750436_751186_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_009227646.1|751241_752552_-	DUF3078 domain-containing protein	NA	NA	NA	NA	NA
WP_009227647.1|752681_754289_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.9	1.8e-134
>prophage 54
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	760289	764324	1770419		Vaccinia_virus(100.0%)	1	NA	NA
WP_009227651.1|760289_764324_-	DUF4981 domain-containing protein	NA	B9U1H7	Vaccinia_virus	33.2	2.6e-105
>prophage 55
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	772769	777817	1770419		Dickeya_phage(50.0%)	4	NA	NA
WP_009227658.1|772769_773288_-	HAD hydrolase-like protein	NA	A0A140XBD6	Dickeya_phage	31.1	7.3e-13
WP_009227659.1|773280_774069_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_009227660.1|774091_774619_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_009227661.1|774988_777817_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	43.4	1.3e-215
>prophage 56
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	781381	786091	1770419		Bacillus_virus(50.0%)	2	NA	NA
WP_020967246.1|781381_783973_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	31.9	4.5e-103
WP_020967247.1|784387_786091_-	AAA family ATPase	NA	H7BUJ6	unidentified_phage	41.7	9.9e-83
>prophage 57
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	792868	800769	1770419		Tupanvirus(25.0%)	8	NA	NA
WP_009227671.1|792868_794092_-	HD domain-containing protein	NA	A0A2K9L0X9	Tupanvirus	30.3	4.7e-26
WP_009227672.1|794093_794918_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_009227673.1|794985_796095_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_009227674.1|796097_797264_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FUD9	Synechococcus_phage	25.4	1.4e-14
WP_009227675.1|797311_798055_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_009227676.1|798065_798800_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_009227677.1|798807_799758_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	28.0	5.8e-24
WP_009227678.1|799779_800769_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	48.6	2.2e-50
>prophage 58
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	810943	822536	1770419		Synechococcus_phage(33.33%)	8	NA	NA
WP_084704722.1|810943_814729_+	DUF4922 domain-containing protein	NA	Q2XU88	Pseudomonas_phage	26.4	2.3e-07
WP_044045730.1|814779_816048_+	MFS transporter	NA	NA	NA	NA	NA
WP_009227692.1|816137_817313_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	42.4	2.1e-79
WP_009227693.1|817333_818407_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.6	6.8e-130
WP_009227694.1|818419_819487_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	30.5	5.0e-32
WP_156860589.1|819826_820582_-	DUF4738 domain-containing protein	NA	NA	NA	NA	NA
WP_009227696.1|820667_821984_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.3	3.4e-83
WP_009227697.1|821990_822536_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.8	6.3e-39
>prophage 59
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	831070	834422	1770419		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_044045732.1|831070_831793_-	phosphatase PAP2 family protein	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	35.6	4.9e-07
WP_009227704.1|831852_832323_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_009227705.1|832518_832863_+	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_009227706.1|833090_834422_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.2	3.8e-37
>prophage 60
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	850943	852365	1770419		Streptococcus_phi-m46.1-like_phage(100.0%)	1	NA	NA
WP_009227718.1|850943_852365_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	30.4	6.8e-53
>prophage 61
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	867282	870861	1770419	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_009227732.1|867282_870861_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	31.7	5.4e-155
>prophage 62
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	888203	896590	1770419		Enterococcus_phage(25.0%)	7	NA	NA
WP_009227749.1|888203_889082_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	7.8e-31
WP_009227750.1|889109_890450_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_009227751.1|890810_891764_-	SPFH/Band 7/PHB domain protein	NA	A0A0G2YDT0	Acanthamoeba_polyphaga_mimivirus	29.9	1.5e-19
WP_009227752.1|891858_892311_-	NfeD family protein	NA	NA	NA	NA	NA
WP_009227753.1|892855_894484_-	family 20 glycosylhydrolase	NA	A0A2H4UUW7	Bodo_saltans_virus	34.7	5.3e-09
WP_051148216.1|895098_895641_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_009227755.1|895651_896590_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.0	2.8e-47
>prophage 63
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	908646	917719	1770419	tRNA	Tupanvirus(50.0%)	7	NA	NA
WP_020967265.1|908646_909999_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	22.9	8.3e-16
WP_009227769.1|910008_911202_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	31.3	4.1e-27
WP_009227770.1|911691_912438_+	TIGR02757 family protein	NA	NA	NA	NA	NA
WP_009227771.1|912597_913209_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_009227772.1|913198_914986_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	7.5e-49
WP_009227773.1|915297_915885_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_009227774.1|915937_917719_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	44.0	4.2e-23
>prophage 64
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	930892	931399	1770419		Tetraselmis_virus(100.0%)	1	NA	NA
WP_009227785.1|930892_931399_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.5	5.3e-24
>prophage 65
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	937533	938817	1770419		Clostridium_phage(100.0%)	1	NA	NA
WP_018361489.1|937533_938817_-	virulence-associated protein E	NA	F8UBM0	Clostridium_phage	28.6	3.7e-13
>prophage 66
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	945197	960063	1770419	integrase	Aureococcus_anophage(25.0%)	11	947718:947731	968723:968736
WP_009228205.1|945197_948710_-	N-6 DNA methylase	NA	A0A076FHE5	Aureococcus_anophage	36.9	2.6e-08
947718:947731	attL	AGGGTCGTTTTCAT	NA	NA	NA	NA
WP_009228204.1|948727_950116_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_009228203.1|950122_953395_-	helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	23.3	1.0e-19
WP_009228202.1|953399_953621_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009228201.1|953865_954288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228200.1|954284_955580_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_020967275.1|955613_956843_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	37.0	3.1e-25
WP_156860569.1|956858_957131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009228199.1|957331_957889_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_009228198.1|958448_959624_+	DUF4369 domain-containing protein	NA	NA	NA	NA	NA
WP_009228197.1|959679_960063_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.4	2.5e-10
968723:968736	attR	ATGAAAACGACCCT	NA	NA	NA	NA
>prophage 67
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	977346	979230	1770419		Streptococcus_phage(100.0%)	1	NA	NA
WP_020967280.1|977346_979230_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.1	4.2e-98
>prophage 68
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	987498	987939	1770419		Noumeavirus(100.0%)	1	NA	NA
WP_009228181.1|987498_987939_-	dUTP diphosphatase	NA	A0A1Q1PNN8	Noumeavirus	57.4	6.4e-42
>prophage 69
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	991492	993466	1770419		Bacillus_virus(100.0%)	1	NA	NA
WP_009228178.1|991492_993466_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.6	1.6e-140
>prophage 70
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	996986	999911	1770419		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_009228173.1|996986_999911_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	27.6	1.3e-13
>prophage 71
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1015184	1021296	1770419		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_009228164.1|1015184_1017830_-	calcium-translocating P-type ATPase, PMCA-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	32.8	2.4e-104
WP_009228163.1|1018429_1020640_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	63.4	1.8e-281
WP_009228162.1|1020792_1021296_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2R2ZH61	Clostridioides_phage	62.4	3.2e-53
>prophage 72
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1024870	1034309	1770419		Cafeteria_roenbergensis_virus(50.0%)	7	NA	NA
WP_009228158.1|1024870_1025515_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	47.9	9.4e-34
WP_009228157.1|1025578_1026793_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.1	5.4e-99
WP_009228155.1|1026931_1028317_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_009228154.1|1028322_1029078_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.2	1.8e-07
WP_020967293.1|1029090_1029864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228152.1|1029892_1031347_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_009228151.1|1031450_1034309_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	22.1	3.4e-19
>prophage 73
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1038700	1045706	1770419		Stenotrophomonas_phage(33.33%)	6	NA	NA
WP_009228145.1|1038700_1039234_+	NUDIX domain-containing protein	NA	A0A142EZP1	Stenotrophomonas_phage	33.3	6.8e-06
WP_009228144.1|1039422_1040013_-	DUF3109 family protein	NA	NA	NA	NA	NA
WP_009228143.1|1040074_1040743_-	uracil-DNA glycosylase	NA	V5NWU7	Chelonid_alphaherpesvirus	45.1	1.9e-45
WP_009228142.1|1040941_1041196_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_009228141.1|1041831_1042557_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_009228140.1|1042871_1045706_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	29.1	1.4e-12
>prophage 74
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1062101	1063157	1770419	transposase	Burkholderia_phage(100.0%)	1	NA	NA
WP_009228128.1|1062101_1063157_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	28.8	6.1e-22
>prophage 75
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1087995	1088526	1770419		Klosneuvirus(100.0%)	1	NA	NA
WP_009228111.1|1087995_1088526_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.3	7.0e-27
>prophage 76
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1093300	1097130	1770419		Indivirus(50.0%)	2	NA	NA
WP_009228105.1|1093300_1094278_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.3	3.2e-09
WP_009228104.1|1094364_1097130_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.6	2.3e-68
>prophage 77
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1103930	1104770	1770419		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009228097.1|1103930_1104770_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	1.5e-39
>prophage 78
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1119348	1121175	1770419		Bacillus_phage(100.0%)	1	NA	NA
WP_009228088.1|1119348_1121175_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	6.7e-53
>prophage 79
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1124865	1127587	1770419		Erythrobacter_phage(50.0%)	3	NA	NA
WP_009228083.1|1124865_1125102_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.1	8.8e-06
WP_009228082.1|1125306_1126569_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_020967305.1|1126558_1127587_+	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	31.5	1.4e-23
>prophage 80
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1169437	1175160	1770419	protease	Bacillus_phage(50.0%)	4	NA	NA
WP_009228055.1|1169437_1169710_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	53.3	1.1e-15
WP_044045746.1|1169919_1170864_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_009228053.1|1170976_1172068_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_009228052.1|1172172_1175160_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	44.4	2.9e-29
>prophage 81
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1205010	1211974	1770419	tRNA	Salmonella_phage(33.33%)	6	NA	NA
WP_009228038.1|1205010_1205985_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	36.8	9.8e-43
WP_009228037.1|1206045_1207539_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	25.7	1.2e-42
WP_009228036.1|1207739_1208204_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_009228035.1|1208325_1209432_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_156860571.1|1209460_1209610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020967314.1|1209769_1211974_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.5	2.0e-59
>prophage 82
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1220812	1224278	1770419		uncultured_virus(50.0%)	5	NA	NA
WP_009228024.1|1220812_1221289_+	peptidase M15 superfamily	NA	A0A218MKM6	uncultured_virus	41.6	9.1e-18
WP_009228023.1|1221449_1221647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228022.1|1221662_1222223_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_009228021.1|1222403_1222985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228019.1|1223171_1224278_-	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	37.5	5.3e-53
>prophage 83
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1227324	1241193	1770419		Methanothermobacter_phage(16.67%)	8	NA	NA
WP_009228016.1|1227324_1228548_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.5	4.0e-33
WP_009228015.1|1228697_1229555_-	3'-5' exonuclease	NA	A0A1B0WLV5	Flavobacterium_phage	36.4	2.7e-36
WP_009228014.1|1229557_1230682_-	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
WP_009228013.1|1230861_1231272_+	DUF3127 domain-containing protein	NA	NA	NA	NA	NA
WP_009228012.1|1231933_1234750_-	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	25.5	1.2e-19
WP_009228011.1|1235179_1236832_-	beta-N-acetylhexosaminidase	NA	A0A2H4UUW7	Bodo_saltans_virus	33.1	1.6e-13
WP_009228010.1|1237324_1239712_-	glycoside hydrolase family 2 protein	NA	B9U1V4	Vaccinia_virus	27.0	1.0e-24
WP_009228009.1|1239885_1241193_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	67.8	4.2e-158
>prophage 84
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1244310	1246131	1770419	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_009228006.1|1244310_1246131_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	29.4	2.2e-48
>prophage 85
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1256260	1258473	1770419		Indivirus(50.0%)	3	NA	NA
WP_020967322.1|1256260_1257259_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.3	4.4e-38
WP_156860596.1|1257247_1257571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009227994.1|1257735_1258473_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.7e-10
>prophage 86
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1266413	1270388	1770419		Hokovirus(100.0%)	1	NA	NA
WP_009227986.1|1266413_1270388_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	A0A1V0SGX0	Hokovirus	24.1	2.0e-17
>prophage 87
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1279842	1284246	1770419	tRNA	Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
WP_009227980.1|1279842_1281768_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	3.6e-57
WP_009227979.1|1282023_1283025_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_009227978.1|1283109_1284246_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	28.4	9.8e-18
>prophage 88
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1294187	1298501	1770419		Bandra_megavirus(50.0%)	2	NA	NA
WP_009227970.1|1294187_1297037_+	insulinase family protein	NA	A0A2K9V7S4	Bandra_megavirus	24.2	7.9e-08
WP_009227969.1|1297463_1298501_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.7	4.9e-08
>prophage 89
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1330180	1331794	1770419		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009227943.1|1330180_1331794_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	49.7	4.0e-126
>prophage 90
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1338223	1339219	1770419		Klosneuvirus(100.0%)	1	NA	NA
WP_020967346.1|1338223_1339219_+	NAD(P)-dependent oxidoreductase	NA	A0A1V0SKV4	Klosneuvirus	23.2	4.0e-07
>prophage 91
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1343499	1344759	1770419		Phage_TP(100.0%)	1	NA	NA
WP_009227931.1|1343499_1344759_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.1	3.5e-16
>prophage 92
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1353583	1357843	1770419		Leptospira_phage(33.33%)	6	NA	NA
WP_009227925.1|1353583_1354519_-	tyrosine recombinase XerD	NA	S5W9T9	Leptospira_phage	30.1	7.3e-19
WP_009227924.1|1354631_1355051_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_009227923.1|1355098_1355734_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.9	4.9e-11
WP_009227922.1|1355776_1356322_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_009227920.1|1356682_1357261_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_009227919.1|1357276_1357843_-	guanylate kinase	NA	A0A223FNL1	NY_014_poxvirus	31.3	3.4e-19
>prophage 93
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1368984	1369932	1770419		Microcystis_virus(100.0%)	1	NA	NA
WP_009227908.1|1368984_1369932_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	48.0	7.3e-19
>prophage 94
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1378265	1379012	1770419		Flavobacterium_phage(100.0%)	1	NA	NA
WP_009227901.1|1378265_1379012_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	45.1	5.4e-25
>prophage 95
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1393417	1396016	1770419	holin	Faustovirus(50.0%)	3	NA	NA
WP_020967357.1|1393417_1394470_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	28.3	8.5e-08
WP_009227886.1|1394466_1395195_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_009227885.1|1395197_1396016_+	LicD family protein	NA	A0A1V0SAS8	Catovirus	47.7	9.5e-07
>prophage 96
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1416888	1418553	1770419		Bottlenose_dolphin_coronavirus(100.0%)	1	NA	NA
WP_044045756.1|1416888_1418553_+	nucleoside kinase	NA	V5TGE8	Bottlenose_dolphin_coronavirus	25.7	5.1e-07
>prophage 97
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1427077	1430716	1770419		Bacillus_phage(100.0%)	2	NA	NA
WP_009227861.1|1427077_1429597_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A127AW21	Bacillus_phage	43.4	1.9e-183
WP_009227860.1|1429672_1430716_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	36.6	2.1e-59
>prophage 98
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1440887	1443688	1770419		Bacillus_phage(50.0%)	2	NA	NA
WP_009227852.1|1440887_1441703_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	37.3	1.8e-05
WP_020967367.1|1442029_1443688_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.2	1.5e-51
>prophage 99
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1452008	1459578	1770419	tRNA	Staphylococcus_phage(50.0%)	8	NA	NA
WP_009227845.1|1452008_1453310_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	41.0	1.4e-73
WP_009227844.1|1453352_1453607_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.1	3.1e-17
WP_009227843.1|1453567_1454005_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_009227842.1|1454017_1454770_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_020967370.1|1454774_1455794_-	DUF4271 domain-containing protein	NA	NA	NA	NA	NA
WP_009227840.1|1455905_1457162_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	50.7	2.0e-104
WP_009227839.1|1457374_1457899_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_020967371.1|1457895_1459578_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	2.5e-33
>prophage 100
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1465973	1472729	1770419		Indivirus(50.0%)	3	NA	NA
WP_009227832.1|1465973_1468883_-	insulinase family protein	NA	A0A1V0SD84	Indivirus	25.4	5.0e-10
WP_009227831.1|1468939_1470190_-	GTPase HflX	NA	NA	NA	NA	NA
WP_009227830.1|1471085_1472729_+	beta-N-acetylhexosaminidase	NA	A0A2H4UUW7	Bodo_saltans_virus	27.0	2.0e-08
>prophage 101
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1477900	1482436	1770419	integrase	Bacillus_phage(50.0%)	2	1478095:1478109	1486955:1486969
WP_009227825.1|1477900_1480591_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	22.4	3.6e-18
1478095:1478109	attL	CATGTTAGAACGTAT	NA	NA	NA	NA
WP_009227824.1|1481206_1482436_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.1	6.2e-26
WP_009227824.1|1481206_1482436_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.1	6.2e-26
1486955:1486969	attR	CATGTTAGAACGTAT	NA	NA	NA	NA
>prophage 102
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1490028	1491465	1770419		Clostridium_phage(100.0%)	1	NA	NA
WP_020967378.1|1490028_1491465_+	hypothetical protein	NA	F8UBM0	Clostridium_phage	28.7	2.8e-14
>prophage 103
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1508776	1512511	1770419		Burkholderia_phage(100.0%)	1	NA	NA
WP_009227798.1|1508776_1512511_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	32.9	1.3e-50
>prophage 104
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1527672	1530294	1770419		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_009228212.1|1527672_1530294_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.4	3.9e-38
>prophage 105
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1536436	1537282	1770419		Pandoravirus(100.0%)	1	NA	NA
WP_009228218.1|1536436_1537282_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	25.8	3.2e-13
>prophage 106
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1542146	1543727	1770419		Tetraselmis_virus(100.0%)	1	NA	NA
WP_009228222.1|1542146_1543727_+	ribonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	29.0	4.2e-11
>prophage 107
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1550190	1550640	1770419		Xanthomonas_phage(100.0%)	1	NA	NA
WP_009228228.1|1550190_1550640_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	41.4	3.3e-17
>prophage 108
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1555718	1556963	1770419		Moumouvirus(100.0%)	1	NA	NA
WP_009228234.1|1555718_1556963_-	insulinase family protein	NA	M1NN74	Moumouvirus	25.2	5.8e-40
>prophage 109
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1562108	1564046	1770419		Bacillus_phage(100.0%)	1	NA	NA
WP_009228239.1|1562108_1564046_+	type IIA DNA topoisomerase subunit B	NA	A0A172JHT4	Bacillus_phage	32.4	1.1e-61
>prophage 110
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1574160	1575204	1770419		Indivirus(100.0%)	1	NA	NA
WP_020967403.1|1574160_1575204_+	hypothetical protein	NA	A0A1V0SDP3	Indivirus	25.3	5.4e-15
>prophage 111
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1578356	1579049	1770419		Lactococcus_phage(100.0%)	1	NA	NA
WP_009228248.1|1578356_1579049_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	32.3	3.4e-05
>prophage 112
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1606627	1608181	1770419		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_009228271.1|1606627_1608181_-	bifunctional response regulator/alkaline phosphatase family protein	NA	Q6XM27	Feldmannia_irregularis_virus	28.2	1.2e-05
>prophage 113
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1616286	1617468	1770419		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_009228278.1|1616286_1617468_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	24.0	4.0e-22
>prophage 114
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1621323	1625317	1770419		Tenacibaculum_phage(50.0%)	4	NA	NA
WP_009228283.1|1621323_1621896_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	35.1	9.5e-22
WP_009228284.1|1622076_1623246_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_020967410.1|1623242_1624112_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_020967411.1|1624162_1625317_+	M23 family metallopeptidase	NA	A0A2L1IVP0	Streptomyces_phage	38.9	5.1e-14
>prophage 115
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1634482	1635082	1770419		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_009228295.1|1634482_1635082_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG3	Prochlorococcus_phage	41.1	6.2e-32
>prophage 116
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1639566	1640784	1770419		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009228298.1|1639566_1640784_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.0	1.6e-103
>prophage 117
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1654416	1658525	1770419		Tetraselmis_virus(33.33%)	4	NA	NA
WP_009228312.1|1654416_1655952_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	26.2	1.2e-18
WP_156860581.1|1656290_1657148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228314.1|1657169_1657847_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	50.2	1.0e-54
WP_020967423.1|1657940_1658525_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	50.5	1.3e-37
>prophage 118
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1661733	1666637	1770419		Staphylococcus_phage(33.33%)	3	NA	NA
WP_009228319.1|1661733_1662048_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	43.0	1.2e-18
WP_009228320.1|1662103_1665814_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	33.7	6.1e-186
WP_009228321.1|1665941_1666637_+	phosphatidylserine decarboxylase family protein	NA	A0A1V0SDU9	Indivirus	31.9	2.3e-14
>prophage 119
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1671334	1671811	1770419		Orpheovirus(100.0%)	1	NA	NA
WP_009228329.1|1671334_1671811_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	41.1	5.0e-16
>prophage 120
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1675877	1677992	1770419		Moraxella_phage(50.0%)	2	NA	NA
WP_009228336.1|1675877_1677539_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	25.3	4.4e-19
WP_009228337.1|1677560_1677992_-	dCMP deaminase family protein	NA	H6WFU3	Cyanophage	49.6	1.9e-30
>prophage 121
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1683087	1684038	1770419		Enterobacteria_phage(100.0%)	1	NA	NA
WP_009228343.1|1683087_1684038_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	30.8	5.8e-24
>prophage 122
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1696013	1697117	1770419		Streptomyces_phage(100.0%)	1	NA	NA
WP_156860602.1|1696013_1697117_+	redoxin domain-containing protein	NA	A0A1J0GW78	Streptomyces_phage	40.3	5.4e-05
>prophage 123
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1717444	1719799	1770419		Acinetobacter_phage(100.0%)	1	NA	NA
WP_009228365.1|1717444_1719799_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.1	9.4e-07
>prophage 124
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1740918	1742449	1770419		environmental_Halophage(50.0%)	2	NA	NA
WP_009228379.1|1740918_1741872_+	site-specific DNA-methyltransferase	NA	H9YPF1	environmental_Halophage	26.6	1.1e-17
WP_009228380.1|1741963_1742449_+	phosphohydrolase	NA	A0A0M3LQS1	Mannheimia_phage	30.6	2.4e-10
>prophage 125
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1746668	1747895	1770419		Enterobacteria_phage(100.0%)	1	NA	NA
WP_009228384.1|1746668_1747895_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	35.7	1.8e-57
>prophage 126
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1751632	1752337	1770419		Planktothrix_phage(100.0%)	1	NA	NA
WP_009228389.1|1751632_1752337_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.9e-36
>prophage 127
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1755917	1756913	1770419		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_009228392.1|1755917_1756913_-	2-hydroxyacid dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	45.2	4.3e-62
>prophage 128
NC_022111	Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence	1770419	1761105	1764539	1770419		Flavobacterium_phage(50.0%)	2	NA	NA
WP_009228396.1|1761105_1763079_+	DNA primase	NA	A0A1B0WMR3	Flavobacterium_phage	30.6	2.3e-43
WP_009228397.1|1763105_1764539_-	AAA family ATPase	NA	K4F9M2	Cronobacter_phage	27.4	8.3e-14
>prophage 1
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	0	14576	709850		Pseudomonas_phage(50.0%)	7	NA	NA
WP_009228702.1|1509_1806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009228703.1|2378_3548_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_009228704.1|3552_4950_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_009228705.1|4963_8275_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_009228706.1|8849_10325_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.7	1.9e-66
WP_009228707.1|10321_11713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228708.1|11981_14576_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	33.4	2.6e-119
>prophage 2
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	30477	33012	709850	protease	Cronobacter_phage(100.0%)	1	NA	NA
WP_009228724.1|30477_33012_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.9	6.1e-121
>prophage 3
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	50041	60151	709850	tRNA	Moumouvirus(25.0%)	6	NA	NA
WP_009229023.1|50041_51445_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.6	8.5e-88
WP_009229022.1|51656_53096_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_009229021.1|53173_54520_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	58.3	8.5e-146
WP_009229020.1|55139_55487_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044045438.1|55591_58213_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.9	3.4e-90
WP_020967862.1|58561_60151_-	hypothetical protein	NA	A0A2P0VP48	Tetraselmis_virus	35.2	3.5e-66
>prophage 4
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	73267	75490	709850		Acinetobacter_phage(100.0%)	1	NA	NA
WP_156860544.1|73267_75490_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.0	7.3e-09
>prophage 5
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	86547	87828	709850		Wolbachia_phage(100.0%)	1	NA	NA
WP_009229001.1|86547_87828_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	46.7	1.6e-64
>prophage 6
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	98480	99485	709850		Wolbachia_phage(100.0%)	1	NA	NA
WP_044045504.1|98480_99485_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.0	5.7e-70
>prophage 7
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	105275	114705	709850		Lactococcus_phage(33.33%)	3	NA	NA
WP_009228983.1|105275_106229_+	Abi family protein	NA	A0A059NT88	Lactococcus_phage	25.5	1.9e-14
WP_020967871.1|106270_112531_-	DUF2958 domain-containing protein	NA	I3PUW5	Vibrio_phage	31.2	2.4e-25
WP_009228981.1|112623_114705_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	30.4	3.7e-39
>prophage 8
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	131292	134738	709850		Bacillus_phage(100.0%)	2	NA	NA
WP_009228968.1|131292_132990_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	9.1e-44
WP_009228967.1|132992_134738_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	2.3e-42
>prophage 9
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	162460	163729	709850	integrase	unidentified_phage(100.0%)	1	157840:157853	171789:171802
157840:157853	attL	ACAGGGACATACAT	NA	NA	NA	NA
WP_020967883.1|162460_163729_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	41.4	5.0e-31
WP_020967883.1|162460_163729_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	41.4	5.0e-31
171789:171802	attR	ACAGGGACATACAT	NA	NA	NA	NA
>prophage 10
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	179045	188151	709850		Bacillus_phage(20.0%)	9	NA	NA
WP_009229053.1|179045_179528_-	dihydrofolate reductase	NA	J9PU01	Bacillus_phage	39.3	7.3e-23
WP_009229054.1|179527_180322_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	66.4	5.3e-103
WP_020967889.1|180383_180770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009229056.1|180854_181628_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.4	1.1e-23
WP_009229057.1|181630_182377_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009229058.1|182899_184798_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.4	4.4e-140
WP_009229060.1|185661_186387_+	ion transporter	NA	NA	NA	NA	NA
WP_009229061.1|186568_186925_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009229062.1|186936_188151_+	hypothetical protein	NA	F8UBM0	Clostridium_phage	27.3	1.1e-19
>prophage 11
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	191653	201507	709850		Oryctes_rhinoceros_nudivirus(33.33%)	7	NA	NA
WP_009229067.1|191653_192535_+	cell filamentation protein Fic	NA	B7SV90	Oryctes_rhinoceros_nudivirus	33.3	2.3e-06
WP_009229068.1|192546_195423_+	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_009229069.1|195434_197381_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	34.3	5.2e-35
WP_051148185.1|197377_197965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084704700.1|197951_198908_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_009229072.1|199206_200241_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_009229073.1|200364_201507_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	37.2	4.4e-10
>prophage 12
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	204612	211119	709850		Streptococcus_phage(50.0%)	4	NA	NA
WP_009229076.1|204612_206643_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.4	1.3e-44
WP_009229077.1|207140_207563_-	hypothetical protein	NA	A0A2H4JDQ6	uncultured_Caudovirales_phage	44.3	1.2e-13
WP_009229078.1|207604_210082_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	31.9	7.1e-21
WP_009229079.1|210234_211119_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.2	1.5e-103
>prophage 13
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	231299	235668	709850	tRNA	Enterococcus_phage(50.0%)	2	NA	NA
WP_009228864.1|231299_234020_-	DNA gyrase/topoisomerase IV subunit A	NA	A0A1G5SA32	Enterococcus_phage	27.0	3.1e-38
WP_009228865.1|234126_235668_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.9	1.0e-46
>prophage 14
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	241881	245301	709850		Tupanvirus(50.0%)	3	NA	NA
WP_009228870.1|241881_243375_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	26.9	4.5e-39
WP_009228871.1|243443_243686_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_009228872.1|243930_245301_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	27.3	2.1e-38
>prophage 15
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	254566	256333	709850		Aureococcus_anophage(100.0%)	1	NA	NA
WP_009228880.1|254566_256333_+	N-6 DNA methylase	NA	A0A076FHE5	Aureococcus_anophage	28.9	1.2e-27
>prophage 16
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	260081	260645	709850		Vibrio_phage(100.0%)	1	NA	NA
WP_009228888.1|260081_260645_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	34.7	4.5e-16
>prophage 17
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	265531	268364	709850	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_009228894.1|265531_267496_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.6	9.3e-125
WP_020967904.1|267671_268364_+	translation initiation factor IF-3	NA	A0A1L2CV30	Pectobacterium_phage	38.7	8.9e-14
>prophage 18
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	271779	278301	709850		Tupanvirus(33.33%)	3	NA	NA
WP_009228900.1|271779_273714_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	4.9e-54
WP_009228901.1|273835_275875_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	32.9	2.6e-90
WP_009228902.1|276453_278301_+	U32 family peptidase	NA	Q6DW11	Phage_TP	27.7	6.0e-25
>prophage 19
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	284117	285509	709850		Tupanvirus(100.0%)	1	NA	NA
WP_009228907.1|284117_285509_+	protoporphyrinogen oxidase	NA	A0A2K9L022	Tupanvirus	35.7	4.0e-05
>prophage 20
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	299342	303613	709850	protease	Lactobacillus_phage(50.0%)	4	NA	NA
WP_009228916.1|299342_299765_-	DUF805 domain-containing protein	NA	D6PSS5	Lactobacillus_phage	26.8	5.4e-06
WP_009228917.1|300408_300726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009228918.1|300819_301125_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_051148187.1|301321_303613_+	AAA domain-containing protein	NA	A0A2I7SAX5	Vibrio_phage	41.4	2.4e-124
>prophage 21
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	321547	322192	709850		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_044045511.1|321547_322192_-	septal ring lytic transglycosylase RlpA family protein	NA	A0A0F6SJ38	Sinorhizobium_phage	37.9	3.7e-14
>prophage 22
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	327289	328450	709850		Bacillus_phage(100.0%)	1	NA	NA
WP_009228942.1|327289_328450_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.5	4.3e-05
>prophage 23
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	360363	361311	709850		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_009228850.1|360363_361311_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	44.4	2.0e-56
>prophage 24
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	364387	367913	709850		Tupanvirus(50.0%)	3	NA	NA
WP_009228847.1|364387_366001_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.3e-44
WP_009228846.1|366120_366699_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_009228845.1|366740_367913_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.4	9.4e-24
>prophage 25
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	375723	376479	709850		Tupanvirus(100.0%)	1	NA	NA
WP_009228839.1|375723_376479_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.7	8.8e-15
>prophage 26
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	387521	388559	709850	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_009228830.1|387521_388559_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	32.1	1.9e-28
>prophage 27
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	407746	418678	709850	tRNA	Ralstonia_phage(16.67%)	13	NA	NA
WP_009228809.1|407746_409747_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.3	2.7e-111
WP_009228808.1|409796_410633_-	type II pantothenate kinase	NA	NA	NA	NA	NA
WP_009228807.1|411271_412174_+	LysM peptidoglycan-binding domain-containing protein	NA	S5M9Y4	Brevibacillus_phage	42.1	5.9e-18
WP_009228806.1|412198_412705_+	DMP19 family protein	NA	NA	NA	NA	NA
WP_009228805.1|412758_413238_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	50.4	4.7e-30
WP_009228804.1|413382_414243_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_009228803.1|414257_415289_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.1	3.8e-69
WP_009228802.1|415288_415804_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	42.1	6.8e-19
WP_009228801.1|415964_416228_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_009228800.1|416234_416423_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_009228799.1|416457_416616_+	DUF4295 domain-containing protein	NA	NA	NA	NA	NA
WP_009228798.1|416819_417440_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_009228797.1|417598_418678_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.1	2.0e-81
>prophage 28
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	428166	452580	709850	tRNA	Streptococcus_phage(22.22%)	16	NA	NA
WP_009228784.1|428166_429021_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	1.5e-39
WP_009228783.1|429053_430622_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.5	2.2e-36
WP_009228782.1|431596_433294_-	putative transporter	NA	NA	NA	NA	NA
WP_009228781.1|433318_434800_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	40.9	2.0e-95
WP_009228780.1|434928_435606_+	OmpA family protein	NA	NA	NA	NA	NA
WP_044045474.1|435674_436382_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_009228778.1|436435_438847_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	38.6	2.9e-112
WP_009228777.1|439084_440857_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	28.0	1.6e-11
WP_009228776.1|440865_442044_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_009228775.1|441928_442738_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	42.9	1.5e-57
WP_009228774.1|442917_443988_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_044045515.1|444235_445753_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	25.5	5.1e-30
WP_009228772.1|445930_446200_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_009228771.1|446348_448154_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	27.1	3.4e-25
WP_009228770.1|448590_449790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009228769.1|449940_452580_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.2	3.3e-149
>prophage 29
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	458996	473282	709850	tRNA	uncultured_Mediterranean_phage(40.0%)	8	NA	NA
WP_009228761.1|458996_460286_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	34.9	5.6e-62
WP_009228760.1|460570_462100_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	25.7	1.6e-31
WP_009228759.1|462108_462837_-	PorT family protein	NA	NA	NA	NA	NA
WP_009228758.1|462858_464223_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009228757.1|464319_465036_+	T9SS type B sorting domain-containing protein	NA	NA	NA	NA	NA
WP_009228756.1|465086_467933_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	50.6	1.9e-272
WP_009228755.1|468065_469979_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.8	4.3e-74
WP_009228753.1|471938_473282_-	purine permease	NA	H9YQ34	environmental_Halophage	50.0	5.9e-22
>prophage 30
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	482060	485042	709850		Mollivirus(50.0%)	2	NA	NA
WP_009228743.1|482060_483962_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	21.7	1.3e-09
WP_009228742.1|483968_485042_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	1.2e-49
>prophage 31
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	489193	508443	709850	tRNA,integrase	unidentified_phage(33.33%)	15	481594:481608	505588:505602
481594:481608	attL	GTGTAACGGTGCTTG	NA	NA	NA	NA
WP_009228739.1|489193_490912_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.9	4.1e-161
WP_009228738.1|491201_491927_-	nitroreductase	NA	NA	NA	NA	NA
WP_009228737.1|492042_493137_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_020967939.1|493672_494902_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	37.0	3.1e-25
WP_009228736.1|494927_496247_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.0	4.4e-22
WP_009228735.1|496243_496669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009228734.1|496904_497327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009228733.1|498299_501413_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.2	2.2e-64
WP_025829755.1|501415_502639_+	TolC family protein	NA	NA	NA	NA	NA
WP_009228732.1|502635_503535_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044045481.1|503531_503717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009228731.1|503762_505634_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.4	1.9e-98
505588:505602	attR	GTGTAACGGTGCTTG	NA	NA	NA	NA
WP_020967940.1|506129_506426_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009229098.1|506441_506729_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018361489.1|507159_508443_+	virulence-associated protein E	NA	F8UBM0	Clostridium_phage	28.6	3.7e-13
>prophage 32
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	522099	533624	709850	tRNA	Euphorbia_ringspot_virus(25.0%)	5	NA	NA
WP_009228547.1|522099_522705_-	non-canonical purine NTP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.2	1.2e-11
WP_020967944.1|522670_523648_-	YitT family protein	NA	NA	NA	NA	NA
WP_009228549.1|523679_526550_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.4	2.9e-207
WP_020967945.1|527063_530348_+	DUF4981 domain-containing protein	NA	B9U1H7	Vaccinia_virus	32.9	1.1e-138
WP_156860548.1|532499_533624_+	hypothetical protein	NA	Q8QNF3	Ectocarpus_siliculosus_virus	39.8	1.4e-24
>prophage 33
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	541424	543743	709850		Tupanvirus(100.0%)	1	NA	NA
WP_009228558.1|541424_543743_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	38.1	3.6e-136
>prophage 34
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	553490	557006	709850	coat	Mycobacterium_phage(50.0%)	3	NA	NA
WP_009228567.1|553490_554909_+|coat	spore coat protein CotH	coat	G1FGA4	Mycobacterium_phage	28.6	3.9e-08
WP_009228568.1|555548_556127_+	YkgB family protein	NA	NA	NA	NA	NA
WP_009228569.1|556373_557006_+	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	36.6	1.3e-27
>prophage 35
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	576283	582321	709850	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_009228583.1|576283_578329_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	32.4	1.0e-78
WP_009228584.1|578435_579440_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009228585.1|579500_580319_-	glycerol acyltransferase	NA	NA	NA	NA	NA
WP_009228586.1|580665_582321_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.7	1.0e-15
>prophage 36
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	624135	624825	709850		Wolbachia_phage(100.0%)	1	NA	NA
WP_009228611.1|624135_624825_-	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	23.2	2.1e-15
>prophage 37
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	630845	634597	709850		Aeromonas_virus(50.0%)	3	NA	NA
WP_009228620.1|630845_631361_-	CYTH domain-containing protein	NA	Q76Z87	Aeromonas_virus	30.4	6.0e-07
WP_009228622.1|631601_632723_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_009228623.1|632788_634597_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.0	5.9e-41
>prophage 38
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	642761	644213	709850		Microcystis_virus(100.0%)	1	NA	NA
WP_009228631.1|642761_644213_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7F1	Microcystis_virus	30.7	6.2e-09
>prophage 39
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	652855	670936	709850	integrase	Acinetobacter_phage(16.67%)	14	643610:643626	664560:664576
643610:643626	attL	CGACTATCCAGTTGTAG	NA	NA	NA	NA
WP_020967966.1|652855_654652_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	40.0	7.9e-123
WP_009228640.1|654923_655916_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_009228641.1|656309_656501_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_009228642.1|656581_657475_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	25.6	1.3e-17
WP_044045493.1|657491_657791_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_009228643.1|658331_659522_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.8	1.4e-30
WP_009228644.1|659679_659871_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_009228645.1|659884_660430_+	transcription termination/antitermination factor NusG	NA	A0A291AUS6	Sinorhizobium_phage	30.6	1.5e-16
WP_009228646.1|660491_660932_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_009228647.1|660954_661647_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_009228648.1|661665_662184_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_009228649.1|662231_662609_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_009228650.1|662751_666561_+	DNA-directed RNA polymerase subunit beta	NA	F2Y186	Organic_Lake_phycodnavirus	37.5	2.8e-32
664560:664576	attR	CGACTATCCAGTTGTAG	NA	NA	NA	NA
WP_009228651.1|666598_670936_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.9	6.5e-54
>prophage 40
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	678860	679193	709850		Bacillus_phage(100.0%)	1	NA	NA
WP_009228658.1|678860_679193_+	TM2 domain-containing protein	NA	A0A1B0T6B3	Bacillus_phage	47.2	9.5e-06
>prophage 41
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	685957	688072	709850		Streptococcus_phage(100.0%)	1	NA	NA
WP_009228665.1|685957_688072_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.2	7.8e-53
>prophage 42
NC_022124	Prevotella sp. oral taxon 299 str. F0039, complete genome	709850	707165	708392	709850		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_009228699.1|707165_708392_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	32.6	1.1e-19
