The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014638	Bifidobacterium bifidum PRL2010, complete sequence	2214656	22225	108820	2214656	transposase,protease,integrase,tRNA	Enterobacteria_phage(26.67%)	60	13890:13912	24267:24289
13890:13912	attL	TGTATCTGCGAGTTTTGAGAGCG	NA	NA	NA	NA
WP_013389330.1|22225_23167_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IY74	Mycobacterium_phage	30.4	1.5e-27
WP_013389331.1|23531_24041_+	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_003815054.1|24557_25904_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
24267:24289	attR	TGTATCTGCGAGTTTTGAGAGCG	NA	NA	NA	NA
WP_047290037.1|26006_26714_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815058.1|26860_27295_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_013389333.1|27670_31168_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_155403038.1|31759_31927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013389334.1|31920_34257_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_003817399.1|34730_35783_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.4	3.8e-16
WP_003817398.1|36112_36562_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003817396.1|36685_36958_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_013389335.1|37023_38541_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_013389336.1|38826_39567_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003815072.1|39754_40234_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_013389337.1|40675_41749_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_003815077.1|41784_43107_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_013389339.1|43315_43864_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013389340.1|44007_44691_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003817384.1|44973_45537_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_013389341.1|45879_47793_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	36.2	1.8e-48
WP_013389342.1|48085_49372_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_013362858.1|49870_52627_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_013362859.1|53058_55029_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_047289795.1|55101_56193_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003819920.1|56766_57786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815099.1|58259_59357_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815101.1|59497_59878_+	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_013389343.1|60720_61326_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013389344.1|61513_62539_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	3.8e-77
WP_013389345.1|62880_65484_+	RICIN domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	30.8	3.2e-16
WP_013389346.1|65537_66509_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	48.2	2.9e-79
WP_013389349.1|68483_68990_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.9	7.4e-26
WP_013389350.1|69251_70712_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_057081738.1|71618_73220_-	glucosyltransferase domain-containing protein	NA	O21944	Shigella_phage	20.6	5.4e-06
WP_164930364.1|73248_74628_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_013389355.1|74764_76660_+	rhamnan synthesis F family protein	NA	NA	NA	NA	NA
WP_013389356.1|76661_77705_+	acyltransferase	NA	NA	NA	NA	NA
WP_047290044.1|77790_78627_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013389361.1|81090_82593_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_013389362.1|82589_83375_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.6	3.3e-33
WP_047289802.1|83470_84217_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.7	6.2e-37
WP_013389365.1|85450_86482_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.5	1.0e-10
WP_013389366.1|86581_87175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165442594.1|88925_89090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143067600.1|89267_89432_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080959228.1|89447_89753_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013389370.1|89806_90712_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	60.7	1.1e-96
WP_013389371.1|90708_92139_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_013389372.1|92195_93218_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.3	3.5e-75
WP_164930365.1|93421_94264_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013389374.1|94267_95524_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_013389377.1|96931_98299_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_047271255.1|99210_99396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013389378.1|99626_101678_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A2H4PQR6	Staphylococcus_phage	25.7	3.4e-05
WP_003811371.1|103160_103505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003823904.1|103710_104118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013389382.1|104454_106908_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	4.5e-12
WP_080545144.1|107076_107319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811385.1|107626_107848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013362938.1|108034_108820_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NC_014638	Bifidobacterium bifidum PRL2010, complete sequence	2214656	1068590	1110983	2214656	capsid,tRNA,terminase,portal,integrase,holin,tail	Bifidobacterium_phage(100.0%)	60	1068643:1068659	1105715:1105731
WP_013389848.1|1068590_1069691_+|tRNA	tRNA (adenine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
1068643:1068659	attL	ACCGCAAGGGCAAGAAG	NA	NA	NA	NA
WP_013389849.1|1069810_1070368_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
WP_013389850.1|1070623_1071844_+|integrase	site-specific integrase	integrase	I3NLE2	Bifidobacterium_phage	100.0	8.9e-243
WP_164930378.1|1071932_1072574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003812975.1|1072622_1072829_-	hypothetical protein	NA	I3NLD9	Bifidobacterium_phage	100.0	4.8e-32
WP_003812981.1|1072830_1072971_-	hypothetical protein	NA	I3NLD8	Bifidobacterium_phage	100.0	1.1e-16
WP_013389854.1|1073280_1074198_+	hypothetical protein	NA	I3NLD6	Bifidobacterium_phage	100.0	5.4e-168
WP_013389855.1|1074244_1074652_-	hypothetical protein	NA	I3NLD5	Bifidobacterium_phage	100.0	7.4e-77
WP_003812988.1|1075327_1076032_-	DUF3800 domain-containing protein	NA	I3NLD4	Bifidobacterium_phage	100.0	2.1e-135
WP_164930363.1|1076051_1076327_-	hypothetical protein	NA	I3NLD3	Bifidobacterium_phage	98.6	1.9e-31
WP_013389857.1|1076576_1076822_+	helix-turn-helix domain-containing protein	NA	I3NLD2	Bifidobacterium_phage	100.0	6.5e-36
WP_164930379.1|1077088_1077667_-	hypothetical protein	NA	I3NLD1	Bifidobacterium_phage	100.0	1.9e-73
WP_013389859.1|1077649_1078444_+	phage antirepressor Ant	NA	I3NLD0	Bifidobacterium_phage	100.0	2.6e-150
WP_003812999.1|1078591_1079047_-	hypothetical protein	NA	I3NLC9	Bifidobacterium_phage	99.1	2.5e-65
WP_013389860.1|1079328_1079571_-	hypothetical protein	NA	I3NLC8	Bifidobacterium_phage	98.4	1.7e-28
WP_003820448.1|1079690_1079924_+	DNA-binding protein	NA	I3NLC7	Bifidobacterium_phage	100.0	1.9e-37
WP_003820450.1|1079952_1080168_+	hypothetical protein	NA	I3NLC6	Bifidobacterium_phage	98.0	1.3e-19
WP_013389861.1|1080164_1080404_+	hypothetical protein	NA	I3NLC5	Bifidobacterium_phage	100.0	2.3e-38
WP_013389862.1|1080683_1081028_+	hypothetical protein	NA	I3NLC4	Bifidobacterium_phage	100.0	5.9e-59
WP_013389863.1|1081027_1081558_+	single-stranded DNA-binding protein	NA	I3NLC3	Bifidobacterium_phage	100.0	6.6e-94
WP_013389864.1|1081576_1082974_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	100.0	3.7e-277
WP_013389865.1|1082970_1083888_+	helix-turn-helix domain-containing protein	NA	I3NLC1	Bifidobacterium_phage	100.0	7.3e-157
WP_003813015.1|1083884_1084076_+	hypothetical protein	NA	I3NLC0	Bifidobacterium_phage	100.0	3.3e-27
WP_003813016.1|1084072_1084477_+	hypothetical protein	NA	I3NLB9	Bifidobacterium_phage	100.0	5.8e-82
WP_003820462.1|1084473_1085052_+	oligoribonuclease Orn	NA	I3NLB8	Bifidobacterium_phage	100.0	8.5e-111
WP_003813021.1|1085051_1085330_+	hypothetical protein	NA	I3NLB7	Bifidobacterium_phage	100.0	4.9e-48
WP_003813023.1|1085326_1085632_+	hypothetical protein	NA	I3NLB6	Bifidobacterium_phage	100.0	6.8e-51
WP_003813024.1|1085634_1085832_+	hypothetical protein	NA	I3NLB5	Bifidobacterium_phage	100.0	4.7e-29
WP_013389867.1|1085885_1086635_+	hypothetical protein	NA	I3NLB4	Bifidobacterium_phage	100.0	2.8e-146
WP_029414628.1|1086667_1086865_+	type II toxin-antitoxin system HicA family toxin	NA	I3NLB3	Bifidobacterium_phage	98.5	1.6e-32
WP_003813029.1|1086861_1087272_+	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	100.0	3.1e-75
WP_003813031.1|1087273_1087441_+	transcriptional regulator	NA	I3NLB1	Bifidobacterium_phage	100.0	4.6e-25
WP_003813034.1|1087593_1087797_-	hypothetical protein	NA	I3NLB0	Bifidobacterium_phage	100.0	7.2e-33
WP_013389869.1|1087786_1087945_-	hypothetical protein	NA	I3NLA9	Bifidobacterium_phage	100.0	1.6e-19
WP_164930380.1|1088239_1088617_+	HNH endonuclease	NA	I3NLA7	Bifidobacterium_phage	98.6	1.5e-36
WP_013389872.1|1088902_1089490_+	bifunctional DNA primase/polymerase	NA	I3NLA6	Bifidobacterium_phage	100.0	1.5e-115
WP_003813042.1|1089509_1089899_+	hypothetical protein	NA	I3NLA5	Bifidobacterium_phage	100.0	1.4e-69
WP_013389873.1|1089898_1091701_+|terminase	terminase	terminase	I3NLA4	Bifidobacterium_phage	100.0	0.0e+00
WP_013389874.1|1091694_1093101_+|portal	phage portal protein	portal	I3NLA3	Bifidobacterium_phage	99.8	2.8e-280
WP_013389875.1|1093084_1094299_+	EndoU domain-containing protein	NA	I3NLA2	Bifidobacterium_phage	100.0	2.2e-241
WP_003816704.1|1094295_1094556_+	hypothetical protein	NA	I3NLA1	Bifidobacterium_phage	100.0	1.8e-44
WP_003816702.1|1094892_1095447_+	hypothetical protein	NA	I3NLA0	Bifidobacterium_phage	100.0	1.5e-96
WP_013389876.1|1095476_1096433_+|capsid	phage major capsid protein	capsid	I3NL99	Bifidobacterium_phage	100.0	6.6e-177
WP_013389877.1|1096432_1096867_+	hypothetical protein	NA	I3NL98	Bifidobacterium_phage	100.0	3.1e-65
WP_003816697.1|1096880_1097378_+	hypothetical protein	NA	I3NL97	Bifidobacterium_phage	100.0	2.2e-91
WP_003813058.1|1097374_1097809_+	hypothetical protein	NA	I3NL96	Bifidobacterium_phage	98.9	1.4e-44
WP_003813060.1|1097798_1098227_+	hypothetical protein	NA	I3NL95	Bifidobacterium_phage	100.0	1.4e-73
WP_003813063.1|1098223_1098634_+	transcriptional regulator	NA	I3NL94	Bifidobacterium_phage	100.0	8.5e-73
WP_013389878.1|1098707_1099250_+	hypothetical protein	NA	I3NL93	Bifidobacterium_phage	100.0	5.5e-96
WP_013389879.1|1099344_1099851_+	DNAase primase	NA	I3NL92	Bifidobacterium_phage	100.0	1.6e-84
WP_003813069.1|1099913_1100210_+	hypothetical protein	NA	I3NL91	Bifidobacterium_phage	100.0	6.4e-54
WP_013389880.1|1100220_1103355_+|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	100.0	0.0e+00
WP_013389881.1|1103351_1104131_+	3-hydroxy-3-methylglutaryl CoA synthase	NA	I3NL89	Bifidobacterium_phage	100.0	1.5e-147
WP_013389882.1|1104132_1105995_+|tail	phage tail protein	tail	I3NL88	Bifidobacterium_phage	100.0	0.0e+00
1105715:1105731	attR	ACCGCAAGGGCAAGAAG	NA	NA	NA	NA
WP_013389883.1|1106005_1106407_+	major factor subunit	NA	I3NL87	Bifidobacterium_phage	100.0	1.4e-67
WP_013389884.1|1106403_1108236_+|tail	tail fiber protein	tail	I3NL86	Bifidobacterium_phage	100.0	8.1e-216
WP_033509724.1|1108336_1109110_+	hypothetical protein	NA	I3NL85	Bifidobacterium_phage	99.6	3.6e-72
WP_003822313.1|1109102_1109510_+	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	100.0	3.0e-70
WP_013389886.1|1109740_1110166_+|holin	phagic holin Spp1 family protein	holin	I3NL83	Bifidobacterium_phage	100.0	1.5e-67
WP_013389887.1|1110149_1110983_+	CHAP domain-containing protein	NA	I3NL82	Bifidobacterium_phage	100.0	3.1e-130
