The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	69671	78190	4840251		Enterobacteria_phage(33.33%)	10	NA	NA
WP_014609527.1|69671_70652_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.7	6.5e-10
WP_014609528.1|70689_71781_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.7	1.6e-97
WP_014609529.1|71823_72699_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.7	1.4e-109
WP_014609530.1|72702_73125_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_014609531.1|73102_73573_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014609532.1|73565_74678_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.7	1.1e-42
WP_014609533.1|74737_75796_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_014609534.1|75834_76602_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014609535.1|76714_77599_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	39.2	5.8e-42
WP_011920285.1|77644_78190_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.4	1.6e-50
>prophage 2
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	127722	136260	4840251		Bacillus_phage(50.0%)	8	NA	NA
WP_014609564.1|127722_129087_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	25.4	3.1e-10
WP_014609565.1|129079_129775_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	26.5	1.1e-06
WP_014609566.1|129777_130080_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_041411871.1|130484_131429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011920253.1|131510_131984_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	47.4	5.5e-23
WP_014609568.1|132064_134047_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.9	3.1e-11
WP_014609569.1|134175_135492_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	5.4e-12
WP_011787527.1|135534_136260_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	1.3e-31
>prophage 3
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	800014	846824	4840251	integrase,transposase	Leptospira_phage(20.0%)	48	799803:799832	856535:856564
799803:799832	attL	CTGAATTTTAGATACAAAAAAACCGACGCT	NA	NA	NA	NA
WP_014609872.1|800014_801298_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011790088.1|801459_802962_-|transposase	IS66-like element ISShes9 family transposase	transposase	S5VTD3	Leptospira_phage	35.8	2.0e-79
WP_011790089.1|803042_803393_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.9	1.3e-18
WP_014611559.1|803389_803725_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014609874.1|805442_806525_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_014609875.1|806718_807105_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014609876.1|807253_807874_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_049789521.1|808104_808443_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014609877.1|808616_809135_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014609878.1|809161_809521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609879.1|809793_810150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609880.1|810469_810691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609881.1|810953_811346_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_014609882.1|811374_812166_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_014609883.1|812284_813031_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_014609884.1|813030_813267_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_014609885.1|814244_814484_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014609886.1|815067_815445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609887.1|817703_817976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609889.1|818561_819473_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_014609890.1|819469_820051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609891.1|820121_820418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609892.1|821029_823006_+	AAA family ATPase	NA	A0A2H4J1E0	uncultured_Caudovirales_phage	32.9	4.8e-28
WP_014609893.1|822991_824026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609894.1|824668_824983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609895.1|825254_825464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609896.1|825590_826052_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011787749.1|826524_826857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011787748.1|826882_827413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011787747.1|827432_828128_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_014609897.1|828117_831261_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_014609898.1|831272_832517_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014609899.1|832525_833809_-	TolC family protein	NA	NA	NA	NA	NA
WP_014609900.1|833822_834803_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_014609901.1|834811_835189_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_011787741.1|835278_835638_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_014609902.1|835895_837368_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	51.1	4.4e-127
WP_014609903.1|838622_839972_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	26.7	1.2e-17
WP_014609904.1|840083_840530_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_014609905.1|840865_841825_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	39.5	1.3e-52
WP_014609906.1|841934_843191_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	40.9	2.1e-85
WP_014609907.1|843191_843599_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1B1ITQ0	uncultured_Mediterranean_phage	44.9	1.5e-21
WP_014609908.1|843660_843891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609909.1|843997_844321_-	putative lipoprotein	NA	NA	NA	NA	NA
WP_014609910.1|844355_844925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041411916.1|844978_845191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840012.1|845664_845955_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	37.2	5.4e-05
WP_011840011.1|846014_846824_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.1	1.9e-44
856535:856564	attR	CTGAATTTTAGATACAAAAAAACCGACGCT	NA	NA	NA	NA
>prophage 4
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	1603303	1614196	4840251	transposase	uncultured_virus(16.67%)	6	NA	NA
WP_014610245.1|1603303_1605538_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.7	9.0e-92
WP_025007472.1|1605909_1607478_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.0	2.5e-56
WP_014610247.1|1607584_1608118_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	50.9	1.0e-46
WP_014610248.1|1608287_1610963_-	FAD-binding protein	NA	A0A0B5JBT9	Pandoravirus	39.5	1.1e-24
WP_014610249.1|1611069_1612089_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.1	3.2e-12
WP_014610250.1|1613161_1614196_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	23.4	3.1e-10
>prophage 5
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	2106485	2116602	4840251		Faustovirus(12.5%)	13	NA	NA
WP_014610488.1|2106485_2107700_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	32.4	1.1e-32
WP_011789190.1|2107738_2108122_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	2.2e-51
WP_011789191.1|2108136_2108460_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.3	8.3e-23
WP_011789192.1|2108476_2109001_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_014610489.1|2109069_2110932_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.8	1.1e-103
WP_011789194.1|2110940_2111279_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011789195.1|2111437_2112343_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.6	9.4e-40
WP_011789196.1|2112413_2112611_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_014610490.1|2112841_2113009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011789197.1|2113206_2113638_+	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	40.2	1.1e-17
WP_011789198.1|2113875_2114319_+	Hsp20 family protein	NA	A0A2L0V0Y9	Agrobacterium_phage	49.5	2.4e-20
WP_011789199.1|2114389_2114884_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_014610491.1|2114883_2116602_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.3	5.2e-55
>prophage 6
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	2278804	2290064	4840251	tRNA	uncultured_Caudovirales_phage(42.86%)	13	NA	NA
WP_014610566.1|2278804_2281495_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.5	8.3e-84
WP_014610567.1|2281571_2282198_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_014610568.1|2282206_2283538_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	4.4e-78
WP_011789326.1|2283530_2283905_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	37.0	6.3e-06
WP_014610569.1|2283923_2285210_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.5	1.5e-99
WP_011789328.1|2285227_2285350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011789329.1|2285445_2285784_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_011789330.1|2285777_2286059_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_011789331.1|2286058_2286415_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_011789332.1|2286429_2286819_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	41.7	6.1e-20
WP_011789333.1|2286879_2287539_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	43.4	2.1e-33
WP_014610570.1|2287771_2288674_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014610571.1|2288789_2290064_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.8	7.3e-14
>prophage 7
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	2883417	2952846	4840251	tRNA,transposase	Acinetobacter_phage(14.29%)	55	NA	NA
WP_011788863.1|2883417_2884542_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.8	6.3e-94
WP_011919550.1|2884701_2885739_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011788861.1|2885795_2886014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014610845.1|2886120_2886735_+	DUF479 domain-containing protein	NA	NA	NA	NA	NA
WP_011919552.1|2886946_2887618_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_011788858.1|2887674_2888109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014610846.1|2888431_2889811_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014610847.1|2889873_2890398_-	CIA30 family protein	NA	NA	NA	NA	NA
WP_014610848.1|2890474_2891698_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_011788854.1|2891851_2892751_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	1.8e-27
WP_011788853.1|2892882_2893353_-	protein phosphatase	NA	NA	NA	NA	NA
WP_014610849.1|2893417_2894701_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.1	8.4e-42
WP_014610850.1|2894748_2895306_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	55.4	7.9e-21
WP_014610851.1|2895366_2897058_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_041412019.1|2897225_2897534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041412022.1|2897593_2898403_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	34.7	4.8e-43
WP_014610852.1|2898614_2902343_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_014610853.1|2902320_2903601_-	radical SAM protein	NA	NA	NA	NA	NA
WP_014610854.1|2903597_2904395_-	taurine catabolism dioxygenase tauD/tfdA	NA	NA	NA	NA	NA
WP_014610855.1|2904397_2904898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014610856.1|2905265_2907095_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	1.0e-29
WP_014610857.1|2909342_2910752_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_041412025.1|2911977_2912169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014610858.1|2912395_2913418_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014610859.1|2913480_2914125_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_014610860.1|2914124_2915522_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_011788844.1|2915633_2917445_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	29.9	1.4e-05
WP_011788843.1|2917441_2918821_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_014610861.1|2918927_2921999_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011788841.1|2922101_2922680_-	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	54.5	4.3e-54
WP_014610862.1|2923222_2925325_+	cytochrome c	NA	NA	NA	NA	NA
WP_011788839.1|2925525_2927679_+	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	21.4	5.2e-20
WP_011919562.1|2927750_2929319_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_014610863.1|2929691_2930618_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_011788836.1|2930618_2931368_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011788835.1|2931680_2932073_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_041412028.1|2932252_2932447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206290.1|2932562_2933771_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
WP_041412030.1|2933767_2934526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206290.1|2934564_2935773_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
WP_049789537.1|2935809_2938053_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_014610864.1|2938052_2939369_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_014610865.1|2939445_2939826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610866.1|2939964_2940699_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_014610867.1|2940699_2941329_+	acyltransferase	NA	NA	NA	NA	NA
WP_014610868.1|2941535_2943251_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014610869.1|2943393_2944518_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_014610870.1|2945001_2945250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610871.1|2945397_2946108_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_014610872.1|2946116_2946902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610873.1|2946901_2949271_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_014610874.1|2949379_2950474_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_014610875.1|2950507_2951047_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.4	6.2e-47
WP_011840011.1|2951686_2952496_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.1	1.9e-44
WP_011840012.1|2952555_2952846_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	37.2	5.4e-05
>prophage 8
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	2961837	3047674	4840251	integrase,transposase	Bluetongue_virus(11.11%)	107	2963841:2963900	3034266:3034285
WP_011840011.1|2961837_2962647_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.1	1.9e-44
WP_011840012.1|2962706_2962997_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	37.2	5.4e-05
WP_049789539.1|2963011_2963341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789540.1|2963527_2963779_+	hypothetical protein	NA	NA	NA	NA	NA
2963841:2963900	attL	AAGGCAGAAAAATCTGCCGAAGCTATGCAATTAGCCCAATCAATTACGGACATGCAGGCA	NA	NA	NA	NA
WP_001206290.1|2963918_2965127_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
2963841:2963900	attL	AAGGCAGAAAAATCTGCCGAAGCTATGCAATTAGCCCAATCAATTACGGACATGCAGGCA	NA	NA	NA	NA
WP_014610885.1|2965834_2966848_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.9	7.0e-92
WP_041412037.1|2967423_2967858_-	hypothetical protein	NA	A0A218MNI5	uncultured_virus	72.3	5.2e-36
WP_041412039.1|2967990_2968497_+	mobile mystery protein A	NA	NA	NA	NA	NA
WP_014610886.1|2968532_2969822_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.2	4.7e-85
WP_003821921.1|2969843_2970356_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004364974.1|2970359_2971256_-	cation transporter	NA	NA	NA	NA	NA
WP_004364961.1|2971351_2971759_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_014610887.1|2971855_2972467_+	mobile mystery protein B	NA	NA	NA	NA	NA
WP_049789541.1|2972527_2972782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610888.1|2972866_2973121_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_014610889.1|2973117_2973459_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_014610890.1|2973622_2974015_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014610891.1|2973999_2975367_-	phosphatidylinositol kinase	NA	NA	NA	NA	NA
WP_014610892.1|2975721_2976039_-	CcdB family protein	NA	NA	NA	NA	NA
WP_014610893.1|2976038_2976284_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_041412043.1|2976864_2977047_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_014610895.1|2977759_2978677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014610896.1|2978885_2979155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610897.1|2979351_2980908_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_049789542.1|2980897_2981653_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	34.8	5.3e-36
WP_014610899.1|2981642_2982131_+	DnaG primase-like protein	NA	NA	NA	NA	NA
WP_014610900.1|2982111_2983086_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K830	Mycobacterium_phage	27.0	3.3e-14
WP_014610901.1|2983158_2983455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610902.1|2983464_2984058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610903.1|2984105_2984705_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_014610904.1|2984705_2985131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006087376.1|2985481_2985817_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_006087375.1|2985816_2986062_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_011979512.1|2986258_2986660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041412050.1|2987323_2987782_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014610905.1|2988058_2988388_-	mRNA-degrading endonuclease	NA	Q708N9	Streptococcus_phage	51.0	3.8e-07
WP_014610906.1|2988387_2988642_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014610907.1|2988913_2989213_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014610908.1|2989205_2989448_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_014610909.1|2989534_2989768_-	HipA protein	NA	NA	NA	NA	NA
WP_014610910.1|2989760_2990087_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049789543.1|2990721_2991903_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	35.4	2.3e-38
WP_014610912.1|2991960_2992374_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	41.4	3.0e-25
WP_014610913.1|2992471_2994193_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_014610914.1|2994702_2995620_-|transposase	IS5-like element ISSpu16 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	56.9	1.1e-96
WP_008114006.1|2995702_2995945_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	56.2	1.5e-16
WP_024606882.1|2996391_2996598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041412056.1|2996685_2996889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609561.1|2996866_2997898_-|transposase	IS630-like element ISSpu23 family transposase	transposase	NA	NA	NA	NA
WP_008114000.1|2998005_2998296_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_008113998.1|2998297_2998537_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_014610915.1|2998879_3000106_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	29.6	7.5e-32
WP_049789544.1|3000214_3000454_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG20	Helicobacter_phage	39.7	2.4e-11
WP_014610916.1|3001016_3002225_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.1	1.5e-170
WP_014610917.1|3002281_3002461_-	CCGSCS motif protein	NA	NA	NA	NA	NA
WP_014610918.1|3003834_3004575_+	hypothetical protein	NA	NA	NA	NA	NA
3004207:3004271	attR	AAGGCAGAAAAATCTGCCGAAGCTATGCAATTAGCCCAATCAATTACGGACATGCAGGCACAGCA	NA	NA	NA	NA
WP_011074401.1|3004705_3004948_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
3004207:3004271	attR	AAGGCAGAAAAATCTGCCGAAGCTATGCAATTAGCCCAATCAATTACGGACATGCAGGCACAGCA	NA	NA	NA	NA
WP_014610919.1|3005147_3005783_+	recombinase family protein	NA	NA	NA	NA	NA
WP_014610920.1|3007196_3007559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610921.1|3008258_3008495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610922.1|3008494_3010132_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014610923.1|3010097_3013046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610924.1|3013053_3014568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610925.1|3014970_3016137_+	DUF3596 domain-containing protein	NA	A0A0P0ZGA8	Escherichia_phage	24.3	1.1e-19
WP_014610926.1|3016210_3016936_+	ATPase AAA	NA	NA	NA	NA	NA
WP_014610885.1|3017447_3018461_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.9	7.0e-92
WP_049789545.1|3019016_3019466_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	70.8	4.1e-44
WP_014610927.1|3019598_3020087_+	mobile mystery protein A	NA	NA	NA	NA	NA
WP_014610928.1|3020083_3020695_+	mobile mystery protein B	NA	NA	NA	NA	NA
WP_049789546.1|3020755_3021007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610888.1|3021091_3021346_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_014610929.1|3021342_3021684_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_014610890.1|3021847_3022240_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014610930.1|3022224_3023592_-	phosphatidylinositol kinase	NA	NA	NA	NA	NA
WP_014610892.1|3023946_3024264_-	CcdB family protein	NA	NA	NA	NA	NA
WP_014610893.1|3024263_3024509_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_041412043.1|3025091_3025274_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_014610931.1|3025538_3026789_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_014610932.1|3026785_3027103_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041412063.1|3027374_3027659_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041412361.1|3027709_3028117_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.6	9.8e-13
WP_041412050.1|3028169_3028628_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014610933.1|3028904_3029234_-	mRNA-degrading endonuclease	NA	Q708N9	Streptococcus_phage	51.0	3.8e-07
WP_041412362.1|3029233_3029488_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014610935.1|3029759_3030059_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014610908.1|3030051_3030294_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_049789547.1|3030368_3030740_+	DUF3596 domain-containing protein	NA	NA	NA	NA	NA
WP_049789548.1|3030739_3031015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610936.1|3031007_3031376_-	DNA-binding protein	NA	A0A0P0ZCT8	Stx2-converting_phage	47.4	6.8e-21
WP_014610937.1|3031386_3031686_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	45.2	2.2e-14
WP_014610938.1|3032000_3032285_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014610939.1|3032274_3032514_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_041412066.1|3032629_3033286_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	39.5	1.6e-33
WP_014610940.1|3033361_3033676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014610941.1|3033666_3034083_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_014610942.1|3034550_3034757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041412068.1|3034876_3036085_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_014610944.1|3036312_3036660_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014610945.1|3036661_3036922_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014610946.1|3037300_3038653_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014610947.1|3038748_3039810_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_014610948.1|3039954_3041028_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_014610950.1|3041561_3042728_-	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	57.1	4.0e-115
WP_014610952.1|3043044_3044049_-	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	30.7	7.1e-12
WP_049789549.1|3045658_3045868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041412070.1|3046096_3046369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206290.1|3046465_3047674_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
>prophage 9
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	3253152	3264150	4840251	tRNA	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_014611058.1|3253152_3255777_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.9	1.6e-79
WP_014611059.1|3256117_3256531_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_011788615.1|3256605_3257679_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.2	1.1e-111
WP_014611060.1|3258062_3260633_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	1.2e-31
WP_014611061.1|3261791_3262676_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	31.9	6.9e-11
WP_014611062.1|3262768_3263404_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	4.1e-34
WP_011788610.1|3263400_3264150_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.7	1.0e-71
>prophage 10
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	3296166	3303634	4840251		Staphylococcus_phage(50.0%)	8	NA	NA
WP_007646164.1|3296166_3296643_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.0	2.1e-30
WP_011788587.1|3296775_3297879_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	40.0	9.0e-69
WP_011919711.1|3297944_3298601_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.5	1.3e-27
WP_014611081.1|3298612_3299767_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.7	4.7e-52
WP_011788584.1|3299874_3300324_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_041412096.1|3300311_3300527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011919713.1|3300523_3301777_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	2.7e-101
WP_011788582.1|3301966_3303634_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	27.9	2.5e-38
>prophage 11
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	3655063	3721810	4840251	tRNA,protease,transposase	Tupanvirus(12.5%)	53	NA	NA
WP_014609561.1|3655063_3656095_+|transposase	IS630-like element ISSpu23 family transposase	transposase	NA	NA	NA	NA
WP_011919917.1|3656168_3656792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011919918.1|3657287_3657749_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_011788205.1|3658263_3658467_-	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_014611256.1|3658720_3660631_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.2	6.8e-72
WP_014611257.1|3660675_3661137_+	DUF2390 domain-containing protein	NA	NA	NA	NA	NA
WP_011788202.1|3661174_3661585_-	GFA family protein	NA	NA	NA	NA	NA
WP_041412379.1|3661586_3663197_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_011788200.1|3663265_3663772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041412137.1|3663881_3664910_+	hydrolase	NA	NA	NA	NA	NA
WP_011788198.1|3664893_3665139_+	YheU family protein	NA	NA	NA	NA	NA
WP_011788197.1|3665229_3666117_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_041408318.1|3666580_3667090_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011788195.1|3667312_3668605_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.5	3.9e-31
WP_014611261.1|3668789_3669494_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_007644947.1|3669657_3670101_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_014611262.1|3670277_3671177_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_014611263.1|3671292_3672777_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	36.7	6.7e-27
WP_011788191.1|3672776_3673259_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011788190.1|3673322_3674117_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_014611264.1|3674169_3675015_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_014611265.1|3675227_3675755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011788187.1|3676077_3676497_+	curlin	NA	NA	NA	NA	NA
WP_014611266.1|3676511_3678002_+	curlin	NA	NA	NA	NA	NA
WP_014611267.1|3678170_3678836_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011788184.1|3679229_3679838_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_011788183.1|3679992_3681222_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	49.6	1.1e-107
WP_014611268.1|3681372_3682329_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_014609977.1|3682378_3683701_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011788181.1|3683822_3684839_-	two-component system response regulator	NA	W8CYM9	Bacillus_phage	32.1	1.3e-10
WP_014611269.1|3684996_3690309_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	35.8	2.9e-80
WP_014611270.1|3690441_3691800_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_025007561.1|3691945_3692263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011788178.1|3692541_3693213_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	5.4e-24
WP_014611271.1|3693209_3695846_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014611272.1|3695842_3697054_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_011788175.1|3697377_3697647_+	chaperone NapD	NA	NA	NA	NA	NA
WP_011788174.1|3697643_3700124_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_014611273.1|3700177_3700912_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_014611274.1|3700908_3701880_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_014611275.1|3701876_3702308_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_014609977.1|3702528_3703851_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014611276.1|3703938_3704091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011788169.1|3704184_3705072_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014611277.1|3705227_3707321_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.2e-60
WP_014609696.1|3707954_3709340_+|transposase	IS4-like element ISSpu12 family transposase	transposase	NA	NA	NA	NA
WP_014611278.1|3709392_3713946_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_011788166.1|3714067_3714979_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014611279.1|3715059_3715872_-	class D beta-lactamase	NA	NA	NA	NA	NA
WP_014611280.1|3716199_3717354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611281.1|3717512_3718172_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_014611282.1|3718865_3719603_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_014611283.1|3720505_3721810_-|transposase	IS1380-like element ISSpu19 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	3727754	3748720	4840251	integrase,protease,transposase	Stx2-converting_phage(33.33%)	21	3733468:3733527	3738187:3739403
WP_049789569.1|3727754_3729257_-|transposase	IS66-like element ISSpu24 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	46.0	4.2e-117
WP_014611285.1|3729371_3729719_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.6	1.9e-33
WP_014611286.1|3729715_3730123_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014611287.1|3730467_3730872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611288.1|3730868_3732938_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_041412146.1|3732934_3733417_-	hypothetical protein	NA	NA	NA	NA	NA
3733468:3733527	attL	CGGACACTTAATTTTGAGACAGTATGGTCAATAAATTAAGAGGTCTATATGAGTCTGAAG	NA	NA	NA	NA
WP_011840012.1|3733515_3733806_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	37.2	5.4e-05
WP_011840011.1|3733865_3734675_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.1	1.9e-44
WP_014609561.1|3735259_3736291_+|transposase	IS630-like element ISSpu23 family transposase	transposase	NA	NA	NA	NA
WP_041412149.1|3736282_3737194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041412151.1|3737193_3738186_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011840012.1|3738234_3738525_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	37.2	5.4e-05
WP_011840011.1|3738584_3739394_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.1	1.9e-44
WP_041412154.1|3739370_3739889_-	hypothetical protein	NA	NA	NA	NA	NA
3738187:3739403	attR	CGGACACTTAATTTTGAGACAGTATGGTCAATAAATTAAGAGGTCTATATGAGTCTGAAGAAATCACATAAGAGTTATCCGCAGGCATTTAAAGATGAAGCCGTCTTGATGGTGCTAGAACAAGGTTATAGCGTTGCCGATGCGGCAAAGTCTCTTGGAGTTAGCACGAGCCTGCTTTACAACTGGAAGGAAAAACACGAAGCCCTGAAACAAGGTATCACCTTAGAAGAATCTGAGCGTGATGAGTTGAAACGATTGCGTAGAGAAAACAAAGAATTACGCATGGAGAAAGAAATTCTAAAAAAGGCAAGCGCCTTCTTTGCGAGAGAAATGAAGTAAGATTTCGTTTCATCAAACAGCAATCTAACCTGTTTCCTATAACACTGTTATGCCGAGTAATGAGTGTCAGTAAGTCAGGCTATTACGATTGGCATAAACGCCCTGCAAACGTGATAAGCCTTGAAACACTGAAGCTTTATCGCCTTGTTAGACAGCTATTTAAGCAAAGTCGAGGCAGCTTAGGAAATCGTGAAATGGTGAAGAAATTGCGCAAGGAAGGCTACCAGGTTGGTCGCTATCTCGTTCGTAAAATTATGCACCGCCTTCGACTCAAAGCAACCCAGCGACGCGCTTACAAGGTGACGACACAGCGAAAACACTCAGATGCAGTGGCAGATAACCTACTAAACATGAACTTTAACCCCGTATCGGCTAATGAGGTTTGGGCGGGTGACGTGACCTATTTAAAGACGGGTGAGGGCTGGATGTATTTAGCTGTGGTGATGGATTTATATTCACGCCGGATTGTGGGATGGCACATAGACAAACGCATGACCACGGATTTGATATCTAAGGCATTAATAAAAGCCTACAACCTGCGCCAACCGGCCAGAGGGCTGGTATTTCACAGTGACCGAGGCTCGCAATATACCAGTAAGCAATTCGGTAGGCTGCTATTGAGCTATGGTATCCGAGCCAGCATGGGTGATGTGGGAGCGTGTTGGGATAATGCCGTTGTTGAGCGATTCTTTGGCAGCTTAAAACACGATTGGATTTTTAAAGTTAATCAACCAACAAGGGAGTTTATGAAGCAAGATGTGACTGCTTACATGAAATATTACAACTTGGAGCGACTTCATTCTGCTAATGGTGATCTGTCACCTGTAGAGTTTGAAAATTCTCAACTAAAAGTGTCCAGTTTGGGTTGACCAGTACAA	NA	NA	NA	NA
WP_014611289.1|3740320_3741052_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_014611290.1|3741116_3742070_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011788159.1|3742156_3743479_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_014611291.1|3743630_3744674_+	methyltransferase	NA	NA	NA	NA	NA
WP_014611292.1|3745101_3746790_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_011788156.1|3746958_3747336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011919927.1|3747583_3748720_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 13
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	4200341	4234477	4840251	head,transposase	Vibrio_phage(26.92%)	39	NA	NA
WP_014611507.1|4200341_4207070_-	membrane protein	NA	A0A2L0V157	Salmonella_phage	32.1	8.5e-77
WP_049789555.1|4207054_4207459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611509.1|4207463_4208087_-	hypothetical protein	NA	A0A2L0V147	Salmonella_phage	37.2	1.6e-30
WP_014611510.1|4208083_4208686_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	36.4	1.8e-23
WP_014611511.1|4208784_4211652_-	tape measure protein	NA	I6P8E3	Pseudomonas_phage	33.3	4.6e-48
WP_014611512.1|4211982_4212312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611513.1|4212320_4213229_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	37.2	4.4e-37
WP_014611514.1|4213233_4213644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611515.1|4213640_4214060_-	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	41.5	1.5e-19
WP_014611516.1|4214062_4214578_-	termination factor Rho	NA	NA	NA	NA	NA
WP_014611517.1|4214648_4215551_-|head	head protein	head	A0SMP3	Pseudomonas_virus	54.5	1.4e-88
WP_014611518.1|4215558_4216707_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	39.5	1.2e-42
WP_014611519.1|4216992_4217451_-	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	33.6	3.6e-11
WP_014611520.1|4217546_4218791_-|head	head morphogenesis protein SPP1 gp7	head	J9STS2	Pseudomonas_phage	46.6	4.6e-53
WP_014611521.1|4218790_4220350_-	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	44.7	1.3e-113
WP_014611522.1|4220349_4222011_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	60.1	2.3e-164
WP_014611523.1|4222010_4222580_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	58.6	9.1e-49
WP_014611524.1|4222582_4222879_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9D8	Vibrio_phage	53.1	3.3e-18
WP_014611525.1|4222878_4223214_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_014611526.1|4223210_4223423_-	hypothetical protein	NA	A0A0H5ARI0	Pseudomonas_phage	45.6	1.3e-05
WP_014611527.1|4223507_4224077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611528.1|4224073_4224646_-	lysozyme	NA	A0A0A1I5L5	Burkholderia_phage	45.2	2.1e-24
WP_014611529.1|4224635_4224932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611530.1|4225010_4225457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611531.1|4225568_4226015_-	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	38.1	9.7e-14
WP_014611532.1|4226004_4226535_-	hypothetical protein	NA	A0A2P9JZH6	Alteromonadaceae_phage	45.2	7.0e-27
WP_014611533.1|4226531_4227116_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	38.6	6.1e-16
WP_014611534.1|4227115_4227334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611535.1|4227432_4227891_-	hypothetical protein	NA	M4MHH2	Vibrio_phage	55.9	2.0e-38
WP_041412216.1|4227902_4228100_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014611537.1|4228193_4228826_-	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	53.3	5.9e-57
WP_014611538.1|4228836_4229115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611539.1|4229126_4229372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611540.1|4229374_4229587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041412219.1|4229629_4230610_-	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	63.2	2.1e-93
WP_014611542.1|4230655_4232653_-|transposase	transposase	transposase	M4M9R2	Vibrio_phage	53.6	5.2e-208
WP_014611543.1|4232649_4233135_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	52.3	3.4e-44
WP_014611544.1|4233255_4233558_-	transcriptional regulator	NA	A0A2P9JZG5	Alteromonadaceae_phage	46.7	1.7e-14
WP_014611545.1|4233718_4234477_+	helix-turn-helix domain-containing protein	NA	A0A2I7S9A5	Vibrio_phage	46.1	3.1e-60
>prophage 14
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	4382925	4450456	4840251	head,integrase,transposase	Vibrio_phage(23.33%)	80	4395710:4395726	4437843:4437859
WP_014611683.1|4382925_4383591_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014611684.1|4383782_4384526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611686.1|4384766_4385057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611687.1|4385067_4385400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041412250.1|4385592_4385838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611690.1|4385865_4386201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041412253.1|4386408_4386852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011918360.1|4386943_4387285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041412255.1|4387294_4387492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611693.1|4387791_4388022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611694.1|4388653_4389007_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	57.1	4.6e-27
WP_011918390.1|4388981_4389890_-	cation transporter	NA	NA	NA	NA	NA
WP_011918389.1|4389921_4390386_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_014611696.1|4390408_4391314_+	cation transporter	NA	NA	NA	NA	NA
WP_011918387.1|4391367_4391733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611697.1|4391784_4393029_+	TolC family protein	NA	NA	NA	NA	NA
WP_014611698.1|4393107_4394154_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014611699.1|4394163_4397286_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
4395710:4395726	attL	CGGTTATCAGAAGCGCT	NA	NA	NA	NA
WP_014611700.1|4397351_4397771_-	DUF3703 domain-containing protein	NA	NA	NA	NA	NA
WP_049789559.1|4397987_4398395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011919306.1|4398419_4398935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611701.1|4398935_4399211_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_014611702.1|4399479_4400652_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_014611703.1|4401057_4401546_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_014611704.1|4401542_4402034_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_014611705.1|4402140_4403223_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014611706.1|4403298_4403883_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007103158.1|4403927_4404596_-	cupin	NA	NA	NA	NA	NA
WP_007103157.1|4404643_4405264_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014611707.1|4405512_4406064_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	35.6	5.1e-12
WP_040291333.1|4407934_4408396_-|transposase	transposase	transposase	A0A193DTP9	Autographa_californica_nuclear_polyhedrosis_virus	40.0	3.1e-15
WP_008983524.1|4408584_4409022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008983523.1|4409164_4409389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041408180.1|4409576_4410347_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.2	1.6e-48
WP_014611708.1|4411456_4411804_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014611709.1|4411805_4412063_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014611710.1|4412224_4412857_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014611712.1|4413795_4414266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611714.1|4415047_4415383_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011918371.1|4415379_4415667_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014611506.1|4415861_4416278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611507.1|4416320_4423049_-	membrane protein	NA	A0A2L0V157	Salmonella_phage	32.1	8.5e-77
WP_049789555.1|4423033_4423438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611509.1|4423442_4424066_-	hypothetical protein	NA	A0A2L0V147	Salmonella_phage	37.2	1.6e-30
WP_014611510.1|4424062_4424665_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	36.4	1.8e-23
WP_014611511.1|4424763_4427631_-	tape measure protein	NA	I6P8E3	Pseudomonas_phage	33.3	4.6e-48
WP_014611512.1|4427961_4428291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611513.1|4428299_4429208_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	37.2	4.4e-37
WP_014611514.1|4429212_4429623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611515.1|4429619_4430039_-	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	41.5	1.5e-19
WP_014611516.1|4430041_4430557_-	termination factor Rho	NA	NA	NA	NA	NA
WP_014611517.1|4430627_4431530_-|head	head protein	head	A0SMP3	Pseudomonas_virus	54.5	1.4e-88
WP_014611518.1|4431537_4432686_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	39.5	1.2e-42
WP_014611519.1|4432971_4433430_-	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	33.6	3.6e-11
WP_014611520.1|4433525_4434770_-|head	head morphogenesis protein SPP1 gp7	head	J9STS2	Pseudomonas_phage	46.6	4.6e-53
WP_014611521.1|4434769_4436329_-	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	44.7	1.3e-113
WP_014611522.1|4436328_4437990_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	60.1	2.3e-164
4437843:4437859	attR	AGCGCTTCTGATAACCG	NA	NA	NA	NA
WP_014611523.1|4437989_4438559_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	58.6	9.1e-49
WP_014611524.1|4438561_4438858_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9D8	Vibrio_phage	53.1	3.3e-18
WP_014611525.1|4438857_4439193_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_014611526.1|4439189_4439402_-	hypothetical protein	NA	A0A0H5ARI0	Pseudomonas_phage	45.6	1.3e-05
WP_014611527.1|4439486_4440056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611528.1|4440052_4440625_-	lysozyme	NA	A0A0A1I5L5	Burkholderia_phage	45.2	2.1e-24
WP_014611529.1|4440614_4440911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611530.1|4440989_4441436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611531.1|4441547_4441994_-	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	38.1	9.7e-14
WP_014611532.1|4441983_4442514_-	hypothetical protein	NA	A0A2P9JZH6	Alteromonadaceae_phage	45.2	7.0e-27
WP_014611533.1|4442510_4443095_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	38.6	6.1e-16
WP_014611534.1|4443094_4443313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611535.1|4443411_4443870_-	hypothetical protein	NA	M4MHH2	Vibrio_phage	55.9	2.0e-38
WP_041412216.1|4443881_4444079_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014611537.1|4444172_4444805_-	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	53.3	5.9e-57
WP_014611538.1|4444815_4445094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611539.1|4445105_4445351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611540.1|4445353_4445566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041412219.1|4445608_4446589_-	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	63.2	2.1e-93
WP_014611542.1|4446634_4448632_-|transposase	transposase	transposase	M4M9R2	Vibrio_phage	53.6	5.2e-208
WP_014611543.1|4448628_4449114_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	52.3	3.4e-44
WP_014611544.1|4449234_4449537_-	transcriptional regulator	NA	A0A2P9JZG5	Alteromonadaceae_phage	46.7	1.7e-14
WP_014611545.1|4449697_4450456_+	helix-turn-helix domain-containing protein	NA	A0A2I7S9A5	Vibrio_phage	46.1	3.1e-60
>prophage 15
NC_017566	Shewanella putrefaciens 200, complete genome	4840251	4666333	4804672	4840251	integrase,tRNA,transposase	Leptospira_phage(16.0%)	118	4657344:4657359	4805354:4805371
4657344:4657359	attL	CATATCGATATAGAAA	NA	NA	NA	NA
WP_014610306.1|4666333_4666597_-|transposase	transposase	transposase	NA	NA	NA	NA
4657344:4657359	attL	CATATCGATATAGAAA	NA	NA	NA	NA
WP_014610305.1|4666615_4668283_-|transposase	IS66-like element ISSpu21 family transposase	transposase	NA	NA	NA	NA
WP_014610304.1|4668304_4668655_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_014610303.1|4668654_4668936_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011791220.1|4669596_4671093_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_011791222.1|4672233_4673481_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	6.3e-95
WP_041412435.1|4673606_4675139_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.3	4.3e-85
WP_014611814.1|4675200_4676868_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_014611815.1|4677022_4677730_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_011918294.1|4677949_4679176_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_014611816.1|4679273_4680026_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_011791228.1|4680107_4680539_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011918292.1|4680705_4681062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611817.1|4681176_4681713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041412271.1|4681942_4682287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611819.1|4682446_4684270_+	glycerophosphodiester phosphodiesterase	NA	M1HUL1	Acanthocystis_turfacea_Chlorella_virus	27.8	1.6e-17
WP_014611820.1|4684271_4684700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011791234.1|4685080_4685761_+	acireductone synthase	NA	NA	NA	NA	NA
WP_025007944.1|4685845_4686952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611822.1|4687305_4687701_-	GFA family protein	NA	NA	NA	NA	NA
WP_014611823.1|4687824_4688253_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014611824.1|4688322_4688589_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012586382.1|4688585_4689134_-	HPP family protein	NA	NA	NA	NA	NA
WP_014611825.1|4689257_4689668_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014611826.1|4689793_4692250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609977.1|4692380_4693703_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014611827.1|4693823_4695620_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	1.1e-39
WP_014611828.1|4695812_4697129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011791243.1|4697125_4697989_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.5	3.9e-19
WP_011791244.1|4698031_4698403_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014611829.1|4698496_4700137_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011791246.1|4700140_4700875_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.6e-21
WP_011918278.1|4700957_4702097_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014611830.1|4702176_4702425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083754.1|4702497_4703031_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_011791249.1|4703321_4703786_-	peptidase P60	NA	A0A1V0DZX6	Clostridioides_phage	39.3	3.8e-13
WP_014611831.1|4703972_4705163_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_014611832.1|4705450_4706374_+	pirin family protein	NA	NA	NA	NA	NA
WP_014611833.1|4706622_4707669_+	DUF4118 domain-containing protein	NA	NA	NA	NA	NA
WP_014611834.1|4707669_4708359_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011791254.1|4708401_4709100_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_014611835.1|4709101_4710466_+	Ktr system potassium transporter B	NA	NA	NA	NA	NA
WP_014611836.1|4710757_4711222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041412436.1|4711294_4712479_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014611838.1|4712753_4713770_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011791259.1|4713774_4714260_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011791260.1|4714518_4714953_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011918275.1|4715219_4716764_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011791262.1|4716774_4717908_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011918274.1|4717937_4719146_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	26.5	2.8e-15
WP_011918273.1|4719155_4719899_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011791265.1|4719884_4720340_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011791266.1|4720362_4720617_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_014611839.1|4721115_4721745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611840.1|4721734_4723975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611841.1|4723959_4727163_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014611842.1|4727400_4728276_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_014611843.1|4728272_4729451_-|integrase	site-specific integrase	integrase	Q76UT6	Pseudomonas_virus	30.7	2.8e-15
WP_014611845.1|4729803_4730013_+	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	43.5	1.2e-09
WP_049789562.1|4731993_4732635_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
4732500:4732515	attR	TTTCTATATCGATATG	NA	NA	NA	NA
WP_014611846.1|4732704_4733721_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
4732500:4732515	attR	TTTCTATATCGATATG	NA	NA	NA	NA
WP_041412272.1|4734102_4734582_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041412273.1|4734565_4735129_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	75.0	1.3e-10
WP_041412274.1|4735125_4736031_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.0	2.0e-66
WP_014611848.1|4736146_4736446_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014611849.1|4736442_4736787_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.2	5.4e-20
WP_049789563.1|4738390_4738960_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_014611850.1|4739098_4739539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611851.1|4739549_4740215_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_014611852.1|4740282_4740960_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.3	1.7e-65
WP_014611853.1|4740976_4743523_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	42.8	4.1e-181
WP_014611854.1|4743542_4745546_-	MtrB/PioB family decaheme-associated outer membrane protein	NA	NA	NA	NA	NA
WP_014611855.1|4745560_4746502_-	DmsE family decaheme c-type cytochrome	NA	NA	NA	NA	NA
WP_014611856.1|4746859_4747651_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014611857.1|4748210_4749671_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.4	3.8e-75
WP_014611849.1|4749757_4750102_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.2	5.4e-20
WP_014611848.1|4750098_4750398_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041411927.1|4750995_4751475_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_049789524.1|4751458_4752028_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	70.0	1.1e-09
WP_011791267.1|4758187_4759615_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_011791268.1|4759706_4760057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014611858.1|4760175_4761078_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_011791270.1|4761261_4761465_+	DUF2061 domain-containing protein	NA	NA	NA	NA	NA
WP_014611859.1|4761795_4762386_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014611860.1|4762420_4763551_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014611861.1|4763550_4766592_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014611862.1|4766592_4767069_+	small multi-drug export protein	NA	NA	NA	NA	NA
WP_014610303.1|4768298_4768580_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014610304.1|4768579_4768930_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_014610305.1|4768951_4770619_+|transposase	IS66-like element ISSpu21 family transposase	transposase	NA	NA	NA	NA
WP_014610306.1|4770637_4770901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014611864.1|4771210_4772464_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	1.1e-81
WP_014611865.1|4772551_4773364_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014611866.1|4773609_4774746_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.5	2.0e-18
WP_014611867.1|4774907_4776503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014611868.1|4776477_4778025_-	transcriptional antiterminator	NA	NA	NA	NA	NA
WP_014611869.1|4778024_4779680_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014611870.1|4779676_4781752_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_036512827.1|4781735_4782572_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_014611872.1|4782687_4784517_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	45.5	8.0e-139
WP_014611873.1|4784561_4785332_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011791273.1|4785534_4787640_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014611874.1|4787916_4789281_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.3	7.6e-33
WP_011791275.1|4789478_4789907_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_011791276.1|4789941_4791333_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_011791277.1|4791368_4792229_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_011791278.1|4792279_4793821_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_011791279.1|4793835_4794369_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_011791280.1|4794384_4794855_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_011791281.1|4794882_4795137_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_011791282.1|4795172_4795994_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_014611875.1|4796006_4796390_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_011791284.1|4796615_4797494_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	37.4	2.8e-12
WP_011791285.1|4797503_4798292_-	ParA family protein	NA	Q8JL10	Natrialba_phage	36.9	1.9e-20
WP_011791286.1|4798366_4798987_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014611876.1|4799104_4800994_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_014611877.1|4801433_4801874_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_001206290.1|4803463_4804672_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
4805354:4805371	attR	GCAGCGGTCACTGCAGCA	NA	NA	NA	NA
