The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014844	Pseudodesulfovibrio aespoeensis Aspo-2, complete sequence	3629109	432589	475445	3629109	protease,integrase,transposase	Salmonella_phage(25.0%)	34	460693:460708	477790:477805
WP_013513348.1|432589_433804_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	33.7	2.1e-50
WP_157864781.1|433886_434486_+	cytochrome C	NA	NA	NA	NA	NA
WP_013513350.1|434541_435639_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_013513351.1|435869_436721_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_013513352.1|436722_438078_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.4	7.5e-17
WP_157864900.1|438239_438812_+	methyltransferase domain-containing protein	NA	R4TG33	Phaeocystis_globosa_virus	27.3	1.9e-06
WP_013513354.1|438841_440722_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013513355.1|441023_442313_-	MFS transporter	NA	NA	NA	NA	NA
WP_157864901.1|442379_443675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013513357.1|443753_445277_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_013513358.1|445286_445748_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_013513359.1|445856_446813_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_013513360.1|446855_448055_-	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_013513361.1|448051_448351_-	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_157864782.1|448783_449065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013513362.1|449454_450570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013513363.1|450707_455549_-	DEAD/DEAH box helicase	NA	A0A1V0SLK7	Klosneuvirus	25.5	9.5e-30
WP_013513364.1|458615_459605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864783.1|459637_460102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013513367.1|460439_461429_-	glycosyltransferase	NA	NA	NA	NA	NA
460693:460708	attL	GCTGCGGCAAGCGGGA	NA	NA	NA	NA
WP_083808611.1|461425_462346_-	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_013513369.1|462349_463165_-	radical SAM protein	NA	NA	NA	NA	NA
WP_013513370.1|463352_463940_-	Fic family protein	NA	S4TP71	Salmonella_phage	34.3	8.0e-08
WP_013513371.1|463917_464154_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_157864784.1|464225_464495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013513372.1|464927_465293_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_013513373.1|465559_467056_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_013513374.1|467065_467620_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_157864785.1|467603_469352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864786.1|469844_470965_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	25.3	3.9e-19
WP_041271314.1|471252_472245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041271315.1|472452_472671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013513379.1|472845_474063_-|integrase	site-specific integrase	integrase	Q858E8	Salmonella_phage	21.5	4.5e-13
WP_013513380.1|474413_475445_-|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	27.0	6.6e-13
477790:477805	attR	GCTGCGGCAAGCGGGA	NA	NA	NA	NA
>prophage 2
NC_014844	Pseudodesulfovibrio aespoeensis Aspo-2, complete sequence	3629109	487319	517697	3629109	terminase,portal,capsid,tail,head,integrase,plate	Pseudomonas_phage(43.48%)	40	512322:512359	526784:526821
WP_013513404.1|487319_487646_-	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	42.7	3.9e-12
WP_013513405.1|487668_488649_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	47.3	8.8e-76
WP_013513406.1|488658_490431_-	ATPase	NA	A0A0U4JIZ9	Pseudomonas_phage	51.5	7.7e-163
WP_013513407.1|490543_491407_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	39.0	3.1e-32
WP_013513408.1|491418_492453_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	43.6	4.8e-72
WP_013513409.1|492528_493206_+|terminase	small terminase subunit	terminase	U3PCG2	Vibrio_phage	33.3	2.9e-17
WP_013513410.1|493290_493752_+|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	38.6	6.1e-19
WP_013513411.1|493748_494204_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_157864787.1|494271_494907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013513413.1|494922_496041_+	DUF2586 domain-containing protein	NA	A0A1D9C9S8	Salinivibrio_phage	45.9	9.4e-90
WP_013513414.1|496052_496505_+	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	67.1	2.1e-48
WP_013513415.1|496514_496715_+	TraR/DksA C4-type zinc finger protein	NA	A0A218M4I6	Erwinia_phage	49.2	1.8e-07
WP_173358446.1|496714_496936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049776366.1|496862_497450_+	lytic transglycosylase domain-containing protein	NA	M4R0Y9	Tetraselmis_viridis_virus	52.2	2.4e-36
WP_157864788.1|497461_497869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041271318.1|498076_498277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013513418.1|498297_498579_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	44.0	4.4e-12
WP_013513419.1|498599_498743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013513420.1|498799_499027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013513421.1|499321_499636_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_013513422.1|499648_499927_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	51.1	1.8e-21
WP_013513423.1|499977_501783_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	50.0	2.4e-103
WP_013513424.1|501797_502130_+	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	46.1	2.0e-16
WP_013513425.1|502126_503302_+|plate	baseplate J/gp47 family protein	plate	A0A0U4JJ14	Pseudomonas_phage	49.3	3.7e-105
WP_013513426.1|503374_503593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013513427.1|503771_504386_+|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	58.0	2.0e-54
WP_013513428.1|504395_505835_+|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	46.2	1.9e-58
WP_013513429.1|505843_506644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013513430.1|506656_506974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013513431.1|506978_507884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013513432.1|507880_508420_+	hypothetical protein	NA	A0A1L5C2B6	Pseudoalteromonas_phage	41.8	3.4e-21
WP_013513433.1|508416_509121_+	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	35.9	4.6e-34
WP_013513434.1|509090_510188_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	51.4	7.4e-55
WP_157864789.1|510184_510460_-	hypothetical protein	NA	NA	NA	NA	NA
512322:512359	attL	TGCCCAGAGGGCAGGGGGTACCCCCTGCCCTCTGGGCA	NA	NA	NA	NA
WP_013513437.1|512466_513948_+	hypothetical protein	NA	A0A1W6DWU6	Sphingobium_phage	34.9	1.3e-54
WP_013513438.1|514016_514856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013513439.1|514957_515260_-	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_013513440.1|515401_515728_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013513441.1|515828_516419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041271321.1|517097_517697_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	36.0	1.7e-21
526784:526821	attR	TGCCCAGAGGGCAGGGGGTACCCCCTGCCCTCTGGGCA	NA	NA	NA	NA
>prophage 3
NC_014844	Pseudodesulfovibrio aespoeensis Aspo-2, complete sequence	3629109	1775491	1800991	3629109	portal,capsid,integrase,tail	Streptococcus_phage(33.33%)	28	1774461:1774479	1793653:1793671
1774461:1774479	attL	CGCTTCCGGTAAGTAACCA	NA	NA	NA	NA
WP_013514534.1|1775491_1776406_-|integrase	tyrosine-type recombinase/integrase	integrase	Q708S2	Streptococcus_phage	27.2	1.1e-11
WP_013514535.1|1776386_1776761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013514536.1|1776794_1776989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013258631.1|1777129_1777402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514537.1|1777398_1777677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514538.1|1777676_1779200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514539.1|1779314_1780823_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_013514540.1|1780822_1781686_+|capsid	minor capsid protein	capsid	Q708N2	Streptococcus_phage	32.1	2.0e-07
WP_013514541.1|1781866_1783186_-	radical SAM protein	NA	NA	NA	NA	NA
WP_013514542.1|1783178_1784003_-	terpene cyclase/mutase family protein	NA	NA	NA	NA	NA
WP_013514543.1|1783992_1785102_-	hypothetical protein	NA	A0A1V0SAP3	Catovirus	25.0	2.0e-07
WP_013514544.1|1785098_1786310_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013514546.1|1786570_1786867_-	PqqD family protein	NA	NA	NA	NA	NA
WP_013514547.1|1786863_1787916_-	radical SAM protein	NA	NA	NA	NA	NA
WP_013514548.1|1787912_1788101_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013514549.1|1788328_1790725_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_013514550.1|1790737_1791100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514551.1|1791118_1791982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514552.1|1792001_1792361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514553.1|1792347_1792812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514554.1|1792798_1793158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514555.1|1793147_1793633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514556.1|1793692_1794241_+	hypothetical protein	NA	NA	NA	NA	NA
1793653:1793671	attR	CGCTTCCGGTAAGTAACCA	NA	NA	NA	NA
WP_013514557.1|1794253_1794511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013514558.1|1794513_1796043_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A127AW39	Bacillus_phage	36.0	1.1e-75
WP_011366977.1|1796058_1796520_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011367808.1|1796535_1797213_+	hypothetical protein	NA	A0A127AX46	Bacillus_phage	28.8	7.6e-10
WP_013514559.1|1797355_1800991_+|tail	phage tail tape measure protein	tail	H7BVM4	unidentified_phage	46.4	1.0e-68
>prophage 4
NC_014844	Pseudodesulfovibrio aespoeensis Aspo-2, complete sequence	3629109	2544327	2647901	3629109	protease,tail,head,plate,tRNA,transposase	Alteromonadaceae_phage(21.43%)	111	NA	NA
WP_013515254.1|2544327_2545059_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_157864854.1|2545055_2546822_-	dephospho-CoA kinase	NA	A0A2H4UV25	Bodo_saltans_virus	31.4	1.1e-07
WP_013515256.1|2546996_2547623_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013515257.1|2547731_2549102_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	34.3	4.9e-48
WP_013515258.1|2549227_2550010_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013515259.1|2550108_2550951_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_013515260.1|2551173_2552313_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_013515261.1|2552441_2553362_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_157864945.1|2553449_2554097_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_157864946.1|2554208_2555846_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_013515264.1|2555851_2556475_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013515265.1|2556484_2556868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515266.1|2556969_2558751_-	DUF115 domain-containing protein	NA	NA	NA	NA	NA
WP_013515267.1|2558922_2561238_+	cysteine synthase	NA	A0A1X9I5K7	Streptococcus_phage	40.0	2.2e-48
WP_013515268.1|2561320_2562580_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	43.0	1.7e-87
WP_013515269.1|2562896_2563550_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013515270.1|2563583_2565419_+	indolepyruvate ferredoxin oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_013515271.1|2565420_2566017_+	indolepyruvate oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_013515272.1|2566029_2567610_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_013515273.1|2567695_2569345_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013515274.1|2569420_2569972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515275.1|2570138_2571758_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_157864947.1|2571868_2573584_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013515277.1|2573624_2573948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041271429.1|2573968_2574217_-	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	46.2	8.6e-12
WP_013515279.1|2574244_2575834_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.3	8.0e-10
WP_013515280.1|2575915_2576854_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_013515281.1|2576895_2579223_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_013515282.1|2579305_2580490_-	ACT domain-containing protein	NA	M1NSB9	Streptococcus_phage	29.7	4.7e-31
WP_013515283.1|2580505_2581648_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_013515284.1|2581992_2583732_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013515285.1|2583735_2584806_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_013515286.1|2584964_2586926_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_013515287.1|2586993_2587434_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_013515288.1|2587446_2588526_-	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_013515289.1|2588538_2588907_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_013515290.1|2588931_2589375_-	NADH-quinone oxidoreductase subunit B family protein	NA	NA	NA	NA	NA
WP_013515291.1|2589378_2590227_-	NADH-quinone oxidoreductase subunit H	NA	NA	NA	NA	NA
WP_013515292.1|2590226_2592122_-	oxidoreductase	NA	NA	NA	NA	NA
WP_013515293.1|2592453_2593131_-	phosphoadenosine phosphosulfate reductase family protein	NA	F8UBB2	Clostridium_phage	23.0	6.0e-07
WP_157864855.1|2593218_2593674_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_157864948.1|2594299_2594893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864856.1|2595083_2596219_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013515298.1|2596609_2597407_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	50.4	1.1e-63
WP_013515299.1|2597562_2597778_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_013515300.1|2597782_2598100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515301.1|2598109_2598910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515302.1|2598918_2599719_-	hypothetical protein	NA	A0A068CE15	Rhizobium_phage	52.8	9.3e-07
WP_157864949.1|2599718_2600282_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	34.1	2.9e-15
WP_013515304.1|2600317_2601373_-|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	47.6	2.5e-76
WP_013515305.1|2601372_2601813_-	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	54.5	3.2e-33
WP_013515306.1|2601812_2602364_-|plate	phage baseplate assembly protein V	plate	A0A2P9JZK4	Alteromonadaceae_phage	59.8	7.3e-27
WP_013515307.1|2602363_2603404_-	hypothetical protein	NA	A0A2P9JZK3	Alteromonadaceae_phage	41.3	8.8e-66
WP_049776402.1|2603396_2604593_-	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	34.8	9.5e-40
WP_013515309.1|2604589_2606470_-|tail	tail tape measure protein	tail	A0A2P9JZK0	Alteromonadaceae_phage	51.8	3.4e-116
WP_013515311.1|2606586_2606961_-|tail	phage tail assembly protein	tail	A0A2P9JZJ9	Alteromonadaceae_phage	45.3	7.6e-20
WP_157864950.1|2606962_2607322_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_013515313.1|2607331_2608798_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	51.8	1.9e-127
WP_041271770.1|2608801_2608990_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_013515315.1|2609001_2609556_-	DUF1834 family protein	NA	A0A2I7S9D4	Vibrio_phage	32.9	1.9e-14
WP_013515316.1|2609552_2610026_-	phage virion morphogenesis protein	NA	M4MB67	Vibrio_phage	44.1	4.6e-22
WP_013515317.1|2610022_2610433_-	DUF1320 domain-containing protein	NA	G8GWF0	Rhodobacter_phage	41.3	4.0e-14
WP_013515318.1|2610436_2610685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515319.1|2610697_2611591_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0M4UKB9	Ralstonia_phage	60.9	1.7e-105
WP_013515320.1|2611600_2612005_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	52.2	1.2e-31
WP_013515321.1|2612004_2613132_-|protease	phage protease	protease	A0A2H4J9A2	uncultured_Caudovirales_phage	39.2	1.2e-63
WP_013515322.1|2613548_2614814_-|head	head morphogenesis protein SPP1 gp7	head	A0A2P1A4D1	Alteromonadaceae_phage	46.0	2.1e-101
WP_013515323.1|2614817_2616380_-	DUF935 domain-containing protein	NA	A0A2P9JZI9	Alteromonadaceae_phage	53.0	2.5e-149
WP_013515324.1|2616379_2618032_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	50.7	6.8e-129
WP_013515325.1|2618028_2618550_-	DUF3486 family protein	NA	A0A2H4JD50	uncultured_Caudovirales_phage	48.8	1.9e-37
WP_049776450.1|2618556_2618829_-	hypothetical protein	NA	Q5ZQY7	Pseudomonas_phage	62.2	2.6e-30
WP_013515327.1|2618854_2619202_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	37.8	8.1e-08
WP_049776403.1|2619192_2619855_-	hypothetical protein	NA	Q6QIC6	Burkholderia_phage	32.4	3.8e-06
WP_157864857.1|2619860_2620577_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.9	3.8e-60
WP_013515330.1|2620504_2620813_-	phage-like membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	46.5	7.7e-10
WP_013515331.1|2621020_2621518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515332.1|2621518_2622475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515333.1|2622605_2623331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041271433.1|2623360_2623702_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013515335.1|2623824_2624049_+	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	53.5	1.7e-14
WP_013515336.1|2624091_2624541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515337.1|2624553_2625000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515338.1|2624992_2625298_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.8	2.1e-23
WP_013515339.1|2625311_2625506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515340.1|2625495_2626482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515341.1|2626483_2628202_+|transposase	transposase	transposase	A4JWN2	Burkholderia_virus	39.1	3.3e-102
WP_013515342.1|2628205_2629357_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	52.5	6.2e-105
WP_157864858.1|2629387_2629633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515344.1|2629625_2630135_+	host-nuclease inhibitor Gam family protein	NA	NA	NA	NA	NA
WP_013515345.1|2630131_2630368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515346.1|2630360_2630561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515347.1|2630593_2630863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515348.1|2630879_2631158_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	44.0	2.5e-12
WP_013515349.1|2631157_2631418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515350.1|2631490_2631700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515351.1|2632079_2632271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515352.1|2632352_2632796_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	44.4	2.7e-24
WP_013515353.1|2632805_2633147_+	Mor transcription activator domain-containing protein	NA	Q6QIE8	Burkholderia_phage	40.4	7.4e-14
WP_013515354.1|2633388_2636916_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_013515355.1|2637029_2638115_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_013515356.1|2638190_2638604_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_013515357.1|2638604_2639021_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_013515358.1|2638993_2640052_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_013515359.1|2640074_2640941_-	signal peptidase I	NA	NA	NA	NA	NA
WP_013515360.1|2641021_2642041_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013515361.1|2642044_2642974_-	adenine nucleotide alpha hydrolase family protein	NA	A0A0U2S5Z2	Escherichia_phage	27.6	4.4e-08
WP_013515362.1|2642985_2643183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515363.1|2643401_2643773_+	response regulator	NA	NA	NA	NA	NA
WP_013515364.1|2643853_2644588_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_157864859.1|2645532_2645871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515367.1|2647241_2647901_-|transposase	IS1595-like element ISDae1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_014844	Pseudodesulfovibrio aespoeensis Aspo-2, complete sequence	3629109	2729060	2775791	3629109	integrase,transposase	Burkholderia_phage(100.0%)	32	2728989:2729007	2776009:2776027
2728989:2729007	attL	AGTAATAAAGTTGAGAACT	NA	NA	NA	NA
WP_013515440.1|2729060_2729885_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_013515441.1|2729871_2731959_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013515442.1|2731959_2733600_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_083808653.1|2733604_2734306_+	TniQ family protein	NA	NA	NA	NA	NA
WP_083808654.1|2735663_2736359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864861.1|2736346_2737957_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013515446.1|2738599_2739862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013515447.1|2739870_2740920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515448.1|2740906_2741566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515449.1|2741574_2742672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864862.1|2743999_2744590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083808655.1|2745749_2746136_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013515452.1|2746507_2747281_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_013515453.1|2747331_2748723_-	ribulose-bisphosphate carboxylase	NA	NA	NA	NA	NA
WP_013515454.1|2748757_2749684_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_013515455.1|2749716_2750706_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_041271441.1|2751027_2751831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013515457.1|2751927_2753301_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013515458.1|2753377_2754376_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_013515459.1|2754595_2755354_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013515460.1|2755363_2756437_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_013515461.1|2756456_2757902_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_013515462.1|2757907_2759080_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013515463.1|2759112_2761128_-	transketolase	NA	NA	NA	NA	NA
WP_013515465.1|2761503_2762721_-	geranylgeranyl reductase family protein	NA	NA	NA	NA	NA
WP_157864863.1|2764134_2764344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083808656.1|2764547_2764967_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_157864856.1|2764969_2766105_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013515467.1|2766698_2767913_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	34.3	9.3e-51
WP_013515468.1|2767991_2772851_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_157864954.1|2772866_2774567_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_157864955.1|2775140_2775791_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
2776009:2776027	attR	AGTTCTCAACTTTATTACT	NA	NA	NA	NA
