The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015673	Corynebacterium resistens DSM 45100, complete sequence	2601311	14290	134262	2601311	transposase,tRNA,protease,integrase	Mycobacterium_phage(14.29%)	92	10792:10807	19307:19322
10792:10807	attL	CGTTCCGGTGGATTGA	NA	NA	NA	NA
WP_013887407.1|14290_15577_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A023W687	Mycobacterium_phage	26.5	1.6e-24
WP_013887408.1|15759_16035_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042378568.1|16003_16645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148257510.1|16641_16836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013887411.1|16956_17178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148257511.1|17382_18599_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.2	2.7e-34
WP_158306448.1|19973_20801_-	hypothetical protein	NA	NA	NA	NA	NA
19307:19322	attR	CGTTCCGGTGGATTGA	NA	NA	NA	NA
WP_013887415.1|20793_21585_-	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_013887416.1|21754_22933_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_084767418.1|22903_23809_-	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_013887418.1|23808_24171_-	DoxX family protein	NA	NA	NA	NA	NA
WP_013887419.1|24488_25370_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_013887420.1|25391_26774_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013887421.1|26971_27970_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
WP_013887422.1|27975_29514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148257513.1|29510_30569_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JHY1	Lactococcus_phage	36.4	1.8e-37
WP_042378576.1|30565_31990_+	multidrug transporter	NA	NA	NA	NA	NA
WP_042379865.1|32175_33381_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042378579.1|33380_34430_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_042378582.1|34417_35191_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	4.9e-13
WP_013887428.1|35195_36719_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013887429.1|36735_37230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013887430.1|37242_38655_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_013887431.1|38770_40267_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	41.6	1.0e-67
WP_013887432.1|40412_42014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013887433.1|42325_42850_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	47.2	3.9e-22
WP_013887434.1|43002_43464_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_013887435.1|43522_43798_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_013887436.1|43874_44567_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	42.7	1.0e-38
WP_013887437.1|44628_46767_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q85650	Moloney_murine_sarcoma_virus	28.2	1.1e-17
WP_013887438.1|46979_48878_-	serine/threonine protein kinase	NA	A0A0H4Y184	Salmon_gill_poxvirus	29.1	7.8e-20
WP_042378589.1|48880_50332_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_013887440.1|50328_51771_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_042378593.1|51774_53334_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013887442.1|53330_53849_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_148257613.1|53964_54465_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_013887444.1|56197_57625_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.4	1.7e-43
WP_013887445.1|57670_58912_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_013887446.1|58908_59574_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_013887447.1|59539_60250_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013887448.1|60303_61389_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_069202927.1|61385_64523_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_013887450.1|64572_65826_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.3	7.3e-83
WP_013887451.1|66090_66381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887452.1|66523_67174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887453.1|67392_67731_+	transglycosylase family protein	NA	A0A2D0ZMX2	Rhodococcus_phage	61.2	5.8e-27
WP_148257615.1|67965_68817_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013887455.1|68914_69970_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_042378600.1|69969_70998_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_013887457.1|71057_71846_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.1	1.8e-15
WP_013887460.1|74120_74663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887461.1|74736_75306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887463.1|77389_78379_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013887464.1|78533_79712_+|transposase	IS256-like element ISCre1 family transposase	transposase	NA	NA	NA	NA
WP_011117481.1|79960_80881_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	47.8	1.9e-59
WP_013887466.1|80877_81195_-|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	43.5	5.5e-11
WP_052297011.1|81570_82452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887464.1|82563_83742_+|transposase	IS256-like element ISCre1 family transposase	transposase	NA	NA	NA	NA
WP_005323424.1|83963_85142_+|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
WP_013887468.1|85394_86648_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013887469.1|86761_87445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148257617.1|87828_88692_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_042379884.1|88897_89617_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_013889031.1|89782_91096_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	25.4	5.2e-15
WP_013887473.1|91437_92109_-	LppP/LprE family lipoprotein	NA	NA	NA	NA	NA
WP_013887474.1|92126_92804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052297013.1|92960_94079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013887476.1|94516_95506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887477.1|95864_99362_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_013887478.1|99550_100411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013887479.1|100557_102174_+	transporter	NA	NA	NA	NA	NA
WP_042379900.1|102462_103413_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013887481.1|103405_105358_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	NA	NA	NA	NA
WP_034969395.1|105350_105998_+	ATP-binding cassette domain-containing protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	28.3	1.2e-09
WP_042379901.1|106037_107453_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_013887484.1|107735_109598_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.8	5.3e-138
WP_042378626.1|109597_110248_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_013887466.1|117122_117440_+|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	43.5	5.5e-11
WP_011117481.1|117436_118357_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	47.8	1.9e-59
WP_013887488.1|119487_120744_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_013887489.1|120801_121650_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_013887490.1|121756_122260_-	DUF2505 domain-containing protein	NA	NA	NA	NA	NA
WP_148257516.1|122332_123109_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_013887492.1|123309_124245_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.9	6.9e-78
WP_013887493.1|124517_125102_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_013887494.1|125205_125511_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005323424.1|125810_126989_+|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
WP_148257517.1|127429_128278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084767422.1|128278_128971_-	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_013887464.1|129139_130318_-|transposase	IS256-like element ISCre1 family transposase	transposase	NA	NA	NA	NA
WP_013887496.1|131234_132740_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_148257518.1|133074_134262_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 2
NC_015673	Corynebacterium resistens DSM 45100, complete sequence	2601311	707621	775995	2601311	transposase,protease	unidentified_phage(17.65%)	49	NA	NA
WP_013887962.1|707621_709259_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	29.3	4.4e-19
WP_013887963.1|709410_709746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013887964.1|709798_710161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013887965.1|710537_711368_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	4.8e-22
WP_013887966.1|711371_714068_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_042380220.1|714210_715365_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.9	1.9e-21
WP_158306457.1|715755_716898_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013887969.1|716903_717575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887970.1|717617_719672_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013887971.1|719790_720660_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013887972.1|720667_721555_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	1.7e-09
WP_148257548.1|721523_722687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148257549.1|722694_723939_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	28.8	2.7e-29
WP_013887975.1|724066_726031_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_052297038.1|726030_728004_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_052297039.1|728003_729986_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013887978.1|729987_730647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887979.1|730649_731201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013887980.1|731494_732658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042380229.1|733351_733918_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	73.1	1.1e-75
WP_013887982.1|734018_735380_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.6	4.0e-66
WP_013887983.1|735376_736591_-	Fic family protein	NA	Q9AZ49	Lactococcus_phage	31.0	3.4e-37
WP_013887984.1|736883_737927_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	31.0	1.6e-30
WP_013887985.1|737901_738855_-	DUF3800 domain-containing protein	NA	A5X9G9	Aeromonas_virus	36.8	7.4e-35
WP_013887464.1|739026_740205_+|transposase	IS256-like element ISCre1 family transposase	transposase	NA	NA	NA	NA
WP_013887962.1|740290_741928_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	29.3	4.4e-19
WP_013887986.1|742530_743829_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_013887987.1|743755_744724_-	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_013887988.1|744835_745048_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_148257550.1|745057_745588_-	flavin reductase	NA	NA	NA	NA	NA
WP_013887990.1|745832_753836_-	putative Ig domain-containing protein	NA	NA	NA	NA	NA
WP_013887991.1|754506_754911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042378865.1|754903_755233_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_013887993.1|755861_756509_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	37.6	1.8e-24
WP_013887994.1|756608_757454_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013887995.1|758007_760221_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_158306459.1|760417_761014_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_013887996.1|761189_762860_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.3	3.2e-49
WP_013887962.1|763014_764652_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	29.3	4.4e-19
WP_013887997.1|764828_765350_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_013887998.1|765399_766137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042378867.1|766249_766657_-	globin	NA	NA	NA	NA	NA
WP_042378869.1|766750_769438_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.5	5.8e-45
WP_042378871.1|769573_770212_+	DsbA family protein	NA	NA	NA	NA	NA
WP_013888002.1|770243_770723_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_042380245.1|770782_770998_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	42.4	3.8e-08
WP_013887464.1|771497_772676_-|transposase	IS256-like element ISCre1 family transposase	transposase	NA	NA	NA	NA
WP_013888004.1|773531_775109_+	trigger factor	NA	NA	NA	NA	NA
WP_013888005.1|775398_775995_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.7	3.9e-42
>prophage 3
NC_015673	Corynebacterium resistens DSM 45100, complete sequence	2601311	1051402	1092010	2601311	capsid,terminase,portal,tail,protease,holin,head	Erysipelothrix_phage(51.85%)	45	NA	NA
WP_013888233.1|1051402_1052344_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013888234.1|1052490_1053087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158306478.1|1053209_1055105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013888236.1|1055310_1056879_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	49.4	1.0e-129
WP_052297046.1|1056878_1058174_-	recombinase family protein	NA	E4ZFN9	Streptococcus_phage	34.7	1.1e-54
WP_013888238.1|1058229_1058445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042379000.1|1059056_1059968_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_013888240.1|1060038_1060875_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	62.6	6.8e-61
WP_013888241.1|1060874_1061342_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	56.3	5.7e-33
WP_042379003.1|1061434_1061632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013888243.1|1061624_1062086_-	DUF1617 family protein	NA	NA	NA	NA	NA
WP_042379006.1|1062101_1065017_-|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	41.2	2.6e-70
WP_042379008.1|1065098_1065785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013888246.1|1065784_1068472_-	tape measure protein	NA	A0A2K9V3J7	Faecalibacterium_phage	38.7	1.8e-38
WP_005295604.1|1068498_1068675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013888247.1|1068692_1069103_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	54.1	5.2e-30
WP_013888248.1|1069115_1069712_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	70.1	3.3e-73
WP_013888249.1|1069730_1070075_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	38.9	1.3e-18
WP_042379011.1|1070071_1070509_-	hypothetical protein	NA	A0A2K5B292	Erysipelothrix_phage	44.3	1.9e-25
WP_042379013.1|1070477_1070840_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_042379015.1|1070843_1071158_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	59.0	4.4e-29
WP_013888252.1|1071193_1072414_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.5	5.9e-130
WP_013888253.1|1072435_1073269_-|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	61.8	2.7e-57
WP_013888254.1|1073265_1074570_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	71.6	3.4e-168
WP_013888255.1|1074598_1076197_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	73.5	1.9e-232
WP_013888256.1|1076309_1076600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013888257.1|1076605_1076911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013888258.1|1077005_1077203_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_042379018.1|1077199_1077856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042380356.1|1077852_1078038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042379022.1|1078185_1079436_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	57.4	2.2e-135
WP_013888262.1|1079407_1080598_-	methionine adenosyltransferase	NA	A0A2K5B278	Erysipelothrix_phage	55.7	1.8e-107
WP_042379024.1|1080686_1081262_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	51.3	2.7e-48
WP_042379028.1|1081510_1081888_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	40.3	1.1e-13
WP_042379030.1|1082040_1082505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042379033.1|1082504_1083869_-	DEAD/DEAH box helicase	NA	A0A1W6JQF1	Corynebacterium_phage	62.2	4.7e-160
WP_013888266.1|1083849_1084128_-	VRR-NUC domain-containing protein	NA	A0A1S7FZ22	Listeria_phage	51.9	1.4e-15
WP_013888267.1|1084261_1086529_-	primase C-terminal domain-containing protein	NA	A0A1B0RXC5	Streptococcus_phage	45.6	2.3e-183
WP_013888268.1|1086525_1086969_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	49.6	2.4e-33
WP_042379037.1|1086965_1087733_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	45.5	7.2e-57
WP_158306463.1|1087892_1088042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042379039.1|1088026_1089988_-	DNA polymerase	NA	A0A1W6JQ98	Corynebacterium_phage	54.4	1.0e-208
WP_013888271.1|1090066_1090276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013888272.1|1090293_1090851_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	61.1	1.1e-57
WP_013888273.1|1090876_1092010_-	DUF2800 domain-containing protein	NA	A0A1W6JQ97	Corynebacterium_phage	59.8	8.8e-120
>prophage 4
NC_015673	Corynebacterium resistens DSM 45100, complete sequence	2601311	1821563	1888667	2601311	capsid,transposase,terminase,tRNA,integrase,tail,protease,head,holin,portal	Erysipelothrix_phage(48.48%)	71	1817796:1817816	1824327:1824347
1817796:1817816	attL	ACGTTAAATTTGAATTCGACG	NA	NA	NA	NA
WP_158306471.1|1821563_1821719_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013888871.1|1821745_1821907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148257578.1|1821992_1822184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162467885.1|1822204_1822360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042380625.1|1823208_1823652_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_084767533.1|1823706_1824015_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	50.6	1.0e-17
WP_005290974.1|1824001_1824283_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013888877.1|1825247_1826402_-	hypothetical protein	NA	NA	NA	NA	NA
1824327:1824347	attR	ACGTTAAATTTGAATTCGACG	NA	NA	NA	NA
WP_013888878.1|1826487_1829820_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.0	1.3e-73
WP_013888879.1|1829816_1831019_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005295471.1|1833574_1834579_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_042379410.1|1834575_1835586_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005295475.1|1835582_1836602_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005295477.1|1836634_1837234_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013888882.1|1837288_1838893_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	33.0	1.2e-10
WP_013888883.1|1838889_1840485_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	42.2	9.2e-22
WP_005295486.1|1840481_1841351_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_005295488.1|1841347_1842667_-	MFS transporter	NA	NA	NA	NA	NA
WP_005295490.1|1842831_1843299_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_005295491.1|1843985_1844714_-	type I restriction-modification system subunit M	NA	NA	NA	NA	NA
WP_034965101.1|1844727_1844958_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	46.4	1.0e-11
WP_005295496.1|1844962_1846624_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_042379415.1|1846607_1846841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005295500.1|1846827_1848066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005295504.1|1848511_1849096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005295507.1|1849158_1849401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005295510.1|1849397_1849820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005295513.1|1849812_1850946_+	DUF2800 domain-containing protein	NA	A0A1W6JQ97	Corynebacterium_phage	58.8	2.6e-119
WP_013888887.1|1850971_1851526_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	60.6	1.4e-54
WP_005295518.1|1851543_1851753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013888888.1|1851840_1853802_+	DNA polymerase	NA	A0A1W6JQ98	Corynebacterium_phage	56.0	2.2e-211
WP_042379418.1|1853786_1854608_-	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_005295523.1|1854771_1855539_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	45.5	1.9e-57
WP_005295525.1|1855535_1855979_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	48.9	2.1e-32
WP_013888890.1|1855975_1858240_+	primase C-terminal domain-containing protein	NA	A0A1B0RXC5	Streptococcus_phage	46.2	3.0e-183
WP_013888891.1|1858376_1858655_+	VRR-NUC domain-containing protein	NA	A0A1S7FZ22	Listeria_phage	48.8	3.2e-15
WP_013888892.1|1858635_1859997_+	DEAD/DEAH box helicase	NA	A0A1W6JQF1	Corynebacterium_phage	61.0	3.2e-156
WP_013888893.1|1859993_1860458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005295540.1|1860613_1860991_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	38.3	2.2e-14
WP_005295544.1|1861210_1861777_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_013888895.1|1862753_1863329_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	51.3	2.1e-48
WP_013888896.1|1863418_1864609_+	methionine adenosyltransferase	NA	A0A2K5B278	Erysipelothrix_phage	56.2	4.0e-107
WP_013888897.1|1864580_1865831_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	56.1	3.8e-132
WP_042380637.1|1865977_1866163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013888899.1|1866159_1866810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042379422.1|1866812_1867010_+	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_042379424.1|1867104_1867440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013888902.1|1867635_1867923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013888903.1|1867956_1868247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013888904.1|1868356_1869955_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	75.5	4.1e-240
WP_013888905.1|1869984_1871292_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	70.8	5.3e-169
WP_013888906.1|1871288_1872116_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	61.8	3.1e-58
WP_013888907.1|1872137_1873358_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.7	1.6e-130
WP_042379427.1|1873391_1873706_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	60.0	1.5e-29
WP_013888909.1|1873709_1874072_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_042379011.1|1874040_1874478_+	hypothetical protein	NA	A0A2K5B292	Erysipelothrix_phage	44.3	1.9e-25
WP_013888249.1|1874474_1874819_+	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	38.9	1.3e-18
WP_013888248.1|1874837_1875434_+|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	70.1	3.3e-73
WP_013888247.1|1875446_1875857_+	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	54.1	5.2e-30
WP_005295604.1|1875874_1876051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013888246.1|1876077_1878765_+	tape measure protein	NA	A0A2K9V3J7	Faecalibacterium_phage	38.7	1.8e-38
WP_013888910.1|1878764_1879451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013888911.1|1879535_1882457_+|tail	phage tail protein	tail	A0A2H4JFY7	uncultured_Caudovirales_phage	41.5	9.4e-73
WP_013888912.1|1882477_1882924_+	DUF1617 family protein	NA	A0A2K9VDF8	Lactobacillus_phage	34.1	5.3e-12
WP_013888913.1|1882920_1883124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042379430.1|1883206_1883674_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	56.3	2.6e-33
WP_013888915.1|1883673_1884516_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	63.9	2.6e-60
WP_042379433.1|1885001_1885412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013888916.1|1885408_1885624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148257579.1|1885589_1887080_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	37.4	6.5e-54
WP_013888918.1|1887080_1888667_+	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	48.9	8.5e-129
