The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017281	Campylobacter jejuni subsp. jejuni S3, complete sequence	1681364	619600	702088	1681364	terminase,integrase,transposase,tRNA,plate,tail,head,protease	Campylobacter_phage(40.0%)	95	611992:612011	679623:679642
611992:612011	attL	AAGTTTTTCAAATACTTCTT	NA	NA	NA	NA
WP_002867647.1|619600_620920_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.4	2.3e-39
WP_002781630.1|620916_621459_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002781628.1|621458_621902_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002867646.1|621914_623135_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_002864726.1|623290_623536_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002867644.1|623532_623940_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_002855252.1|623932_624661_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	1.4e-25
WP_002854994.1|624660_625911_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011049757.1|626074_627499_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_014517212.1|631606_632215_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_011049758.1|634014_635988_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_002852327.1|636141_636372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002854947.1|636361_636604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014517213.1|636600_637038_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_002867637.1|637019_638873_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002870227.1|640500_641304_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002876361.1|641402_641672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002870225.1|641687_641879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014517215.1|641879_643994_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002790751.1|644082_644940_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	31.2	9.6e-26
WP_002795448.1|644936_645128_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002824157.1|645124_645310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002865075.1|645365_645797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002865074.1|645870_646209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014517217.1|646404_646890_+	host-nuclease inhibitor Gam family protein	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	3.2e-18
WP_002791416.1|646886_647066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791414.1|647129_647402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791413.1|647398_647785_+	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	56.4	2.7e-36
WP_002864977.1|647899_648079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002790255.1|648075_648504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918730.1|648555_648747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014517218.1|648733_649213_+	phage virion morphogenesis protein	NA	A7YGZ0	Campylobacter_phage	29.6	2.3e-05
WP_002870187.1|649351_650485_-	hypothetical protein	NA	A0A1C6ZDL9	Pseudomonas_phage	34.2	5.1e-27
WP_014517219.1|650477_651857_-	DUF935 family protein	NA	A0A0M3LRU4	Mannheimia_phage	22.0	9.7e-12
WP_002865465.1|651853_653380_-|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	31.1	6.4e-49
WP_002790261.1|653469_653784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|653895_654144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784498.1|654140_654482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002870185.1|654492_654882_-	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	45.9	4.2e-21
WP_002790266.1|654871_655237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790896.1|655233_655587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014517220.1|655583_655895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790002.1|655894_656782_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2K9VH18	Faecalibacterium_phage	43.7	3.5e-63
WP_002790001.1|656781_657822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002865847.1|657952_658417_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002827116.1|658413_659046_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.6	4.6e-09
WP_002784486.1|659054_659246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002795239.1|659242_659533_+	GPW/gp25 family protein	NA	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_014517221.1|659529_660696_+|plate	baseplate J/gp47 family protein	plate	A0A1X9SH02	Bradyrhizobium_phage	25.8	3.3e-13
WP_002864870.1|660692_661313_+|tail	phage tail protein I	tail	A7YGM6	Campylobacter_phage	97.4	2.8e-59
WP_002873735.1|661312_662392_+|tail	phage tail protein	tail	A7YGV0	Campylobacter_phage	100.0	3.9e-149
WP_014517222.1|662401_662908_+	DUF4376 domain-containing protein	NA	A7YGY7	Campylobacter_phage	95.8	3.5e-84
WP_002873737.1|662904_663276_+	DUF1353 domain-containing protein	NA	A7YGF6	Campylobacter_phage	99.2	1.7e-67
WP_014517223.1|663400_664414_+	hypothetical protein	NA	A7YGH6	Campylobacter_phage	99.1	7.7e-192
WP_014517224.1|664424_665615_+|tail	phage tail sheath family protein	tail	A7YGA3	Campylobacter_phage	98.7	3.9e-195
WP_002789981.1|665737_666253_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	26.3	2.6e-10
WP_002876453.1|666263_666500_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002876454.1|666607_666838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014517225.1|666867_668832_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002870151.1|668833_669208_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002789964.1|669200_669392_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_014517226.1|669385_670354_+|tail	phage tail protein	tail	A0A219Y9Y2	Aeromonas_phage	26.8	4.3e-14
WP_014517227.1|670455_671271_+	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	96.7	7.2e-148
WP_002784651.1|671298_671586_-	hypothetical protein	NA	A7YGG4	Campylobacter_phage	97.9	1.6e-46
WP_002784648.1|671665_671860_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	96.9	1.1e-27
WP_002784647.1|671869_672190_-	hypothetical protein	NA	A7YG71	Campylobacter_phage	97.2	1.6e-50
WP_014517228.1|672270_672900_-	LexA family transcriptional regulator	NA	A7YGK7	Campylobacter_phage	98.2	2.8e-59
WP_002854766.1|673191_674265_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_002864738.1|674294_674993_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_079254348.1|675082_676588_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_002864740.1|676601_677792_+	acetate kinase	NA	NA	NA	NA	NA
WP_011049761.1|677819_681572_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.1	1.3e-45
679623:679642	attR	AAGTTTTTCAAATACTTCTT	NA	NA	NA	NA
WP_002852223.1|681721_682213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002867634.1|682200_683139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079254349.1|683138_684077_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002867632.1|684235_685726_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002859607.1|685722_687111_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002852071.1|687126_688239_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002852052.1|688394_689207_+	flagellar hook-basal body protein	NA	NA	NA	NA	NA
WP_002852142.1|689235_690027_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_002867631.1|690092_691523_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_002867858.1|691725_692421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002867857.1|692417_693671_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.5	6.1e-37
WP_002852194.1|693671_694166_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002867856.1|694175_694712_+	DUF3972 domain-containing protein	NA	NA	NA	NA	NA
WP_002867855.1|694723_695587_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002867854.1|695573_696299_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002856929.1|696308_697025_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_002867853.1|697021_698179_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_014517230.1|698159_698912_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.8	2.8e-05
WP_002859618.1|698979_700317_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002852274.1|700382_700610_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002852144.1|700612_700855_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002867850.1|700847_701387_+	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_002885710.1|701383_702088_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NC_017281	Campylobacter jejuni subsp. jejuni S3, complete sequence	1681364	1222775	1276797	1681364	integrase,terminase,tail,tRNA,head,portal,capsid,protease	Campylobacter_phage(92.73%)	65	1237307:1237324	1253873:1253890
WP_002867346.1|1222775_1224617_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002867345.1|1224613_1226593_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	33.6	1.2e-18
WP_002857924.1|1226592_1227684_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_002874423.1|1227680_1228886_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	29.9	6.5e-28
WP_002867343.1|1228897_1231093_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	44.0	1.4e-07
WP_002853464.1|1231076_1231301_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002854049.1|1231311_1232031_-	UMP kinase	NA	NA	NA	NA	NA
WP_002867342.1|1232082_1233276_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002867341.1|1233272_1234079_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002856386.1|1234065_1234731_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	2.8e-17
WP_011049923.1|1234800_1235979_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_074482847.1|1235978_1237214_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_002867338.1|1237158_1238127_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
1237307:1237324	attL	ATAAAATACAAAAAATAA	NA	NA	NA	NA
WP_002887899.1|1238204_1239305_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_002787311.1|1239643_1240819_+|integrase	site-specific integrase	integrase	X2KXI6	Campylobacter_phage	100.0	1.7e-222
WP_002787309.1|1240815_1241022_-	helix-turn-helix domain-containing protein	NA	X2KXB9	Campylobacter_phage	100.0	4.8e-32
WP_002787307.1|1241023_1241377_-	hypothetical protein	NA	X2KRB4	Campylobacter_phage	100.0	2.1e-56
WP_002787306.1|1241394_1242150_-	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	100.0	9.6e-147
WP_002787304.1|1242127_1242394_-	hypothetical protein	NA	X2KLR9	Campylobacter_phage	100.0	4.7e-40
WP_002858334.1|1242377_1242749_-	hypothetical protein	NA	X2KQ09	Campylobacter_phage	100.0	1.2e-60
WP_002787300.1|1242749_1242974_-	hypothetical protein	NA	X2KM06	Campylobacter_phage	100.0	1.8e-37
WP_002787298.1|1242982_1243744_-	hypothetical protein	NA	X2KQ81	Campylobacter_phage	100.0	1.4e-124
WP_002787295.1|1243680_1243995_-	hypothetical protein	NA	X2KR17	Campylobacter_phage	100.0	1.6e-50
WP_002787293.1|1244073_1244394_-	hypothetical protein	NA	X2KLS2	Campylobacter_phage	100.0	1.4e-51
WP_002787289.1|1244780_1245017_-	hypothetical protein	NA	X2KXC5	Campylobacter_phage	100.0	8.1e-36
WP_002787287.1|1245030_1245798_-	hypothetical protein	NA	X2KRC2	Campylobacter_phage	100.0	3.7e-138
WP_002787283.1|1245935_1246166_-	hypothetical protein	NA	X2KLS5	Campylobacter_phage	100.0	5.0e-38
WP_002787281.1|1246131_1246395_-	hypothetical protein	NA	X2KQ17	Campylobacter_phage	100.0	4.1e-44
WP_002787279.1|1246451_1246739_-	hypothetical protein	NA	X2KXC8	Campylobacter_phage	100.0	2.4e-50
WP_002788580.1|1247952_1248237_-	hypothetical protein	NA	X2KRM3	Campylobacter_phage	100.0	2.3e-40
WP_002858450.1|1248233_1248437_-	hypothetical protein	NA	X2KRB3	Campylobacter_phage	100.0	6.3e-29
WP_002788578.1|1248650_1249034_+	helix-turn-helix domain-containing protein	NA	X2KPM6	Campylobacter_phage	100.0	1.0e-43
WP_002788577.1|1249037_1249355_+	hypothetical protein	NA	X2KX12	Campylobacter_phage	100.0	2.5e-48
WP_002788576.1|1249356_1250337_+	DNA polymerase III subunit epsilon	NA	X2KQX9	Campylobacter_phage	100.0	2.5e-187
WP_002858053.1|1250346_1250967_+	hypothetical protein	NA	X2KQS5	Campylobacter_phage	100.0	6.1e-107
WP_002858176.1|1250968_1252747_+	NTPase KAP	NA	X2KLG0	Campylobacter_phage	100.0	0.0e+00
WP_002905815.1|1252801_1252999_-	hypothetical protein	NA	X2KPN2	Campylobacter_phage	100.0	1.5e-27
WP_002857883.1|1252916_1253336_-	hypothetical protein	NA	X2KX19	Campylobacter_phage	100.0	6.3e-55
WP_002858146.1|1253397_1253856_-	hypothetical protein	NA	X2KQY5	Campylobacter_phage	100.0	2.0e-83
WP_002801920.1|1253904_1255188_-	hypothetical protein	NA	X2KRN1	Campylobacter_phage	100.0	1.3e-239
1253873:1253890	attR	TTATTTTTTGTATTTTAT	NA	NA	NA	NA
WP_002801918.1|1255184_1255556_-	DUF1353 domain-containing protein	NA	X2KRC3	Campylobacter_phage	100.0	9.7e-68
WP_002801917.1|1255545_1256010_-	hypothetical protein	NA	X2KM25	Campylobacter_phage	100.0	5.1e-74
WP_002789149.1|1256006_1256642_-	DUF4376 domain-containing protein	NA	X2KRD7	Campylobacter_phage	100.0	1.3e-96
WP_014517274.1|1256654_1257104_-	hypothetical protein	NA	X2KQT3	Campylobacter_phage	98.7	8.7e-79
WP_002858267.1|1257105_1258671_-	hypothetical protein	NA	X2KRN6	Campylobacter_phage	100.0	1.1e-205
WP_002788297.1|1258663_1259296_-	hypothetical protein	NA	X2KRC7	Campylobacter_phage	100.0	7.9e-110
WP_002788295.1|1259292_1259610_-|head,tail	head-tail adaptor protein	head,tail	X2KXD7	Campylobacter_phage	100.0	9.2e-51
WP_002788293.1|1259622_1260060_-|head,tail	phage gp6-like head-tail connector protein	head,tail	X2KR38	Campylobacter_phage	100.0	1.8e-76
WP_002788291.1|1260056_1260308_-	hypothetical protein	NA	X2KLU2	Campylobacter_phage	100.0	3.7e-18
WP_002788288.1|1260318_1261485_-|capsid	phage major capsid protein	capsid	X2KQ31	Campylobacter_phage	100.0	2.8e-214
WP_002788287.1|1261501_1262059_-|head,protease	HK97 family phage prohead protease	head,protease	X2KXE1	Campylobacter_phage	100.0	1.1e-96
WP_002788286.1|1262144_1263014_-	hypothetical protein	NA	X2KRE5	Campylobacter_phage	100.0	3.9e-168
WP_002857954.1|1263026_1268753_-	hypothetical protein	NA	X2KLJ2	Campylobacter_phage	99.9	0.0e+00
WP_002788283.1|1268812_1269151_+	hypothetical protein	NA	X2KLU6	Campylobacter_phage	100.0	1.6e-56
WP_002788282.1|1269142_1269358_-	hypothetical protein	NA	X2KXE3	Campylobacter_phage	100.0	2.2e-32
WP_002788281.1|1269438_1269795_-	hypothetical protein	NA	X2KRE9	Campylobacter_phage	100.0	1.8e-58
WP_002858135.1|1269791_1270772_-	hypothetical protein	NA	X2KRA7	Campylobacter_phage	100.0	2.3e-180
WP_002788276.1|1270943_1271294_-	hypothetical protein	NA	X2KXE7	Campylobacter_phage	100.0	7.3e-57
WP_002788274.1|1271294_1271837_-	HK97 gp10 family phage protein	NA	X2KRF4	Campylobacter_phage	98.9	3.7e-92
WP_002788272.1|1271833_1273006_-|portal	phage portal protein	portal	X2KR48	Campylobacter_phage	100.0	3.1e-216
WP_002788265.1|1273165_1273600_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	X2KQB2	Campylobacter_phage	100.0	3.2e-78
WP_002788263.1|1273654_1275280_-|terminase	terminase large subunit	terminase	X2KXM1	Campylobacter_phage	99.8	0.0e+00
WP_002788261.1|1275283_1275919_-|terminase	P27 family phage terminase small subunit	terminase	X2KRQ1	Campylobacter_phage	99.1	1.3e-109
WP_002788260.1|1276178_1276520_-	HNH endonuclease	NA	X2KRE4	Campylobacter_phage	100.0	1.1e-62
WP_002788257.1|1276506_1276797_-	hypothetical protein	NA	X2KM44	Campylobacter_phage	97.4	2.6e-15
>prophage 3
NC_017281	Campylobacter jejuni subsp. jejuni S3, complete sequence	1681364	1410109	1418521	1681364		Bodo_saltans_virus(37.5%)	9	NA	NA
WP_002867277.1|1410109_1411591_-	NTP transferase domain-containing protein	NA	A0A2H4UUJ1	Bodo_saltans_virus	29.7	3.0e-51
WP_002867276.1|1411592_1412318_-	class II aldolase/adducin family protein	NA	A0A2H4UUW4	Bodo_saltans_virus	27.5	1.0e-12
WP_002867275.1|1412304_1413606_-	HAD-IA family hydrolase	NA	A0A2H4UUR3	Bodo_saltans_virus	35.6	3.8e-26
WP_002867274.1|1413598_1414192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002870158.1|1414166_1414847_-	NTP transferase domain-containing protein	NA	A0A2K9L821	Tupanvirus	25.1	2.5e-08
WP_002860371.1|1414834_1415440_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	35.0	3.7e-16
WP_014517291.1|1415427_1416447_-	D-glycero-D-manno-heptose 7-phosphate kinase	NA	A0A222YW25	Synechococcus_phage	39.9	5.1e-58
WP_002867271.1|1416443_1417475_-	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	73.3	6.5e-146
WP_002867270.1|1417471_1418521_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	40.9	2.5e-76
>prophage 1
NC_017282	Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence	43222	0	12908	43222		Streptococcus_phage(80.0%)	12	NA	NA
WP_002804244.1|2632_2899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790730.1|2901_3462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002779704.1|3520_3787_-	hypothetical protein	NA	A0A2R3ZY63	Campylobacter_phage	90.4	6.8e-39
WP_002779703.1|3791_4349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002779702.1|4345_4858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790442.1|5395_5701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079254360.1|5690_6353_-	relaxase/mobilization nuclease domain-containing protein	NA	D0R0F7	Streptococcus_phage	99.1	4.9e-54
WP_002779755.1|6487_6661_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	100.0	4.6e-28
WP_002779752.1|6712_8632_-	tetracycline resistance ribosomal protection protein Tet(O)	NA	A0A1B0RXH7	Streptococcus_phage	98.3	0.0e+00
WP_002779751.1|8990_9170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790581.1|9188_10610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002779644.1|10715_12908_-	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	23.3	3.8e-18
>prophage 2
NC_017282	Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence	43222	24276	25934	43222		Yersinia_phage(50.0%)	3	NA	NA
WP_014517319.1|24276_24702_-	single-stranded DNA-binding protein	NA	A9DEQ4	Yersinia_phage	36.4	1.9e-11
WP_002801682.1|24735_25371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041176772.1|25367_25934_-	Rha family transcriptional regulator	NA	X2KM03	Campylobacter_phage	48.4	4.8e-18
>prophage 3
NC_017282	Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence	43222	29875	30490	43222		Bacteroides_phage(100.0%)	1	NA	NA
WP_014517323.1|29875_30490_+	recombinase family protein	NA	H2A0H0	Bacteroides_phage	33.5	3.2e-15
>prophage 4
NC_017282	Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence	43222	34109	35336	43222		Escherichia_phage(100.0%)	1	NA	NA
WP_002823310.1|34109_35336_-	toprim domain-containing protein	NA	A0A1W6JT61	Escherichia_phage	31.1	2.3e-20
>prophage 5
NC_017282	Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence	43222	39144	39756	43222		Burkholderia_virus(100.0%)	1	NA	NA
WP_031263757.1|39144_39756_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	43.3	6.2e-27
