The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015161	Deinococcus proteolyticus MRP, complete sequence	2147060	1704512	1711893	2147060		Staphylococcus_phage(66.67%)	7	NA	NA
WP_013615340.1|1704512_1705439_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SA11	Synechococcus_phage	33.9	1.6e-39
WP_013615341.1|1705501_1706704_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	2.3e-102
WP_013615342.1|1706703_1707378_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.0	1.1e-27
WP_083801580.1|1707377_1708475_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.2	5.5e-34
WP_013615344.1|1708911_1709460_-	RNA 2'-phosphotransferase	NA	A0A2H4IBJ2	Erwinia_phage	40.2	5.0e-28
WP_013615345.1|1709456_1710467_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_013615346.1|1710666_1711893_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.3	1.8e-118
>prophage 1
NC_015162	Deinococcus proteolyticus MRP plasmid pDEIPR02, complete sequence	195800	78685	118657	195800	transposase	Streptococcus_phage(25.0%)	53	NA	NA
WP_013615857.1|78685_79852_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	52.5	1.4e-104
WP_148231990.1|80531_82031_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_013615860.1|82058_83084_+	hypothetical protein	NA	F8J1D6	Lactobacillus_phage	30.8	9.7e-33
WP_013615861.1|83116_83644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615862.1|83791_84400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615863.1|84396_85080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615864.1|85279_86218_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L4X0	Tupanvirus	23.5	3.3e-11
WP_013615865.1|86300_87200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615866.1|87199_87829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615867.1|88028_88778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041223067.1|88774_89191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615869.1|89392_89761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615870.1|89757_90354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615871.1|90350_90554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615872.1|90599_91601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615873.1|91597_92527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148231991.1|92567_93029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615875.1|93019_93262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615876.1|93305_93971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615877.1|94067_94496_+	DUF3846 domain-containing protein	NA	NA	NA	NA	NA
WP_013615878.1|94513_95017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615879.1|95087_97727_-	UvrD-helicase domain-containing protein	NA	A0A0S0NAE3	Pseudomonas_phage	26.0	2.2e-28
WP_013615880.1|97766_98291_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_013615881.1|98295_98676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013615883.1|99146_99956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615884.1|99955_100702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615885.1|100760_101588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615886.1|101620_102340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615887.1|102438_102735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615888.1|102731_102959_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_013615889.1|102955_103528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615890.1|103524_103803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013615891.1|103864_104368_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_013615892.1|104364_105000_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_148231993.1|105025_105697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169310710.1|105999_106431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169310663.1|107400_107769_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169310664.1|107801_108260_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083801595.1|108418_108613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169310711.1|108587_108797_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083801594.1|108916_109216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013615894.1|109865_110516_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013615895.1|110563_112750_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.7	1.8e-129
WP_013615896.1|112751_113351_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_013615897.1|113366_113633_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_013615898.1|113625_114531_+	cation transporter	NA	NA	NA	NA	NA
WP_126352310.1|114620_115196_+	SCO family protein	NA	NA	NA	NA	NA
WP_013615900.1|115192_115594_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	38.6	9.7e-13
WP_126352311.1|115667_116012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041223109.1|116013_116346_-	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	41.6	1.2e-11
WP_013615903.1|116411_116657_-	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_126352280.1|116738_117438_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	36.2	6.0e-26
WP_013615904.1|117568_118657_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_015163	Deinococcus proteolyticus MRP plasmid pDEIPR04, complete sequence	97188	7362	66669	97188	transposase,protease,integrase	Bacillus_phage(21.05%)	45	34831:34868	65458:65495
WP_013616000.1|7362_8265_+|protease	Protein of unknown function DUF2268, Zn-dependent protease-related protein	protease	NA	NA	NA	NA
WP_169310716.1|8490_9078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013616002.1|9074_9737_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.1e-10
WP_013616003.1|9733_10519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013616004.1|10695_11241_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148232021.1|11257_12130_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013616006.1|12126_12414_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013616007.1|12598_14785_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_013616008.1|15167_16796_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013616009.1|17137_18913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083801597.1|20857_21106_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013616010.1|21169_21739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013616011.1|23201_24098_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	37.5	2.1e-23
WP_013616014.1|26475_27102_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	31.0	1.3e-08
WP_013616015.1|27212_27683_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_013616016.1|27863_28628_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	32.5	1.4e-07
WP_013616017.1|28642_29254_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_049775341.1|29429_29858_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	39.4	6.1e-13
WP_169310717.1|29779_32368_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	46.5	1.9e-210
WP_013616019.1|33818_34667_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
34831:34868	attL	AAGAGAGAGCCCCATCAAGCTTGATGGGGCTCTCTCTT	NA	NA	NA	NA
WP_041222302.1|35002_35986_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_148232029.1|36113_36953_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013616021.1|36985_37273_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013616022.1|37718_38258_+	CueP family metal-binding protein	NA	NA	NA	NA	NA
WP_148232023.1|38458_38944_+	DUF305 domain-containing protein	NA	A0A1E1EVF9	Acanthamoeba_castellanii_mimivirus	38.7	5.3e-05
WP_013616025.1|39015_39681_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	4.3e-42
WP_013616026.1|39684_40800_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.1	1.0e-27
WP_013616027.1|41400_41802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148232024.1|41994_42177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013616028.1|42216_42930_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	36.5	6.5e-28
WP_041223169.1|44550_45138_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	38.5	9.2e-20
WP_013616030.1|46786_48157_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_013616031.1|48223_49147_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	39.5	5.7e-08
WP_013616032.1|49143_49911_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	34.4	2.2e-13
WP_013616033.1|50442_51561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013616034.1|51758_52985_-	DUF790 family protein	NA	NA	NA	NA	NA
WP_049775355.1|52971_54345_-	DEAD/DEAH box helicase family protein	NA	A0A1D8BJ75	Sulfolobus_islandicus_filamentous_virus	24.3	2.2e-16
WP_169310718.1|54383_54623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169310719.1|56765_57296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126352314.1|58477_59077_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	41.1	5.7e-17
WP_013616038.1|59100_59766_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	2.9e-38
WP_013616039.1|59769_60867_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	7.4e-31
WP_013616040.1|60922_63280_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	5.2e-90
WP_148231767.1|63309_64010_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	35.3	6.6e-25
WP_041223171.1|65646_66669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
65458:65495	attR	AAGAGAGAGCCCCATCAAGCTTGATGGGGCTCTCTCTT	NA	NA	NA	NA
