The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015214	Lactobacillus amylovorus, complete sequence	2078001	247164	291359	2078001	protease,tRNA,integrase,transposase	Streptococcus_phage(15.38%)	40	279015:279070	286857:286912
WP_080890046.1|247164_248394_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.1	3.0e-65
WP_013437097.1|248781_249306_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.3	4.6e-23
WP_013437098.1|249459_250341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013437099.1|250542_251058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013437100.1|251213_251534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013641449.1|251520_252045_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013437102.1|252306_252588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641450.1|252644_253880_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	54.0	1.2e-101
WP_013641451.1|253971_255573_+	APC family permease	NA	NA	NA	NA	NA
WP_013641452.1|255605_256436_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_013641453.1|256554_258177_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_013437106.1|258287_258533_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004897277.1|258751_259975_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	3.4e-93
WP_013641455.1|260315_261683_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_013437108.1|261696_263190_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	38.5	1.1e-66
WP_013641456.1|263269_263626_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_013437110.1|263628_264759_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	9.4e-29
WP_013641457.1|264832_265540_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_013437112.1|265709_266681_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_013437113.1|266814_267372_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_013641458.1|267373_270868_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011254102.1|270883_271126_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_013437115.1|271200_271575_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_013437116.1|271574_271937_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041808263.1|271977_273222_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	26.2	2.9e-15
WP_013641460.1|273316_275485_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	47.6	3.9e-108
WP_013437119.1|275538_276429_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_013641461.1|276508_277534_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_013641462.1|277550_279098_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	36.9	2.0e-82
279015:279070	attL	TTCCCAACAATGCGTCCAGAACGTGTTGAAAGCGTAGAAGCTGAAGTTAAGGCTGA	NA	NA	NA	NA
WP_013641463.1|279336_280497_+	adenine-specific methyltransferase EcoRI family protein	NA	A0A1B0XVT8	Campylobacter_phage	33.5	3.5e-23
WP_013641464.1|280498_281659_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_013641465.1|282053_282431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041808264.1|282513_283497_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_013641467.1|283515_284025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641468.1|284185_285211_+	hypothetical protein	NA	S4TF11	uncultured_marine_virus	29.5	1.4e-07
WP_013641469.1|285226_285427_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013641470.1|285492_286725_+|integrase	site-specific integrase	integrase	H7BUX8	unidentified_phage	40.9	1.0e-84
WP_013641471.1|287009_287465_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
286857:286912	attR	TTCCCAACAATGCGTCCAGAACGTGTTGAAAGCGTAGAAGCTGAAGTTAAGGCTGA	NA	NA	NA	NA
WP_013437122.1|288307_288763_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_013641472.1|288869_291359_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.3	7.4e-119
>prophage 2
NC_015214	Lactobacillus amylovorus, complete sequence	2078001	1004226	1074643	2078001	protease,tRNA,integrase,transposase	unidentified_phage(18.18%)	60	1006420:1006434	1018333:1018347
WP_013437788.1|1004226_1005543_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_013641828.1|1005542_1006451_+	tyrosine recombinase XerC	NA	A0A142K830	Mycobacterium_phage	30.6	4.4e-13
1006420:1006434	attL	AAAAATATTTTCCTC	NA	NA	NA	NA
WP_013437789.1|1006460_1006985_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_013437790.1|1006996_1008394_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.0	2.0e-28
WP_013641829.1|1008533_1009430_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_013641830.1|1009526_1010795_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_013437793.1|1010791_1011649_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013437794.1|1011691_1012501_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013437795.1|1012705_1013095_+	CrcB family protein	NA	NA	NA	NA	NA
WP_013437796.1|1013096_1013474_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_013641831.1|1013515_1014916_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_013641832.1|1015094_1015583_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_081456854.1|1015864_1015999_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_013437802.1|1016146_1016344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158304738.1|1016349_1016694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013437804.1|1016858_1018331_-	APC family permease	NA	NA	NA	NA	NA
WP_013641833.1|1018568_1020662_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
1018333:1018347	attR	AAAAATATTTTCCTC	NA	NA	NA	NA
WP_013437806.1|1020680_1021943_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_013437807.1|1022049_1022721_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013641834.1|1022713_1024054_-	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_013641835.1|1024165_1025932_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	41.1	7.4e-81
WP_013437810.1|1026024_1026477_+	Trp operon repressor	NA	NA	NA	NA	NA
WP_013641836.1|1026620_1027616_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_013641838.1|1027835_1028468_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_148226137.1|1028716_1029805_+	serine hydrolase	NA	NA	NA	NA	NA
WP_013641840.1|1029874_1030696_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_013437815.1|1030705_1031263_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_013641841.1|1031338_1032544_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_013641842.1|1032785_1033139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641844.1|1033804_1033975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641845.1|1034162_1035608_+	amino acid permease	NA	NA	NA	NA	NA
WP_013641846.1|1035684_1036314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013437823.1|1036364_1036808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641847.1|1036856_1037969_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013437825.1|1038036_1038897_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013641848.1|1039021_1040089_+	YSIRK signal domain/LPXTG anchor domain surface protein	NA	NA	NA	NA	NA
WP_013641849.1|1040153_1041086_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_013437830.1|1041219_1041864_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_013641850.1|1041920_1042451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641851.1|1042544_1043582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641852.1|1043583_1044159_+	AAA family ATPase	NA	C1KFF1	Lactobacillus_virus	22.4	2.5e-09
WP_013641853.1|1044192_1044837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641854.1|1044805_1046290_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_013641855.1|1046424_1047315_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_013641856.1|1048283_1049111_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_013641857.1|1049301_1053723_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1V0SII8	Klosneuvirus	23.0	7.1e-32
WP_013641858.1|1053722_1054697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641859.1|1054698_1055379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641860.1|1055605_1057657_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	25.4	4.9e-28
WP_013641863.1|1059284_1060322_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_013641865.1|1060940_1061990_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	6.8e-50
WP_013641867.1|1062671_1062851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641869.1|1063534_1064254_+	Fic family protein	NA	NA	NA	NA	NA
WP_013641870.1|1064346_1065000_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_013641872.1|1065369_1066359_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	35.7	1.8e-07
WP_013641875.1|1068057_1068609_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_013438435.1|1069894_1070944_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	8.9e-50
WP_081456856.1|1071142_1072906_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	28.4	6.4e-16
WP_179943692.1|1073130_1074459_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	27.7	2.5e-41
WP_013641879.1|1074412_1074643_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_015214	Lactobacillus amylovorus, complete sequence	2078001	1252781	1305938	2078001	tRNA,integrase,terminase,tail,holin,head,portal	Lactobacillus_prophage(34.38%)	71	1269649:1269668	1305964:1305983
WP_013642029.1|1252781_1254845_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_013438076.1|1254837_1255755_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_013438077.1|1256014_1256767_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_013642030.1|1256766_1257672_-	GTPase Era	NA	NA	NA	NA	NA
WP_013642031.1|1257671_1258196_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_013438080.1|1258198_1259158_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	46.8	1.0e-47
WP_013642032.1|1259189_1259633_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	32.9	9.0e-12
WP_013438082.1|1261320_1261644_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_013642033.1|1261643_1263047_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_013642034.1|1263049_1263490_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	32.1	9.3e-09
WP_013642035.1|1263476_1264709_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.0	6.9e-102
WP_013642036.1|1264674_1265898_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_013642037.1|1265907_1266609_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.7	2.3e-09
WP_002880182.1|1266958_1267135_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013438084.1|1267311_1268148_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_013438086.1|1268921_1269449_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
1269649:1269668	attL	TGTTGCACAAATGTTGCACA	NA	NA	NA	NA
WP_013642038.1|1269857_1270736_-	lysin	NA	Q38373	Lactococcus_phage	50.5	4.1e-80
WP_013642039.1|1270725_1271148_-|holin	phage holin	holin	NA	NA	NA	NA
WP_013642040.1|1271137_1271341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642041.1|1271330_1271570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642042.1|1271586_1271988_-	hypothetical protein	NA	Q6SEB9	Lactobacillus_prophage	70.7	1.5e-50
WP_013642043.1|1272000_1275225_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_013642044.1|1275237_1275720_-	hypothetical protein	NA	Q6SEC1	Lactobacillus_prophage	56.0	6.2e-06
WP_013642045.1|1275719_1278152_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	42.4	5.1e-165
WP_148226126.1|1278151_1279060_-	hypothetical protein	NA	Q6SEC3	Lactobacillus_prophage	37.7	4.5e-42
WP_013642047.1|1279059_1281738_-|tail	phage tail tape measure protein	tail	A0A0A1ENQ9	Lactobacillus_phage	62.4	1.1e-109
WP_013642048.1|1281737_1282043_-	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	44.8	9.6e-13
WP_013642049.1|1282090_1282477_-|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	39.8	2.0e-15
WP_013642050.1|1282487_1283138_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_013642051.1|1283138_1283525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642052.1|1283514_1283898_-	HK97 gp10 family phage protein	NA	B5SP35	Lactococcus_phage	44.5	3.9e-19
WP_013642053.1|1283890_1284202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049770877.1|1284185_1284545_-|head,tail	phage head-tail connector protein	head,tail	Q6SED1	Lactobacillus_prophage	73.3	8.9e-42
WP_013642055.1|1284630_1285572_-	hypothetical protein	NA	Q6SED2	Lactobacillus_prophage	88.3	1.1e-155
WP_013642056.1|1285586_1286150_-	DUF4355 domain-containing protein	NA	Q6SED3	Lactobacillus_prophage	70.2	5.8e-64
WP_013642057.1|1286246_1286495_-	hypothetical protein	NA	Q5ULN6	Lactobacillus_virus	50.6	4.4e-16
WP_013642058.1|1286554_1287541_-	hypothetical protein	NA	A0A0A1EKX3	Lactobacillus_phage	44.2	1.1e-68
WP_013642059.1|1287524_1288955_-|portal	phage portal protein	portal	Q6SED7	Lactobacillus_prophage	56.5	2.0e-148
WP_013642060.1|1288966_1290235_-|terminase	PBSX family phage terminase large subunit	terminase	Q9AZ91	Lactobacillus_prophage	85.3	3.5e-218
WP_041808214.1|1290221_1290647_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	57.4	1.8e-33
WP_013642062.1|1290713_1291160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642063.1|1291189_1291612_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_148226138.1|1292685_1293180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081456862.1|1293185_1293377_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013642067.1|1293459_1293855_-	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	59.1	1.2e-34
WP_013642070.1|1294064_1294229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642071.1|1294216_1294456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642072.1|1294448_1294637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041808217.1|1294776_1294974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642074.1|1294970_1295417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642075.1|1295413_1295644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642076.1|1295640_1296375_-	helix-turn-helix domain-containing protein	NA	A0A2H4JEL5	uncultured_Caudovirales_phage	59.5	4.2e-30
WP_013642077.1|1296376_1297174_-	ERF family protein	NA	Q6SE93	Lactobacillus_prophage	46.0	2.8e-56
WP_013642078.1|1297176_1298058_-	DUF1351 domain-containing protein	NA	A0A1S5SE30	Streptococcus_phage	24.5	9.3e-08
WP_013642079.1|1298078_1298450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642080.1|1298514_1298685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642081.1|1298701_1298926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642082.1|1298948_1299104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642083.1|1299093_1299393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118027135.1|1299398_1299593_-	helix-turn-helix transcriptional regulator	NA	Q6SE98	Lactobacillus_prophage	50.0	8.2e-10
WP_013642085.1|1299670_1299892_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_013642086.1|1299888_1300125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642087.1|1300111_1300921_-	phage repressor protein/antirepressor Ant	NA	L0P8P6	Lactobacillus_phage	68.4	6.1e-99
WP_013642088.1|1300980_1301187_-	helix-turn-helix transcriptional regulator	NA	X2CXM8	Lactobacillus_phage	46.7	6.9e-07
WP_013642089.1|1301358_1301727_+	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	43.5	1.4e-13
WP_013642090.1|1301730_1302171_+	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	38.2	5.3e-12
WP_013642091.1|1302197_1302515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642092.1|1302540_1303260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081456882.1|1303479_1303794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642094.1|1303819_1304623_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_013642095.1|1304816_1305938_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	43.2	1.6e-73
1305964:1305983	attR	TGTTGCACAAATGTTGCACA	NA	NA	NA	NA
>prophage 4
NC_015214	Lactobacillus amylovorus, complete sequence	2078001	1465398	1523265	2078001	protease,transposase	Bacillus_phage(26.67%)	56	NA	NA
WP_179943692.1|1465398_1466727_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	27.7	2.5e-41
WP_013641879.1|1466680_1466911_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081456857.1|1466975_1467326_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004897518.1|1467319_1467496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041808222.1|1467725_1469858_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_041808224.1|1469938_1471195_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_013642197.1|1472633_1474271_-	ATPase	NA	W8CYF6	Bacillus_phage	32.5	1.2e-29
WP_013642198.1|1474270_1474951_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	3.3e-29
WP_013642199.1|1475070_1475709_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_013642200.1|1475708_1476476_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	1.5e-14
WP_013642201.1|1476479_1477355_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_013642202.1|1477359_1478265_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_013642203.1|1478283_1479174_-	phosphate ABC transporter substrate-binding protein	NA	M1U9L0	Synechococcus_phage	23.8	8.8e-06
WP_013642204.1|1479870_1480968_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	44.9	4.0e-85
WP_013642205.1|1481234_1481834_-	SHOCT domain-containing protein	NA	Q38183	Lactococcus_phage	27.4	2.0e-06
WP_013642206.1|1481906_1482704_-	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	30.9	1.1e-20
WP_013642207.1|1482797_1483013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642209.1|1483390_1485772_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_013438288.1|1485830_1486268_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_013438289.1|1486317_1486599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438292.1|1486725_1487589_-	sugar transporter	NA	NA	NA	NA	NA
WP_013642211.1|1487958_1488300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642212.1|1488409_1488862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438294.1|1488980_1492169_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_118026958.1|1492161_1493253_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.3	1.3e-54
WP_013438296.1|1493259_1494537_-	dihydroorotase	NA	NA	NA	NA	NA
WP_013438297.1|1494536_1495493_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	32.1	3.2e-22
WP_013438298.1|1495638_1496181_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_013438299.1|1496355_1497279_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_013438300.1|1497532_1498240_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_013642214.1|1498241_1498880_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	31.9	2.6e-28
WP_013642216.1|1499403_1502025_+	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.4	1.8e-83
WP_013642217.1|1502121_1503456_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_014565993.1|1503496_1503775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130898834.1|1503702_1503858_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_013642219.1|1503908_1504427_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013438307.1|1504492_1504789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438308.1|1504890_1505184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438309.1|1505395_1506058_+	serine dehydratase	NA	NA	NA	NA	NA
WP_013438310.1|1506071_1506953_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_013642220.1|1506952_1507276_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_013642221.1|1507290_1507524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642223.1|1508519_1509380_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013642224.1|1509392_1510133_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.5	7.0e-17
WP_013438314.1|1510142_1510817_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013438315.1|1510797_1511457_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013642225.1|1511604_1511838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641474.1|1511885_1513268_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.1	1.4e-58
WP_013642226.1|1513334_1514189_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_041808226.1|1514188_1514854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642228.1|1514856_1515186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642230.1|1515880_1517626_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013642231.1|1517976_1518615_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013642232.1|1518758_1519166_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_013642233.1|1519258_1520206_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_004897277.1|1522041_1523265_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	3.4e-93
>prophage 5
NC_015214	Lactobacillus amylovorus, complete sequence	2078001	1632481	1640969	2078001	transposase	Synechococcus_phage(33.33%)	8	NA	NA
WP_013642315.1|1632481_1633078_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.3	6.2e-32
WP_013642316.1|1633087_1634125_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.5	6.5e-61
WP_013438443.1|1634126_1635578_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	4.1e-61
WP_013438444.1|1635553_1637782_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	2.7e-144
WP_013438445.1|1637778_1638450_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013642317.1|1638446_1638701_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_013642318.1|1638701_1639418_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	38.7	1.3e-39
WP_013438404.1|1639688_1640969_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.5	1.3e-42
>prophage 6
NC_015214	Lactobacillus amylovorus, complete sequence	2078001	1769251	1812736	2078001	protease,transposase	Bacillus_phage(30.0%)	45	NA	NA
WP_013642400.1|1769251_1769938_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_013642401.1|1770009_1770660_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	39.6	6.2e-09
WP_013642402.1|1770709_1772512_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_013438565.1|1772524_1773274_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	2.6e-35
WP_013642403.1|1773420_1774695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642404.1|1774789_1775491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013438568.1|1775514_1775907_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_013642405.1|1776022_1776322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438570.1|1776376_1776517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642406.1|1776614_1777610_-	asparaginase	NA	NA	NA	NA	NA
WP_013642407.1|1777629_1778400_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013642408.1|1778527_1779865_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_013642409.1|1780553_1781054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013438575.1|1781086_1781650_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013642410.1|1782241_1782394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013438435.1|1782611_1783661_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	8.9e-50
WP_148226142.1|1783825_1784449_-	DNA polymerase III	NA	NA	NA	NA	NA
WP_013642412.1|1784668_1786069_-	KAP family P-loop domain-containing protein	NA	R9TRQ8	Vibrio_phage	30.0	5.6e-23
WP_013642413.1|1786390_1787446_-	Abi family protein	NA	NA	NA	NA	NA
WP_013642414.1|1787784_1788567_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013642415.1|1788556_1789717_-	MFS transporter	NA	NA	NA	NA	NA
WP_013642416.1|1789734_1791054_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.6	1.5e-30
WP_013642417.1|1791106_1792633_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	1.0e-22
WP_013642418.1|1792649_1794152_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_148226130.1|1794275_1795145_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013642420.1|1795479_1795671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642421.1|1795788_1796709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642422.1|1797041_1797527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642423.1|1797715_1798519_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013642424.1|1798540_1799179_-	lipolytic protein G-D-S-L family	NA	NA	NA	NA	NA
WP_013642425.1|1799178_1800657_-	DUF4127 family protein	NA	NA	NA	NA	NA
WP_013642426.1|1800658_1801417_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013642427.1|1801413_1802715_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_013642428.1|1802717_1803404_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_148226131.1|1803909_1804938_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.8	6.5e-45
WP_013642430.1|1805272_1807003_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.7	1.8e-95
WP_013642432.1|1807512_1808118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642433.1|1808154_1808676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642434.1|1808733_1808895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642435.1|1808913_1809297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642436.1|1809411_1810287_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.7	3.9e-75
WP_013641778.1|1810626_1810803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179943697.1|1810796_1811030_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_179943692.1|1811223_1812552_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	27.7	2.5e-41
WP_013641879.1|1812505_1812736_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_015214	Lactobacillus amylovorus, complete sequence	2078001	1856847	1946701	2078001	protease,transposase,bacteriocin	Bacillus_phage(27.27%)	103	NA	NA
WP_013642468.1|1856847_1857678_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013642469.1|1857750_1859265_-	L-lactate permease	NA	NA	NA	NA	NA
WP_013438647.1|1859617_1859983_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_046433828.1|1860052_1860379_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000945966.1|1860498_1862118_-	recombinase family protein	NA	C7F8K5	Bacillus_phage	26.9	1.1e-25
WP_001205019.1|1862967_1863762_-	replication initiator protein A	NA	M1PFC4	Streptococcus_phage	34.0	7.5e-09
WP_000998386.1|1863834_1864221_-	cysteine-rich VLP protein	NA	NA	NA	NA	NA
WP_009249723.1|1864210_1865878_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001126628.1|1865849_1866248_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_129974465.1|1866903_1867053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001909500.1|1867217_1867415_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013642473.1|1867417_1869340_-	tetracycline resistance ribosomal protection protein Tet(W)	NA	E4ZFJ7	Streptococcus_phage	99.7	0.0e+00
WP_162467432.1|1869898_1870189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642475.1|1870256_1870550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642476.1|1870650_1871445_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_013642477.1|1871444_1872092_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	8.0e-17
WP_013438653.1|1872126_1873017_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013438654.1|1873257_1873536_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013642479.1|1874087_1876091_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_013438658.1|1876114_1877029_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004897518.1|1877953_1878130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081456857.1|1878123_1878474_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013641879.1|1878538_1878769_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_179943692.1|1878722_1880051_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	27.7	2.5e-41
WP_013642481.1|1880359_1881574_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013642482.1|1881566_1882463_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	30.5	3.3e-05
WP_013642483.1|1882499_1882739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642484.1|1882998_1883421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642485.1|1883447_1883642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003549779.1|1883774_1883984_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013642486.1|1883998_1884538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642487.1|1884542_1884725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721007.1|1884891_1885107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721006.1|1885176_1885371_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_013642488.1|1885388_1885679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721002.1|1886232_1886430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642490.1|1886816_1887413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642491.1|1887423_1889586_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.6	4.0e-44
WP_013642492.1|1889746_1890148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642493.1|1890174_1890429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642494.1|1890725_1891892_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	6.2e-36
WP_013642495.1|1892091_1892331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642496.1|1892626_1892902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642497.1|1892960_1893158_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_013642498.1|1893167_1893410_-|bacteriocin	bacteriocin lactacin F subunit LafA	bacteriocin	NA	NA	NA	NA
WP_013642499.1|1893650_1893863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158083624.1|1893868_1895029_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013642501.1|1895078_1895255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642502.1|1895398_1896616_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_013642503.1|1896825_1896975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642504.1|1897022_1897823_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_179943698.1|1897815_1899108_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_013642507.1|1899408_1899555_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_013642508.1|1899588_1899861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642509.1|1899903_1900077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642510.1|1900207_1901419_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013086945.1|1901579_1901747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642511.1|1901876_1903076_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013642512.1|1903213_1903432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013086947.1|1903447_1903855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642513.1|1904024_1904210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642514.1|1904374_1906678_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_013642515.1|1907032_1908364_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	38.0	1.5e-62
WP_013438667.1|1908739_1908964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438668.1|1909039_1909363_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_013642516.1|1909442_1910672_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_013438670.1|1910997_1911162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642517.1|1911484_1911775_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_013642518.1|1911847_1912597_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_013438673.1|1912608_1914180_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_013642519.1|1914228_1915383_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	6.8e-27
WP_013438675.1|1915386_1916073_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	1.3e-36
WP_041808373.1|1916255_1918115_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	1.6e-46
WP_013642521.1|1918124_1919849_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	2.9e-37
WP_013642522.1|1919968_1920745_-	DUF1129 family protein	NA	NA	NA	NA	NA
WP_013438679.1|1920753_1921854_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_013438680.1|1921910_1922174_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_013438681.1|1922166_1923051_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.8	6.4e-17
WP_013438682.1|1923028_1923808_-	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	1.1e-25
WP_013642523.1|1923822_1924659_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	34.2	6.1e-17
WP_013438684.1|1924675_1925398_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_013438685.1|1925558_1926095_+	CvpA family protein	NA	NA	NA	NA	NA
WP_013642524.1|1926142_1927072_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_013642525.1|1927077_1927869_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_013438688.1|1927965_1928514_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	40.4	4.1e-30
WP_013438689.1|1928527_1929067_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.5	3.2e-27
WP_013438690.1|1929216_1929840_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013438691.1|1929950_1930193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642526.1|1930282_1931695_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_013642527.1|1931735_1932410_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	5.4e-32
WP_013438694.1|1932411_1933473_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013642528.1|1933473_1934001_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013438696.1|1934113_1934713_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_013438697.1|1934852_1935596_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013438698.1|1935592_1936354_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_013438699.1|1936406_1937045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013438700.1|1937076_1937871_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_013642529.1|1938015_1939242_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_013438702.1|1939325_1939523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642530.1|1939885_1940557_-	membrane protein	NA	NA	NA	NA	NA
WP_013438707.1|1942252_1944787_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.5	3.9e-67
WP_013642531.1|1944987_1945350_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	68.6	3.0e-21
WP_013641421.1|1945651_1946701_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	8.9e-50
>prophage 8
NC_015214	Lactobacillus amylovorus, complete sequence	2078001	1996653	2062253	2078001	protease,transposase,holin	Moraxella_phage(16.67%)	60	NA	NA
WP_013438746.1|1996653_1998783_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.6	1.7e-116
WP_013642558.1|1999098_1999971_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013642559.1|1999963_2001271_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_013642560.1|2001356_2002058_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	7.6e-37
WP_013642561.1|2002067_2004608_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013642562.1|2004656_2004893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081456873.1|2004947_2006564_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_013642564.1|2006853_2007828_+	SLAP domain-containing protein	NA	Q6SE63	Lactobacillus_prophage	54.4	6.5e-63
WP_013642565.1|2007901_2008582_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_013642566.1|2008848_2009247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642567.1|2009341_2010283_-	serine hydrolase	NA	NA	NA	NA	NA
WP_013642568.1|2010282_2011569_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003625019.1|2011561_2011801_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_013642569.1|2011834_2013073_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.9	3.1e-25
WP_013642570.1|2013072_2014587_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.1	9.0e-35
WP_013438768.1|2014602_2014755_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_013642571.1|2014906_2015203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041808249.1|2015221_2016358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438771.1|2016947_2017418_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_013642573.1|2017559_2019416_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.9	6.8e-69
WP_013642574.1|2019570_2020740_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_081456874.1|2020910_2021021_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_013642575.1|2021173_2021590_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_049770887.1|2021617_2021827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642577.1|2021826_2023401_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.7	3.4e-13
WP_013642578.1|2023504_2024371_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013642579.1|2024506_2025013_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_013642580.1|2025117_2025495_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	40.3	3.3e-07
WP_013642581.1|2025558_2026218_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013642582.1|2026307_2027411_+	YdcF family protein	NA	NA	NA	NA	NA
WP_013642583.1|2027434_2029774_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	38.0	7.9e-30
WP_013438783.1|2029818_2030424_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_013642584.1|2030543_2031584_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	42.0	1.6e-70
WP_013642585.1|2031693_2032521_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_013642586.1|2032641_2033361_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_013642588.1|2034481_2035129_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.9	2.0e-47
WP_013642589.1|2035153_2035840_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	53.0	4.9e-57
WP_013642590.1|2035910_2036711_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013438790.1|2036934_2038242_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	28.5	2.6e-38
WP_013642591.1|2038449_2039181_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013438797.1|2039361_2040669_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.9	1.1e-44
WP_013642592.1|2040970_2042281_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.3	5.9e-51
WP_013438799.1|2042375_2043110_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_013438800.1|2043157_2043412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642593.1|2043778_2045407_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013642594.1|2045437_2046700_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013642595.1|2046862_2047303_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_013438804.1|2047314_2047692_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013438805.1|2047691_2047979_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013642596.1|2047978_2049907_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.2	1.2e-95
WP_013642597.1|2049903_2050551_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_013642599.1|2052177_2052633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013642600.1|2052659_2053805_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	34.0	1.1e-53
WP_179943699.1|2053806_2055207_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_013642602.1|2055261_2055546_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_013642603.1|2055558_2056020_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_013642604.1|2056035_2056653_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_013642605.1|2056659_2058705_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_013642607.1|2059989_2061270_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.8	1.5e-43
WP_013642608.1|2061536_2062253_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
