The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012090	Mycobacterium tuberculosis W-148 chromosome, complete genome	4418548	2715611	2753883	4418548	head,tRNA,integrase,capsid,terminase,protease	Mycobacterium_phage(33.33%)	46	2744412:2744439	2754036:2754063
WP_003413486.1|2715611_2717690_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2717798_2718026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2718022_2719408_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2719752_2720253_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2720269_2720710_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2720805_2721534_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2721518_2721872_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2721884_2722310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2722306_2722981_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2723058_2723880_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2724015_2724909_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2724911_2725730_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2725744_2726926_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2726984_2727416_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2727929_2729171_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2729585_2729843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2730189_2731314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2731315_2731855_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2733331_2733613_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2733757_2734243_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2734269_2734524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2734527_2736864_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2736892_2737135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2737135_2737813_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2738008_2738665_+	DedA family protein	NA	NA	NA	NA	NA
WP_003910926.1|2738827_2739274_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2739448_2739781_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2739900_2740260_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2740361_2740820_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2740955_2741336_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2741332_2742829_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2743063_2743255_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2744412:2744439	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2744545_2744977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2744973_2745972_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2745985_2746450_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2746437_2746689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2746859_2748299_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2748306_2748840_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2748992_2749484_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2749650_2749974_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2750053_2750299_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2750295_2751723_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2751724_2752117_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2752113_2752374_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2752390_2752753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2752755_2753883_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2754036:2754063	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
