The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	176334	271940	3570858	holin,capsid,portal,integrase,terminase,tail,protease,head,plate,tRNA	Shigella_phage(11.54%)	91	266720:266736	279707:279723
WP_010937452.1|176334_177009_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_010937453.1|177037_178027_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010937454.1|178038_178815_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_010937455.1|179040_179643_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	40.2	3.8e-21
WP_010937456.1|180028_180436_-	response regulator	NA	NA	NA	NA	NA
WP_010937457.1|180579_181389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937458.1|181385_181646_-	lipoprotein	NA	NA	NA	NA	NA
WP_010937459.1|181718_182330_-	DUF4881 domain-containing protein	NA	NA	NA	NA	NA
WP_010937460.1|182352_183405_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010937461.1|183426_183723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937462.1|184042_186916_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_010937463.1|186985_189547_+	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
WP_010937464.1|190003_190387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937466.1|190854_192243_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_010937467.1|192239_194399_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	32.0	5.7e-75
WP_010937468.1|194395_195367_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_010937469.1|195387_196386_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_010937470.1|196599_197121_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010937471.1|197146_198142_-	KpsF/GutQ family sugar-phosphate isomerase	NA	E5E465	Acinetobacter_phage	33.2	6.3e-21
WP_010937472.1|198444_199833_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	29.4	1.2e-46
WP_010937473.1|199860_203094_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_010937474.1|203532_204093_+	lipoprotein	NA	NA	NA	NA	NA
WP_014524196.1|204153_205065_+	cation transporter	NA	NA	NA	NA	NA
WP_010937476.1|205349_206363_-	ATP-binding cassette domain-containing protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	21.4	3.4e-06
WP_010937477.1|206373_207360_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	7.4e-14
WP_010937478.1|207362_208283_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010937479.1|208284_209262_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010937480.1|209431_210994_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010937481.1|211426_213496_+	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_010937482.1|213724_214906_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_164561858.1|215107_215257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937483.1|215483_216485_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	39.1	2.8e-24
WP_010937484.1|216494_218696_-	thiosulfate reductase	NA	NA	NA	NA	NA
WP_010937486.1|219257_220889_-	trehalose-binding protein	NA	NA	NA	NA	NA
WP_010937487.1|221144_222044_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_010937488.1|222193_223003_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010937489.1|223207_224605_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_010937490.1|224591_225353_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.6	2.0e-22
WP_010937491.1|225349_226051_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010937492.1|226415_227339_-	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_010937493.1|227506_229276_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_010937496.1|230020_230800_+	DUF169 domain-containing protein	NA	NA	NA	NA	NA
WP_014524198.1|231221_232349_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_010937499.1|233751_235437_+	primase	NA	K4I341	Streptomyces_virus	30.7	4.2e-41
WP_010937501.1|235703_237263_+	primase	NA	NA	NA	NA	NA
WP_010937502.1|237389_238748_+	DNA modification methylase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	40.8	3.9e-82
WP_010937503.1|238740_239472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164928111.1|239431_241447_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V301	Faecalibacterium_phage	32.9	2.9e-65
WP_010937505.1|241443_241662_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164928140.1|242310_242586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937507.1|242589_244290_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	27.3	1.5e-33
WP_010937508.1|244273_245593_+	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	32.8	3.0e-26
WP_010937509.1|245602_245986_+|head	head decoration protein	head	NA	NA	NA	NA
WP_010937510.1|245997_247002_+|capsid	major capsid protein	capsid	G8GWE7	Rhodobacter_phage	42.6	1.5e-06
WP_010937511.1|247010_247331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937512.1|247333_247822_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_164928113.1|247821_248391_+	hypothetical protein	NA	K4PXD6	Edwardsiella_phage	33.7	1.3e-10
WP_010937514.1|248408_248819_+	lipoprotein	NA	NA	NA	NA	NA
WP_010937515.1|248811_248979_+	peptidase M16	NA	NA	NA	NA	NA
WP_010937516.1|248981_249575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937517.1|249571_249898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937518.1|249894_250452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937519.1|250435_250627_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_010937520.1|250630_252094_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	43.7	7.2e-106
WP_010937521.1|252143_252509_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_010937522.1|252508_252769_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_010937523.1|252968_254459_+	hypothetical protein	NA	R9U4C6	Rhizobium_phage	47.7	4.8e-73
WP_010937524.1|254467_255667_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	29.1	2.4e-27
WP_010937525.1|255789_256923_+|tail	tail protein	tail	B5TK72	Pseudomonas_phage	34.8	2.1e-52
WP_010937526.1|256924_257563_+|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	47.0	7.1e-26
WP_010937527.1|257564_258041_+	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	53.2	3.8e-24
WP_010937528.1|258049_259111_+|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	42.6	9.6e-68
WP_010937529.1|259119_259746_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	45.1	3.7e-35
WP_010937531.1|260764_261208_+|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_010937532.1|261219_261549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937533.1|261648_261831_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_010937534.1|261874_262270_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	31.2	5.8e-10
WP_164928115.1|262360_262606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164928116.1|262656_263637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937537.1|263798_264329_-	YfbU family protein	NA	NA	NA	NA	NA
WP_164928117.1|264413_265106_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164928118.1|265192_265480_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_164928119.1|265592_265769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937540.1|265801_266266_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_164928120.1|266560_266812_+	hypothetical protein	NA	NA	NA	NA	NA
266720:266736	attL	GACCTCAAGCGCCTCGC	NA	NA	NA	NA
WP_164928121.1|266954_267194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937544.1|267981_268305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010937545.1|268307_268871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164928122.1|268860_269286_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010937546.1|269282_270425_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	29.9	7.0e-08
WP_010937547.1|270665_271940_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.4	5.9e-96
279707:279723	attR	GCGAGGCGCTTGAGGTC	NA	NA	NA	NA
>prophage 2
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	1182377	1214345	3570858	tail,plate,tRNA	Bacillus_phage(20.0%)	28	NA	NA
WP_010938378.1|1182377_1183751_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_014524310.1|1183925_1184612_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010938380.1|1184608_1186228_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_014524311.1|1186347_1186953_+	3'-5' exonuclease domain-containing protein 2	NA	NA	NA	NA	NA
WP_010938382.1|1187126_1187816_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	5.5e-40
WP_010938383.1|1187843_1188611_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	7.5e-14
WP_010938384.1|1188619_1189285_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_010938385.1|1189442_1190192_+	GAK system XXXCH domain-containing protein	NA	NA	NA	NA	NA
WP_010938388.1|1191778_1194418_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.2	3.2e-80
WP_010938389.1|1194496_1195570_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.6	2.1e-107
WP_010938390.1|1195858_1196965_+	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_010938391.1|1197182_1198544_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_010938392.1|1198733_1199264_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010938393.1|1199396_1200779_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_010938394.1|1200782_1201973_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_010938395.1|1202024_1202927_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_014524313.1|1203074_1203818_+	UPF0280 family protein	NA	NA	NA	NA	NA
WP_010938397.1|1204237_1204981_-	DNA methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	48.9	4.8e-58
WP_014524314.1|1204958_1205153_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	65.1	2.4e-09
WP_010938398.1|1205410_1205857_-|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_010938399.1|1205870_1207388_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	31.1	4.2e-16
WP_010938400.1|1207389_1208046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524316.1|1208200_1209382_-|plate	baseplate J/gp47 family protein	plate	H7BVM7	unidentified_phage	34.3	4.5e-26
WP_010938402.1|1209359_1209794_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_010938403.1|1209790_1210522_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_010938404.1|1210508_1211309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938405.1|1211454_1212006_-	hypothetical protein	NA	A0A1B1IUE1	uncultured_Mediterranean_phage	27.9	3.2e-06
WP_010938406.1|1212002_1214345_-|tail	phage tail tape measure protein	tail	A2I2Y1	Vibrio_virus	52.0	8.9e-74
>prophage 3
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	1220431	1245391	3570858	head,holin,capsid,transposase	Pseudomonas_phage(28.57%)	34	NA	NA
WP_010938415.1|1220431_1221427_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_010938416.1|1221435_1221783_-|head	head decoration protein	head	NA	NA	NA	NA
WP_010938417.1|1221798_1222749_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	41.2	7.9e-21
WP_010938418.1|1222938_1224240_-|capsid	minor capsid protein	capsid	A0A2K9VGX3	Faecalibacterium_phage	41.6	3.1e-36
WP_010938419.1|1224239_1225832_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	28.1	2.3e-25
WP_010938420.1|1225916_1226537_-	OB-fold putative lipoprotein	NA	NA	NA	NA	NA
WP_010938421.1|1226596_1228081_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	51.2	6.8e-128
WP_014524317.1|1228131_1228728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938423.1|1228739_1228982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938424.1|1228978_1229452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938425.1|1229448_1229754_-	lipoprotein	NA	NA	NA	NA	NA
WP_010938426.1|1229707_1230121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938427.1|1230113_1230779_-	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	56.9	7.9e-60
WP_010938428.1|1230778_1231147_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	46.4	1.4e-18
WP_010938429.1|1231220_1231685_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010938430.1|1231668_1232034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524318.1|1232030_1232507_-	regulatory protein GemA	NA	A0A2H4J581	uncultured_Caudovirales_phage	30.0	1.4e-05
WP_010938432.1|1232503_1232962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938433.1|1233043_1233331_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_010938434.1|1233344_1233584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938435.1|1233601_1234114_-	host-nuclease inhibitor Gam family protein	NA	B7SDX6	Pseudomonas_virus	27.6	7.3e-05
WP_010938436.1|1234115_1234304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938437.1|1234306_1234939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938438.1|1234931_1235669_-	ATP-binding protein	NA	A0A2H4J809	uncultured_Caudovirales_phage	25.7	3.8e-07
WP_010938439.1|1235665_1237819_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A125RN39	Pseudomonas_phage	24.9	4.0e-20
WP_014524319.1|1238042_1238531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938441.1|1238530_1238800_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010938442.1|1238796_1239222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938443.1|1239483_1240251_+	helix-turn-helix domain-containing protein	NA	A7Y8H7	Pseudomonas_virus	32.5	6.6e-18
WP_010938445.1|1241836_1243216_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	35.8	4.2e-55
WP_010938446.1|1243217_1244264_+	hypothetical protein	NA	A0A125RNN9	Pseudomonas_phage	28.2	1.3e-16
WP_081448120.1|1244291_1244519_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	55.6	4.3e-10
WP_081448121.1|1244857_1245076_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081448122.1|1245157_1245391_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	1281919	1298107	3570858	tRNA	Staphylococcus_phage(36.36%)	16	NA	NA
WP_010938487.1|1281919_1284490_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	5.9e-172
WP_010938488.1|1284486_1284789_-	acylphosphatase	NA	NA	NA	NA	NA
WP_010938489.1|1284797_1285475_-	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	32.4	2.4e-24
WP_014524331.1|1285510_1286500_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_010938491.1|1286582_1287101_-	lipoprotein	NA	NA	NA	NA	NA
WP_010938492.1|1287084_1289574_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.1	7.4e-204
WP_010938493.1|1289616_1290078_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_010938494.1|1290081_1290552_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	54.4	4.4e-33
WP_010938495.1|1290683_1291913_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.0	5.9e-93
WP_010938496.1|1291944_1292607_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.6	4.2e-29
WP_010938497.1|1292612_1293746_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.8	9.4e-37
WP_010938498.1|1293748_1294279_-	cytidine/deoxycytidylate deaminase family protein	NA	S5YN57	Mycobacterium_phage	37.8	7.2e-24
WP_010938499.1|1294344_1295583_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	55.3	3.9e-97
WP_010938500.1|1295641_1296889_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_010938501.1|1297076_1297307_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.2	5.9e-07
WP_010938502.1|1297363_1298107_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	A0A0M4JSW6	Mollivirus	32.5	5.1e-07
>prophage 5
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	1530261	1601785	3570858	capsid,portal,integrase,terminase,tail,protease,head,tRNA	Burkholderia_phage(15.38%)	76	1556471:1556487	1596076:1596092
WP_010938745.1|1530261_1530750_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011792381.1|1530754_1532476_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.6	7.5e-38
WP_010938747.1|1532606_1533794_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010938748.1|1534208_1534952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938749.1|1534992_1536003_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_010938750.1|1536246_1537176_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	28.5	2.2e-20
WP_010938751.1|1537476_1538223_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_010938752.1|1538485_1539658_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_010938753.1|1539693_1540029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938754.1|1540046_1541369_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_011792376.1|1541370_1542201_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_010938756.1|1542187_1542865_-	bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
WP_010938757.1|1542987_1544223_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_010938758.1|1544266_1545595_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010938759.1|1545701_1546628_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_010938760.1|1546643_1547969_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.4	1.8e-39
WP_010938761.1|1548080_1549529_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.4	2.0e-20
WP_010938762.1|1549689_1551153_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_010938763.1|1551306_1551591_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_010938764.1|1551663_1552092_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011792370.1|1552106_1554554_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014524440.1|1554875_1555124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938768.1|1555563_1556241_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
1556471:1556487	attL	GTATGGCGGAGAGGGTG	NA	NA	NA	NA
WP_164928126.1|1557265_1557733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938771.1|1557758_1558655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938772.1|1558663_1559671_+	DUF1848 domain-containing protein	NA	NA	NA	NA	NA
WP_010938773.1|1559711_1560071_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_014524437.1|1560129_1560630_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	34.9	9.3e-05
WP_010938776.1|1561262_1561772_-|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_010938777.1|1561764_1562103_-	hypothetical protein	NA	Q58MX5	Prochlorococcus_phage	43.5	2.4e-17
WP_014524436.1|1562105_1562738_-	hypothetical protein	NA	Q5DN32	Alphaproteobacteria_virus	28.0	1.1e-07
WP_164928127.1|1562737_1565485_-|tail	phage tail protein	tail	A0A2H4P6Z2	Pseudomonas_phage	27.9	1.8e-41
WP_010938781.1|1565889_1566795_-|tail	tail protein	tail	NA	NA	NA	NA
WP_010938783.1|1567151_1569950_-	tape measure protein	NA	A5A3Q5	Burkholderia_phage	25.1	4.1e-33
WP_010938784.1|1570122_1570305_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_010940652.1|1570353_1570758_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	49.3	1.7e-09
WP_010938785.1|1571177_1571561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938786.1|1571569_1572733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524433.1|1572744_1573131_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_010938788.1|1573133_1573631_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_010938789.1|1573623_1573950_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	45.0	9.9e-16
WP_010938790.1|1573949_1574507_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_010938791.1|1574510_1574780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938792.1|1574825_1576022_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	39.3	9.5e-64
WP_010938793.1|1576226_1576961_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	58.3	1.4e-57
WP_010938794.1|1576953_1578213_-|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	34.0	1.3e-55
WP_010938795.1|1578212_1579910_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	52.3	1.4e-161
WP_010938796.1|1579914_1580382_-|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	38.7	1.6e-19
WP_010938797.1|1580465_1580864_-	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	49.6	5.4e-24
WP_010938798.1|1580883_1581132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938799.1|1581128_1581479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938800.1|1581478_1581886_-	hypothetical protein	NA	A0A0M4TU77	Ralstonia_phage	50.7	1.0e-33
WP_010938801.1|1582049_1582439_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_010938802.1|1582431_1582995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938804.1|1583336_1583597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938805.1|1583583_1584078_-	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	57.8	2.6e-28
WP_014524431.1|1584074_1584482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041722649.1|1585242_1585428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938807.1|1585460_1586924_-	DNA cytosine methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	40.0	1.2e-73
WP_014524429.1|1587126_1587483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938809.1|1587482_1587896_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_081448130.1|1588106_1588418_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164928128.1|1588495_1589107_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHY1	Moraxella_phage	25.8	1.5e-12
WP_010938812.1|1589164_1590151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014524426.1|1590848_1591145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938815.1|1591190_1592219_+	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	29.3	3.7e-16
WP_010938816.1|1592221_1593118_+	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_010938817.1|1593137_1594130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010938818.1|1594493_1594712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010938819.1|1594708_1595902_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	47.1	6.5e-97
WP_010938820.1|1596515_1597001_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	36.5	9.0e-05
1596076:1596092	attR	GTATGGCGGAGAGGGTG	NA	NA	NA	NA
WP_010938821.1|1597221_1597878_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	32.5	9.0e-16
WP_010938822.1|1598014_1599625_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010938823.1|1599750_1600323_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_010938824.1|1600298_1600859_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.6	8.4e-31
WP_010938825.1|1600855_1601785_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 6
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	1851001	1861875	3570858		Vibrio_phage(16.67%)	10	NA	NA
WP_010939076.1|1851001_1852774_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.3	7.3e-36
WP_010939077.1|1852766_1854485_-	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	29.1	5.2e-39
WP_010939078.1|1854517_1856833_-	Smr/MutS family protein	NA	Q94M10	Lactobacillus_phage	45.9	6.2e-11
WP_010939079.1|1856839_1857289_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	42.2	6.8e-23
WP_010939080.1|1857404_1857608_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010939082.1|1857724_1857928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939083.1|1857938_1858211_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	55.1	5.2e-18
WP_164562208.1|1858412_1859264_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010939086.1|1859304_1859820_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_010939087.1|1859826_1861875_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	3.0e-57
>prophage 7
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	2083334	2112676	3570858	protease,integrase,transposase	Burkholderia_phage(20.0%)	21	2072526:2072542	2103487:2103503
2072526:2072542	attL	CCCTGCGCCAGTTCGAA	NA	NA	NA	NA
WP_164928133.1|2083334_2084039_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	30.1	3.3e-16
WP_010937781.1|2086356_2087406_+|transposase	IS481-like element ISDvu4 family transposase	transposase	A0A077SLK2	Escherichia_phage	43.5	5.0e-77
WP_010939290.1|2087711_2087867_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010939293.1|2088754_2089138_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_150103618.1|2089118_2090230_-|transposase	IS3-like element ISD1 family transposase	transposase	NA	NA	NA	NA
WP_010939296.1|2090667_2092329_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_010939297.1|2092403_2093579_-	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_081448124.1|2093575_2093824_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_010939299.1|2093763_2094645_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	2.0e-10
WP_010939300.1|2094688_2095930_-|transposase	ISL3-like element ISDvu5 family transposase	transposase	NA	NA	NA	NA
WP_014524354.1|2095970_2096186_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010939301.1|2096175_2098245_-|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_010939302.1|2098259_2100758_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_010939303.1|2100754_2101222_-	GxxExxY protein	NA	NA	NA	NA	NA
WP_010939304.1|2101221_2104698_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	25.2	7.6e-05
2103487:2103503	attR	TTCGAACTGGCGCAGGG	NA	NA	NA	NA
WP_010939305.1|2104702_2105242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939306.1|2105238_2106303_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014524353.1|2106299_2109848_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_010939308.1|2109862_2110453_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_014524351.1|2110473_2111085_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_150103616.1|2111439_2112676_+|transposase	IS3-like element ISDvu2 family transposase	transposase	Q9ZXG3	Shigella_phage	48.0	2.0e-64
>prophage 8
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	2252214	2269777	3570858	holin,capsid,portal,tail,head	Rhodovulum_phage(25.0%)	20	NA	NA
WP_010939430.1|2252214_2256255_-|tail	tail fiber protein	tail	A0A1B1P733	Rhodovulum_phage	35.0	3.3e-60
WP_010939431.1|2256244_2256670_-	C40 family peptidase	NA	A0A1B0T6D9	Thiobacimonas_phage	45.0	5.8e-24
WP_014524470.1|2256669_2257179_-	DUF1833 family protein	NA	M4ST87	Rhodobacter_phage	29.7	2.7e-12
WP_010939433.1|2257175_2257541_-	hypothetical protein	NA	A0A1B1P748	Rhodovulum_phage	36.6	1.0e-05
WP_010939434.1|2257540_2260462_-|tail	tail protein	tail	G9BW49	Planktothrix_phage	24.3	2.5e-17
WP_041722685.1|2260464_2260677_-	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_010939435.1|2260760_2261111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939436.1|2261119_2262064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939437.1|2262081_2262549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939438.1|2262545_2263256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524471.1|2263255_2263606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939440.1|2263605_2263770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939441.1|2263762_2264173_-	lipoprotein	NA	NA	NA	NA	NA
WP_014524473.1|2264315_2264831_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_014524474.1|2264838_2265294_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010939444.1|2265366_2265576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939445.1|2265578_2266604_-|capsid	major capsid protein	capsid	A0A248XCX5	Klebsiella_phage	23.4	2.5e-12
WP_010939446.1|2266614_2266983_-|head	head decoration protein	head	NA	NA	NA	NA
WP_010939447.1|2266986_2268207_-	S49 family peptidase	NA	A0A2I7QY56	Vibrio_phage	28.6	3.1e-09
WP_010939448.1|2268223_2269777_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	29.3	3.4e-37
>prophage 9
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	2801324	2834336	3570858	capsid,terminase,transposase,tail,protease,head,plate	uncultured_Caudovirales_phage(23.08%)	45	NA	NA
WP_014524552.1|2801324_2803520_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	Q38013	Pseudomonas_phage	38.0	6.8e-100
WP_010939958.1|2803528_2804314_+	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	25.0	2.3e-10
WP_010939959.1|2804316_2804904_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014524553.1|2804896_2805226_+	helix-turn-helix domain-containing protein	NA	G8GWC3	Rhodobacter_phage	39.5	1.1e-14
WP_014524554.1|2805228_2805711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939961.1|2805720_2805957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939962.1|2806042_2806282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939963.1|2806363_2806798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939964.1|2806806_2807223_+	regulatory protein GemA	NA	A0A2H4J581	uncultured_Caudovirales_phage	49.6	9.3e-27
WP_164928143.1|2807249_2807708_+	DNA transposition protein	NA	A0A0M3VI83	Ralstonia_phage	42.3	2.0e-14
WP_010939966.1|2807720_2808059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939967.1|2808171_2808534_+	lipoprotein	NA	Q6QIC8	Burkholderia_phage	46.4	8.1e-19
WP_010939968.1|2808533_2809181_+	transglycosylase SLT domain-containing protein	NA	A4JWP4	Burkholderia_virus	56.4	1.0e-59
WP_010939969.1|2809173_2809593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014524556.1|2809546_2809840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939971.1|2809843_2810125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939972.1|2810111_2810327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939973.1|2810328_2810847_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.3	1.5e-37
WP_010939974.1|2810843_2812520_+|terminase	phage terminase large subunit	terminase	A0SMN6	Pseudomonas_virus	60.3	3.5e-189
WP_010939975.1|2812506_2814225_+	DUF935 domain-containing protein	NA	A0A1C6ZDK1	Pseudomonas_phage	43.0	1.0e-106
WP_010939976.1|2814227_2815478_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	50.2	5.1e-68
WP_010939977.1|2815642_2816131_+	phage virion morphogenesis protein	NA	F8TVC6	EBPR_siphovirus	41.8	3.5e-17
WP_010940676.1|2816265_2816802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014524557.1|2816837_2818019_+|protease	phage protease	protease	A0A2D1GNS3	Pseudomonas_phage	42.5	4.7e-55
WP_010939979.1|2818019_2818949_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A1C6ZDN1	Pseudomonas_phage	55.8	2.8e-95
WP_010939980.1|2818960_2819290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939981.1|2819289_2819721_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_010939982.1|2819717_2820347_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_010939983.1|2820349_2820535_+	DUF2635 domain-containing protein	NA	B7SDP7	Haemophilus_phage	52.7	6.6e-09
WP_010939984.1|2820521_2821943_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4JFT7	uncultured_Caudovirales_phage	46.2	1.0e-96
WP_010939985.1|2822021_2822849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939987.1|2822984_2823359_+	hypothetical protein	NA	A0A2H4J9F8	uncultured_Caudovirales_phage	46.1	1.1e-23
WP_010939988.1|2823556_2823886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010939989.1|2824044_2825985_+|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	42.1	9.3e-69
WP_010939990.1|2826004_2827345_+	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.3	4.5e-38
WP_010939991.1|2827364_2828489_+|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	42.4	5.9e-76
WP_010939992.1|2828485_2829112_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	41.7	5.5e-31
WP_010939993.1|2829050_2829500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010939994.1|2829572_2829929_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	58.1	1.2e-27
WP_010939995.1|2829938_2831000_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.9	6.6e-69
WP_010939996.1|2830996_2831590_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_010939997.1|2831673_2832564_+|tail	tail protein	tail	Q9MCR6	Enterobacteria_phage	43.7	1.3e-14
WP_010939998.1|2832573_2833113_+|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_010939999.1|2833413_2833614_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	48.2	9.7e-06
WP_010940000.1|2833586_2834336_+	DNA methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	48.1	1.1e-54
>prophage 10
NC_002937	Desulfovibrio vulgaris str. Hildenborough, complete sequence	3570858	2936360	2981296	3570858	holin,capsid,portal,integrase,tail,head,plate,tRNA	Alteromonadaceae_phage(18.18%)	54	2936186:2936230	2977658:2977702
2936186:2936230	attL	TGGCGCGCCCGGGAGGATTCGAACCCCCGGCCAAGAGCTTAGAAG	NA	NA	NA	NA
WP_041722798.1|2936360_2937656_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1U9WS15	Gordonia_phage	25.4	1.9e-09
WP_010940095.1|2937657_2937900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940096.1|2937964_2938330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524576.1|2938414_2938627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940097.1|2938712_2938907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940098.1|2938893_2939355_-	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_010940099.1|2939512_2939842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010940100.1|2939831_2940170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940101.1|2940239_2940512_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014524577.1|2940629_2941055_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010940103.1|2941167_2942241_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	39.3	1.7e-56
WP_010940104.1|2942312_2943650_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.0	4.1e-23
WP_010940105.1|2943650_2944175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010940106.1|2944283_2944985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940107.1|2944984_2946184_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	44.5	1.2e-87
WP_010940108.1|2946323_2947400_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	50.8	3.2e-87
WP_010940109.1|2947408_2947819_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	60.3	1.6e-42
WP_010940110.1|2947835_2948699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010940111.1|2948706_2949135_+	HIT family protein	NA	D7NW73	Streptomyces_phage	51.5	2.1e-21
WP_010940113.1|2949440_2949770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940114.1|2949781_2950321_-|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_010940115.1|2950330_2951146_-|tail	tail protein	tail	A0A2P1A4E8	Alteromonadaceae_phage	59.0	5.2e-13
WP_010940116.1|2951138_2951765_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	45.1	2.2e-35
WP_010940117.1|2951773_2952835_-|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	42.3	6.2e-67
WP_010940118.1|2952843_2953320_-	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	52.3	1.1e-23
WP_010940119.1|2953321_2953960_-|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	46.6	7.1e-26
WP_010940120.1|2953961_2955095_-|tail	tail protein	tail	B5TK72	Pseudomonas_phage	34.8	2.7e-52
WP_010940121.1|2955217_2956417_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	28.6	3.8e-28
WP_010940122.1|2956425_2957916_-	hypothetical protein	NA	R9U4C6	Rhizobium_phage	49.7	4.6e-76
WP_150103629.1|2957996_2958104_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_010940123.1|2958115_2958376_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_010937521.1|2958375_2958741_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_010940124.1|2958790_2960254_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	42.5	3.0e-104
WP_010937519.1|2960257_2960449_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_010940125.1|2960432_2960990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937517.1|2960986_2961313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937516.1|2961309_2961903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937515.1|2961905_2962073_-	peptidase M16	NA	NA	NA	NA	NA
WP_010940127.1|2962065_2962476_-	lipoprotein	NA	NA	NA	NA	NA
WP_010940128.1|2962493_2963042_-	hypothetical protein	NA	K4PXD6	Edwardsiella_phage	33.7	1.2e-10
WP_010940129.1|2963062_2963551_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010940130.1|2963553_2963901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010937510.1|2963909_2964914_-|capsid	major capsid protein	capsid	G8GWE7	Rhodobacter_phage	42.6	1.5e-06
WP_010937509.1|2964925_2965309_-|head	head decoration protein	head	NA	NA	NA	NA
WP_010940131.1|2965318_2966638_-	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	32.5	1.1e-25
WP_010940132.1|2966621_2968322_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	27.5	2.2e-34
WP_010940133.1|2968325_2968601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940135.1|2969248_2969467_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010940137.1|2971441_2972164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010940138.1|2972156_2973515_-	DNA modification methylase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	40.7	2.3e-82
WP_010940139.1|2973641_2975198_-	primase	NA	NA	NA	NA	NA
WP_010940141.1|2975464_2977150_-	primase	NA	K4I341	Streptomyces_virus	30.7	4.2e-41
WP_010940142.1|2978218_2979715_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
2977658:2977702	attR	TGGCGCGCCCGGGAGGATTCGAACCCCCGGCCAAGAGCTTAGAAG	NA	NA	NA	NA
WP_010940143.1|2979886_2981296_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
