The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_002935	Corynebacterium diphtheriae NCTC 13129, complete genome	2488635	119739	190661	2488635	integrase,head,transposase,protease,portal,capsid,tail	Corynebacterium_phage(75.0%)	75	152059:152082	190948:190971
WP_173355285.1|119739_119988_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.7	5.2e-09
WP_010934055.1|120067_120265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934056.1|120486_120867_+	SdpI family protein	NA	NA	NA	NA	NA
WP_010934057.1|120866_120974_+	lipoprotein	NA	NA	NA	NA	NA
WP_014302727.1|121428_121722_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_010934059.1|121721_122546_+	VOC family protein	NA	NA	NA	NA	NA
WP_003850125.1|122551_122857_+	MGMT family protein	NA	NA	NA	NA	NA
WP_010934060.1|122866_123787_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_003850128.1|123926_124553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041627739.1|124560_126555_-	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	33.6	2.6e-74
WP_010934062.1|126598_127231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934063.1|127227_128148_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010934064.1|128137_129046_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010934065.1|129066_129504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934066.1|129729_133155_-	arabinosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_041627741.1|133147_135148_-	galactan 5-O-arabinofuranosyltransferase	NA	NA	NA	NA	NA
WP_010934068.1|135342_136104_-	decaprenylphospho-beta-D-erythro-pentofuranosid- 2-ulose 2-reductase	NA	NA	NA	NA	NA
WP_003850144.1|136123_137590_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010934069.1|137706_137955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934070.1|137983_138418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934071.1|138414_138963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934072.1|138974_139394_+	GtrA family protein	NA	NA	NA	NA	NA
WP_010934073.1|139603_140383_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_003850156.1|140516_141434_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010934074.1|141607_142573_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010934075.1|142672_143407_+	metal ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	26.3	1.8e-09
WP_010934076.1|143403_144303_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010934077.1|144299_145151_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_041627743.1|145235_146273_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003850169.1|146338_147118_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	3.9e-10
WP_014307805.1|147136_148042_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010934080.1|148132_149326_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010934081.1|149322_150270_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010934082.1|150626_151661_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.8	5.4e-15
152059:152082	attL	CTCGAACTCAAGAACACGAAAACC	NA	NA	NA	NA
WP_010934083.1|152425_154000_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_010934086.1|155599_156826_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	90.9	5.3e-219
WP_010934087.1|156925_157948_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010934088.1|157959_158523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934089.1|158617_159025_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1W6JRC2	Corynebacterium_phage	99.3	1.7e-73
WP_010934091.1|159638_159881_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JRC7	Corynebacterium_phage	98.7	1.6e-34
WP_041627747.1|159927_160395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628108.1|160478_160859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934094.1|160941_161760_+	phage antirepressor Ant	NA	A0A1W6JRI1	Corynebacterium_phage	89.4	1.5e-137
WP_003850203.1|161779_161980_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010934095.1|161976_162219_+	hypothetical protein	NA	A0A1W6JRC8	Corynebacterium_phage	59.0	1.9e-19
WP_010934096.1|162230_162455_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	44.4	6.4e-06
WP_010934097.1|162451_162598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129060495.1|162587_162875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934103.1|164150_165359_+	hypothetical protein	NA	A0A220NQT1	Corynebacterium_phage	66.0	2.4e-131
WP_010934104.1|165351_165966_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	85.1	1.4e-90
WP_003850222.1|166017_166335_+	HNH endonuclease	NA	A0A1W6JRD4	Corynebacterium_phage	100.0	1.4e-51
WP_003850225.1|166487_166832_+	hypothetical protein	NA	A0A1W6JRH9	Corynebacterium_phage	50.5	3.5e-19
WP_003850227.1|166821_168423_+	hypothetical protein	NA	A0A1W6JRF6	Corynebacterium_phage	77.2	3.6e-159
WP_010934105.1|168435_169686_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	93.0	2.5e-224
WP_003850232.1|169682_170726_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	91.7	3.4e-182
WP_010934106.1|170722_171973_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	88.9	5.8e-205
WP_010934107.1|171972_172173_+	hypothetical protein	NA	A0A1W6JRE2	Corynebacterium_phage	63.6	6.7e-15
WP_003850235.1|172194_172677_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	93.8	1.6e-83
WP_010934108.1|172673_173036_+	hypothetical protein	NA	A0A1W6JRD5	Corynebacterium_phage	93.3	3.6e-59
WP_003850237.1|173028_173295_+	hypothetical protein	NA	A0A1W6JRE6	Corynebacterium_phage	94.3	1.5e-38
WP_010934110.1|173284_173662_+	hypothetical protein	NA	A0A1W6JRI9	Corynebacterium_phage	88.0	1.1e-58
WP_010934111.1|173690_174638_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	83.8	4.3e-152
WP_010934112.1|174735_175113_+	hypothetical protein	NA	A0A1W6JRK1	Corynebacterium_phage	91.2	2.7e-57
WP_010934113.1|175274_175484_+	hypothetical protein	NA	A0A1W6JRF2	Corynebacterium_phage	88.4	9.1e-31
WP_010934114.1|175496_181139_+|tail	phage tail tape measure protein	tail	A0A1W6JRG1	Corynebacterium_phage	81.8	0.0e+00
WP_003850245.1|181148_181901_+	hypothetical protein	NA	A0A1W6JRF0	Corynebacterium_phage	88.0	1.0e-127
WP_010934115.1|181901_182762_+	hypothetical protein	NA	Q37921	Corynephage	99.7	5.2e-165
WP_010934116.1|182761_183877_+	hypothetical protein	NA	Q37922	Corynephage	88.1	1.6e-150
WP_010934117.1|183876_185304_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	48.8	1.7e-43
WP_010934118.1|185303_185978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628116.1|186721_187498_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1JY73	Gordonia_phage	54.1	9.8e-70
WP_010934120.1|187500_187824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934121.1|187829_188294_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	73.5	2.5e-57
WP_010934122.1|188290_188629_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	88.4	1.2e-48
WP_003850266.1|188978_190661_+	diphtheria toxin	NA	A7UH54	Corynephage	98.0	0.0e+00
190948:190971	attR	GGTTTTCGTGTTCTTGAGTTCGAG	NA	NA	NA	NA
>prophage 2
NC_002935	Corynebacterium diphtheriae NCTC 13129, complete genome	2488635	683944	738459	2488635	transposase,tRNA,protease	Bacillus_phage(40.0%)	47	NA	NA
WP_010934496.1|683944_684448_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_010934497.1|684493_685117_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.5	1.7e-08
WP_004567129.1|685113_685365_+	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_004567131.1|685369_685714_-	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_004567132.1|686051_686312_-	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	45.1	2.0e-11
WP_010934499.1|686944_687406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934500.1|687399_688662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934501.1|688658_689969_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.0	1.7e-42
WP_004567139.1|690226_690454_+	DUF3107 domain-containing protein	NA	NA	NA	NA	NA
WP_010934503.1|690456_691335_+	DUF3152 domain-containing protein	NA	NA	NA	NA	NA
WP_010934504.1|691358_692216_+	TIGR02569 family protein	NA	NA	NA	NA	NA
WP_010934505.1|692219_695402_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_010934506.1|695395_698626_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	22.9	1.5e-18
WP_004567149.1|698670_699759_+	potassium channel protein	NA	NA	NA	NA	NA
WP_010934507.1|699790_700474_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_010934508.1|700466_702518_+	ATP-dependent DNA helicase UvrD2	NA	S5MMD7	Bacillus_phage	27.5	2.9e-44
WP_014303076.1|702462_703356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934510.1|703391_703913_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_010934511.1|703909_705301_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_010934512.1|705381_706434_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_041627816.1|706445_707144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934514.1|707194_707698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934515.1|707870_710834_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_010934516.1|711317_711887_-	sodium:glutamate symporter	NA	NA	NA	NA	NA
WP_010934518.1|712416_713427_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_010934519.1|713429_714386_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_010934520.1|714641_714809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934521.1|715064_716546_+	methylmalonyl-CoA carboxytransferase subunit 5S	NA	NA	NA	NA	NA
WP_010934522.1|716558_718115_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_003850577.1|718128_718392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003850583.1|718416_718785_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_014301560.1|718987_720079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934524.1|720097_720886_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_014308099.1|720942_721758_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_010934526.1|721937_723047_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010934527.1|723043_724642_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_003850596.1|724820_725510_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.7	1.2e-26
WP_010934528.1|725526_726429_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003850600.1|726535_727027_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	52.2	1.5e-36
WP_010934530.1|727617_728997_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	7.9e-38
WP_010934531.1|729106_732040_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_010934532.1|732027_734160_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.2	5.3e-33
WP_010934533.1|734159_735038_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	6.6e-30
WP_010934534.1|735037_735835_+	lantibiotic ABC transporter permease	NA	NA	NA	NA	NA
WP_010934535.1|736000_736267_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013170013.1|737301_737583_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_044026255.1|737655_738459_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_002935	Corynebacterium diphtheriae NCTC 13129, complete genome	2488635	1830347	1880855	2488635	integrase,protease,portal,terminase,tRNA	Gordonia_phage(27.78%)	50	1825226:1825241	1883876:1883891
1825226:1825241	attL	GCGACGAGGTCTTCGA	NA	NA	NA	NA
WP_003852470.1|1830347_1833056_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	37.4	7.2e-136
WP_010935335.1|1833150_1834131_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_010935336.1|1834613_1835366_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010935337.1|1835402_1836695_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.2	3.3e-131
WP_041627968.1|1836841_1839367_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	30.4	6.2e-65
WP_003852475.1|1839461_1840091_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.0	3.6e-38
WP_003852476.1|1840108_1840708_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.7	3.3e-41
WP_010935339.1|1840873_1842220_-	trigger factor	NA	NA	NA	NA	NA
WP_003852480.1|1843046_1843283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852481.1|1843429_1844212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852484.1|1844288_1844762_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_010935340.1|1844793_1845414_-	DsbA family protein	NA	NA	NA	NA	NA
WP_010935341.1|1845535_1848154_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	28.0	5.7e-45
WP_010935342.1|1848409_1849426_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010935343.1|1849437_1849830_+	globin	NA	NA	NA	NA	NA
WP_010935344.1|1849826_1850447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935345.1|1850456_1850900_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010935346.1|1851026_1852697_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.2	1.3e-47
WP_010935347.1|1852794_1853283_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_010935348.1|1853466_1855503_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_010935349.1|1855729_1858015_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_003852501.1|1858035_1858236_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_003852518.1|1859707_1860913_-	MFS transporter	NA	NA	NA	NA	NA
WP_014309480.1|1861317_1862349_+	oxidoreductase	NA	NA	NA	NA	NA
WP_010935351.1|1862408_1863209_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010935352.1|1863227_1863860_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	38.6	4.3e-23
WP_010935353.1|1864037_1864868_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014307201.1|1864868_1866122_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_100209167.1|1866364_1866631_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157761930.1|1866761_1866953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003852534.1|1866949_1867234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852535.1|1867226_1867556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126374930.1|1867527_1867722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935357.1|1868440_1868842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852539.1|1868834_1869113_+	HNH endonuclease	NA	G9FGW5	Rhodococcus_phage	61.8	3.4e-25
WP_041627971.1|1869233_1869554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035119248.1|1869615_1870953_+|terminase	terminase	terminase	A0A2P1CBZ2	Gordonia_phage	46.4	6.4e-101
WP_010935359.1|1871191_1872241_+|portal	phage portal protein	portal	G9FGU9	Rhodococcus_phage	45.3	2.5e-52
WP_003852546.1|1872224_1872776_+	C39 family peptidase	NA	A0A2H4P9D2	Corynebacterium_phage	71.8	1.0e-73
WP_003852548.1|1872966_1873203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852552.1|1873195_1874599_+	hypothetical protein	NA	G9FGV2	Rhodococcus_phage	42.7	2.2e-59
WP_003852555.1|1874598_1874910_+	hypothetical protein	NA	A0A2P1CBZ4	Gordonia_phage	44.7	5.2e-14
WP_003852557.1|1874906_1875281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852559.1|1875280_1875703_+	hypothetical protein	NA	A0A160DHJ4	Gordonia_phage	38.4	1.4e-17
WP_010935362.1|1875705_1876119_+	hypothetical protein	NA	A0A2P1CBZ9	Gordonia_phage	46.9	5.6e-24
WP_003852563.1|1876118_1876430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935363.1|1876507_1878073_+	hypothetical protein	NA	A0A222ZGY6	Arthrobacter_phage	46.3	1.5e-61
WP_003852566.1|1878066_1879254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935364.1|1879254_1880043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935365.1|1880039_1880855_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1CCU8	Gordonia_phage	46.5	1.2e-57
1883876:1883891	attR	GCGACGAGGTCTTCGA	NA	NA	NA	NA
>prophage 4
NC_002935	Corynebacterium diphtheriae NCTC 13129, complete genome	2488635	1998092	2038799	2488635	transposase,tRNA,protease	Escherichia_phage(22.22%)	40	NA	NA
WP_041627987.1|1998092_1998857_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	5.6e-86
WP_007929940.1|1999594_2000446_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2000573_2001074_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041627987.1|2001580_2002345_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	5.6e-86
WP_010935457.1|2002456_2004193_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_010935458.1|2004305_2005757_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_088245739.1|2006197_2007495_-|transposase	IS3-like element ISCod1 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.9	6.5e-58
WP_010935461.1|2007630_2007888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935462.1|2008027_2008507_+	hypothetical protein	NA	A0A1L6BZI7	Pasteurella_phage	45.8	2.2e-24
WP_010935463.1|2008562_2008877_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8D5N3	Corynebacterium_phage	52.5	2.5e-16
WP_010935464.1|2009015_2009465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935465.1|2009461_2009800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133060854.1|2009895_2010342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041627995.1|2010402_2011782_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	4.6e-38
WP_010935468.1|2012163_2013708_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003852836.1|2013768_2014113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021336039.1|2014112_2015561_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_014310795.1|2015588_2016071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935471.1|2016060_2016819_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_014302329.1|2016781_2017909_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010935472.1|2017930_2018872_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_010935473.1|2018899_2020291_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.8	3.7e-43
WP_010935474.1|2020309_2020792_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_003852854.1|2020784_2021519_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003852856.1|2021528_2022110_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_041627997.1|2022365_2022947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935476.1|2023050_2024442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935477.1|2024798_2026190_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003852863.1|2026217_2026934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003852865.1|2027003_2027633_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_010935478.1|2027763_2028651_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_080624866.1|2028647_2029925_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003852870.1|2030031_2030202_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_041627999.1|2030232_2032869_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.5	2.5e-133
WP_003852875.1|2033316_2033772_-	DIP1984 family protein	NA	NA	NA	NA	NA
WP_010935481.1|2033807_2034446_+	Pr6Pr family membrane protein	NA	NA	NA	NA	NA
WP_041628193.1|2034552_2035347_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014309555.1|2035362_2035536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935483.1|2035872_2037435_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.3	2.9e-73
WP_010935484.1|2037818_2038799_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_002935	Corynebacterium diphtheriae NCTC 13129, complete genome	2488635	2286981	2338221	2488635	integrase,transposase,protease,holin,tRNA	Vibrio_phage(20.0%)	45	2315345:2315359	2325291:2325305
WP_010935656.1|2286981_2289207_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	5.6e-17
WP_041628057.1|2289478_2291272_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	28.1	1.6e-54
WP_041628058.1|2291457_2292621_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	46.1	1.7e-94
WP_041628060.1|2292659_2292866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935659.1|2292834_2293263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935660.1|2293315_2294341_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010935661.1|2294402_2294678_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_010935662.1|2295147_2296968_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A159B6I5	Gordonia_phage	34.8	8.9e-05
WP_010935663.1|2297076_2297805_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_010935664.1|2297797_2298856_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_010935665.1|2298911_2299496_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_010935666.1|2299488_2301045_-	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_010935667.1|2301410_2302097_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_010935668.1|2302096_2304727_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_010935669.1|2304728_2305688_+	type I-E CRISPR-associated endonuclease Cas1	NA	A0A2D0YZM7	Vibrio_phage	28.0	1.1e-09
WP_010935670.1|2305688_2306003_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_014302524.1|2307663_2307834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935671.1|2307892_2308408_+	single-stranded DNA-binding protein	NA	A0A0U4B2E8	Arthrobacter_phage	65.9	4.4e-42
WP_010935673.1|2309126_2309804_+	hypothetical protein	NA	G1BSM8	Mycobacterium_virus	32.6	1.3e-09
WP_010935675.1|2310209_2310485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014302528.1|2310640_2310790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935677.1|2310947_2311757_-	SpaH fimbrial minor subunit SpaI	NA	NA	NA	NA	NA
WP_010935678.1|2311829_2312876_-	SpaH fimbrial biogenesis class C sortase SrtE	NA	NA	NA	NA	NA
WP_010935679.1|2312859_2313816_-	SpaH fimbrial biogenesis class C sortase SrtD	NA	NA	NA	NA	NA
WP_010935680.1|2314005_2315673_-	SpaH fimbrial major subunit SpaH	NA	NA	NA	NA	NA
2315345:2315359	attL	CAGCCCTCCTGCTTC	NA	NA	NA	NA
WP_010935681.1|2315776_2319904_-	SpaH fimbrial tip protein SpaG	NA	NA	NA	NA	NA
WP_010935682.1|2320037_2320220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628064.1|2320564_2320729_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157891399.1|2320767_2321031_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B3AZE5	Gordonia_phage	59.1	2.3e-07
WP_004567371.1|2321159_2321318_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010935684.1|2322595_2322967_+	SdpI family protein	NA	NA	NA	NA	NA
WP_010935685.1|2323065_2324586_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_010935686.1|2324604_2325345_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.3	2.0e-16
2325291:2325305	attR	GAAGCAGGAGGGCTG	NA	NA	NA	NA
WP_041628066.1|2325344_2327069_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_010935688.1|2327265_2329098_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010935689.1|2329110_2329938_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_010935690.1|2329967_2331227_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	31.6	4.5e-56
WP_042382035.1|2331324_2332098_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041628069.1|2332099_2333101_+	septum formation family protein	NA	NA	NA	NA	NA
WP_010935693.1|2333107_2333455_+	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_010935694.1|2333529_2334777_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041628071.1|2334762_2335389_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010935696.1|2335433_2336336_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_041628073.1|2336371_2337508_+	amidase	NA	NA	NA	NA	NA
WP_010935698.1|2337504_2338221_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
