The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	10250	44489	5688987	tRNA,tail,plate	Salmonella_phage(33.33%)	39	NA	NA
WP_011144421.1|10250_10472_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.4	1.1e-18
WP_011144422.1|10548_11634_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	60.2	1.8e-117
WP_011144423.1|11630_12095_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.9	2.6e-46
WP_011144424.1|12097_14536_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	32.3	2.8e-86
WP_071824073.1|14516_14639_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	5.7e-09
WP_011144426.1|14650_14968_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	52.7	2.0e-21
WP_011144427.1|14994_15510_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	64.0	1.3e-57
WP_011144428.1|15520_16693_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	75.3	7.4e-170
WP_011144431.1|17677_18208_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	44.6	2.6e-34
WP_071824074.1|18287_18380_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_109791221.1|18437_19037_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	45.2	1.1e-41
WP_011144433.1|19033_19522_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	46.1	5.8e-28
WP_011144434.1|19521_20649_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	53.6	3.1e-93
WP_011144435.1|20645_21260_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	64.8	8.8e-74
WP_011144436.1|21252_22251_-|plate	baseplate J/gp47 family protein	plate	A0A0F7LCJ3	Escherichia_phage	56.4	3.1e-84
WP_011144437.1|22255_22597_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	59.1	1.6e-29
WP_011144438.1|22596_23439_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	39.5	1.8e-40
WP_011144439.1|23935_24139_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	70.1	2.0e-22
WP_164488458.1|24421_24586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144441.1|24982_25597_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.3e-44
WP_011144442.1|25879_26452_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	67.9	2.0e-67
WP_011144445.1|27551_27893_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	62.1	6.5e-10
WP_041379846.1|28311_28944_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	41.9	1.2e-30
WP_049789712.1|28943_29987_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	44.3	9.9e-25
WP_011144448.1|30413_30554_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_011144449.1|30573_30828_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011144450.1|30976_32806_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.6	1.8e-130
WP_011144451.1|32913_34287_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.8	2.1e-35
WP_011144452.1|34415_34838_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_011144453.1|34859_36242_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_011144454.1|36276_37140_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_011144455.1|37198_38740_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_011144456.1|38754_39288_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_011144457.1|39300_39771_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000429386.1|39829_40069_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_011144458.1|40122_40947_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_011144459.1|40977_41355_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_011144460.1|41965_42586_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_011144461.1|42599_44489_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 2
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	310051	355888	5688987	tRNA,transposase	Planktothrix_phage(40.0%)	37	NA	NA
WP_011144691.1|310051_310966_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011144692.1|310975_313045_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011144693.1|313662_314886_-	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
WP_011144694.1|314971_315676_-|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_041379872.1|316142_316448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144696.1|316426_317347_+	EamA family transporter	NA	NA	NA	NA	NA
WP_011144697.1|317949_319557_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011144698.1|319675_320695_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_011144699.1|320705_321605_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_011144700.1|321617_322598_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	4.3e-14
WP_011144701.1|322594_323614_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	8.5e-21
WP_041379873.1|323976_324684_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_011144703.1|324862_326353_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011144704.1|326396_326603_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_011144705.1|326658_327651_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_011144706.1|327801_327993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041379874.1|328178_329210_-|transposase	IS630-like element ISPlu8 family transposase	transposase	NA	NA	NA	NA
WP_011144708.1|329631_331026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144709.1|331173_331629_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.8	6.2e-16
WP_011144710.1|333296_333845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144711.1|334183_338626_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_011144712.1|338691_340359_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_109791279.1|341027_341621_-	inclusion body family protein	NA	NA	NA	NA	NA
WP_011144714.1|341867_343484_-|transposase	IS1634-like element ISPlu4 family transposase	transposase	NA	NA	NA	NA
WP_011144715.1|343905_344634_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011144717.1|345586_345784_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	51.9	1.9e-09
WP_173362504.1|346271_346415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041379878.1|347037_347421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|347482_348508_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011144721.1|349026_349419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303148.1|349428_349590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144722.1|349657_350542_-|transposase	IS982-like element ISPlu11 family transposase	transposase	NA	NA	NA	NA
WP_011144723.1|350699_351194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165828650.1|351311_351500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144724.1|352180_352888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789814.1|353193_353670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144727.1|354505_355888_-|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
>prophage 3
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	367329	431253	5688987	plate,transposase	Burkholderia_phage(10.0%)	52	NA	NA
WP_011144720.1|367329_368355_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011144738.1|368553_369261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058588885.1|369567_369969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144740.1|370265_370646_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_011144742.1|370936_371134_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	50.0	1.6e-08
WP_011144743.1|371237_371789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144744.1|372356_372677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144746.1|377113_377533_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_011144747.1|377580_379476_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.6e-27
WP_011144727.1|380264_381647_+|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
WP_011144748.1|382430_385976_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011144749.1|385972_387406_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011144750.1|387411_388059_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_011144751.1|388055_388856_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011144752.1|388852_391498_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	1.9e-93
WP_011144753.1|391508_392279_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011144754.1|392278_393631_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011144755.1|393633_394200_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011144756.1|394199_395486_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_041379883.1|395491_396544_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011144758.1|396507_398355_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011144759.1|398356_398797_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011144760.1|398803_400282_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011144761.1|400305_400803_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011144762.1|401703_402222_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011144763.1|402860_403703_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_011144764.1|403798_405169_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_011144765.1|405434_406523_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_011144766.1|406519_408172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144767.1|408252_408771_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_041379884.1|408767_409358_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_011144769.1|409575_410568_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011144770.1|410588_411212_+	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_041379885.1|411367_412531_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_011144772.1|412509_415137_-	histidinol-phosphatase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.3	6.3e-20
WP_011144773.1|415164_415404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144774.1|415529_416543_+|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011144775.1|417017_419807_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.6	1.1e-70
WP_049789721.1|419898_420138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789722.1|420148_420367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144776.1|420745_422038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144777.1|422510_423143_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011144778.1|423450_424020_+	peptidylprolyl isomerase A	NA	A0A1V0SCU1	Indivirus	34.3	2.9e-10
WP_011144779.1|424119_424470_-	YcgJ family protein	NA	NA	NA	NA	NA
WP_011144780.1|424718_425294_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	6.8e-68
WP_011144781.1|425417_426629_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	3.6e-34
WP_010848517.1|426678_427311_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011144782.1|427631_428039_+	OsmC family protein	NA	NA	NA	NA	NA
WP_011144783.1|428164_429034_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_011144784.1|429052_429271_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	41.8	1.1e-07
WP_011144785.1|429270_430248_-	hydrolase	NA	NA	NA	NA	NA
WP_011144786.1|430368_431253_+|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	1054824	1065802	5688987		Sodalis_phage(80.0%)	11	NA	NA
WP_011145280.1|1054824_1056006_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	39.9	7.5e-37
WP_011145281.1|1056028_1057222_+	MFS transporter	NA	NA	NA	NA	NA
WP_125026268.1|1057784_1057994_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	63.8	8.0e-19
WP_011145283.1|1058314_1059037_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	32.6	2.2e-15
WP_011145284.1|1059197_1059920_-	PAS domain-containing protein	NA	Q2A088	Sodalis_phage	35.3	2.0e-16
WP_011145285.1|1060241_1060964_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	30.5	4.9e-15
WP_011145286.1|1061264_1061987_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	32.6	9.9e-16
WP_011145287.1|1062304_1063027_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	30.3	2.4e-17
WP_011145288.1|1063312_1064035_-	PAS domain-containing protein	NA	Q2A088	Sodalis_phage	31.9	3.2e-14
WP_011145289.1|1064196_1064919_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	33.3	2.2e-15
WP_011145290.1|1065079_1065802_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	28.8	1.7e-15
>prophage 5
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	1203814	1240735	5688987	integrase,transposase	Shigella_phage(33.33%)	37	1202704:1202718	1239097:1239111
1202704:1202718	attL	CGGATGAGCCAGTCA	NA	NA	NA	NA
WP_011145380.1|1203814_1204003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157866895.1|1204060_1204360_+|transposase	transposase	transposase	Q716C1	Shigella_phage	75.5	7.7e-31
WP_049789744.1|1204374_1205214_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	68.5	3.9e-96
WP_011145383.1|1205149_1206061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041379950.1|1206170_1206359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791377.1|1206368_1207412_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_157866896.1|1207397_1207538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041379951.1|1208135_1209653_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_011145387.1|1209730_1210732_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011145388.1|1211266_1212151_+	ParA family protein	NA	NA	NA	NA	NA
WP_011145389.1|1212143_1213523_+	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	7.5e-113
WP_011145390.1|1213519_1215250_+	ParB family protein	NA	NA	NA	NA	NA
WP_011145391.1|1215242_1215494_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_011145392.1|1215557_1216148_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_041379952.1|1216144_1216408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791378.1|1216391_1217660_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011145394.1|1217928_1218627_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011145395.1|1218630_1220661_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.1	1.3e-36
WP_011145396.1|1221320_1221779_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_011145397.1|1221852_1222317_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	71.7	2.6e-46
WP_109791951.1|1222842_1223049_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011145399.1|1223041_1223710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145400.1|1223696_1224584_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011145401.1|1224596_1225490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145407.1|1227924_1228974_+	TcpQ domain-containing protein	NA	NA	NA	NA	NA
WP_011145408.1|1228980_1229418_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_173362519.1|1229502_1231140_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_011145410.1|1231163_1232480_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_049789746.1|1232466_1232952_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_011145412.1|1232965_1234519_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_011145413.1|1234511_1235597_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011145414.1|1235665_1236268_+	type IV prepilin	NA	NA	NA	NA	NA
WP_011145415.1|1236268_1236934_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_157866897.1|1236996_1238178_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_049789715.1|1238471_1238837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144475.1|1238830_1239166_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
1239097:1239111	attR	TGACTGGCTCATCCG	NA	NA	NA	NA
WP_011145417.1|1239229_1240735_+|transposase	IS66-like element ISPlu20 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	1.3e-89
>prophage 6
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	1492597	1503443	5688987		Mycobacterium_phage(25.0%)	12	NA	NA
WP_011145607.1|1492597_1493797_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.7	2.0e-29
WP_011145608.1|1494394_1495354_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.5	4.4e-128
WP_011145609.1|1495374_1497504_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	52.1	6.6e-209
WP_041380729.1|1497506_1497923_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.3	6.3e-15
WP_011145611.1|1497936_1498167_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	48.6	7.7e-15
WP_011145612.1|1498498_1498960_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_041379980.1|1499178_1499388_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	7.7e-22
WP_011145614.1|1499464_1499839_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.5	3.4e-20
WP_011145615.1|1499978_1500944_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_041379981.1|1501054_1501696_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011145617.1|1501827_1502091_-	YbeD family protein	NA	NA	NA	NA	NA
WP_041380730.1|1502231_1503443_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.7	4.5e-106
>prophage 7
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	1753138	1823873	5688987	transposase,tail,tRNA,protease	Enterobacteria_phage(11.76%)	59	NA	NA
WP_011145763.1|1753138_1754041_+|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	50.0	1.8e-35
WP_011145764.1|1754450_1754807_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_011145765.1|1754803_1755187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011145766.1|1755592_1756507_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	39.7	1.4e-35
WP_011145767.1|1756923_1757742_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	37.4	1.6e-30
WP_011145768.1|1757899_1758670_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_011145770.1|1759529_1760294_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	9.5e-17
WP_011145771.1|1761307_1762348_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_011145772.1|1762524_1763250_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.3	4.2e-22
WP_011145773.1|1763641_1764694_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.7	5.2e-82
WP_011145774.1|1764790_1765543_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011145775.1|1765702_1766530_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011145776.1|1766934_1768410_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	29.5	1.3e-14
WP_011145777.1|1768586_1769378_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_011145778.1|1769560_1769695_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_011145779.1|1770068_1770839_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041380749.1|1770981_1771674_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011145781.1|1771667_1772732_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	29.9	1.1e-18
WP_011145782.1|1772808_1773627_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_011145783.1|1773772_1774759_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011145784.1|1775311_1775986_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_011145785.1|1775978_1776644_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_011145786.1|1776855_1778127_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.2e-21
WP_011145787.1|1778221_1779259_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_011145788.1|1779258_1780410_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_011145789.1|1780393_1781161_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011145790.1|1781153_1781834_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_011145791.1|1782150_1783044_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	46.6	2.9e-65
WP_011145792.1|1783044_1783659_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J122	uncultured_Caudovirales_phage	49.0	2.0e-33
WP_011145793.1|1785332_1787342_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_041380006.1|1787991_1790106_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011145795.1|1790108_1791467_+	VRR-NUC domain-containing protein	NA	A4JX24	Burkholderia_virus	28.7	3.0e-05
WP_011145796.1|1791481_1792627_+	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_011145797.1|1792664_1793810_+	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_011145798.1|1793813_1794086_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011144854.1|1794506_1795520_+|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011145799.1|1796344_1797253_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.4	1.3e-25
WP_011145800.1|1797661_1798645_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011145801.1|1798684_1799164_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011145802.1|1799160_1799406_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_011145803.1|1799409_1799862_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_011145804.1|1800044_1800755_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_049789825.1|1801566_1802814_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011145806.1|1802921_1804076_+	MFS transporter	NA	NA	NA	NA	NA
WP_011145807.1|1804362_1805469_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011145808.1|1805481_1806642_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011145809.1|1806638_1808378_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	1.5e-22
WP_011145810.1|1808387_1809380_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_041380007.1|1809396_1810083_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_041380009.1|1810384_1811671_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	1.6e-56
WP_011145813.1|1811674_1812607_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_011145814.1|1812840_1813383_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_157852169.1|1813364_1814498_-	MFS transporter	NA	NA	NA	NA	NA
WP_011145816.1|1814536_1815595_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	28.8	3.0e-05
WP_041380011.1|1815903_1817010_-	lipase family protein	NA	NA	NA	NA	NA
WP_011145818.1|1817430_1818561_-	lipase family protein	NA	NA	NA	NA	NA
WP_011145819.1|1818931_1820050_-	lipase family protein	NA	NA	NA	NA	NA
WP_011145820.1|1820644_1821769_-	lipase family protein	NA	NA	NA	NA	NA
WP_109791427.1|1822479_1823873_-|transposase	IS5-like element ISPlu14 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.0	3.8e-80
>prophage 8
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	1893984	2041677	5688987	tRNA,tail,protease,transposase	Sodalis_phage(10.81%)	113	NA	NA
WP_011145885.1|1893984_1894713_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-31
WP_011145886.1|1895016_1895916_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_011145887.1|1896236_1897349_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	33.6	8.4e-06
WP_011145888.1|1897348_1899292_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.3	1.3e-38
WP_011145889.1|1899372_1899594_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.1e-15
WP_011145890.1|1899936_1900257_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	1.4e-14
WP_011145891.1|1900289_1902566_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	3.1e-164
WP_002211347.1|1902665_1902884_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_041380764.1|1903040_1903733_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011145893.1|1903739_1905488_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A1V0SJ29	Klosneuvirus	34.2	5.2e-18
WP_011145894.1|1905490_1907260_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	1.3e-24
WP_011145895.1|1907394_1908354_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.3	6.4e-63
WP_011145896.1|1908852_1909347_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_011145897.1|1909477_1912912_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.5	3.2e-88
WP_011145898.1|1913130_1913742_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011145899.1|1913749_1915093_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	2.6e-78
WP_011145900.1|1915324_1916614_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	1.2e-96
WP_109791434.1|1916709_1917480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144714.1|1917586_1919203_+|transposase	IS1634-like element ISPlu4 family transposase	transposase	NA	NA	NA	NA
WP_162096537.1|1920833_1921016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789764.1|1921115_1921718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145223.1|1922232_1923201_-|transposase	IS30-like element ISPlu1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	5.3e-41
WP_082303118.1|1923684_1923987_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011145903.1|1924464_1925403_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.8	1.1e-62
WP_011145904.1|1925819_1926560_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	4.7e-21
WP_011145905.1|1926633_1928916_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.3e-159
WP_011145906.1|1928971_1929829_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_041380020.1|1930148_1931912_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_011145908.1|1932050_1933094_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_011145909.1|1933263_1933539_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_011145910.1|1933535_1934039_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162096538.1|1934063_1934210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011145911.1|1934210_1935299_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	1.2e-86
WP_011145912.1|1935548_1936835_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011145913.1|1937139_1937823_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_011145914.1|1938004_1939678_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_011145915.1|1939743_1940028_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	41.1	3.7e-11
WP_011145916.1|1940991_1941891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145917.1|1941954_1942113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145918.1|1942623_1943259_-	LysE family translocator	NA	NA	NA	NA	NA
WP_109791440.1|1943263_1944085_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_011145920.1|1944984_1947312_+	ComEC family protein	NA	NA	NA	NA	NA
WP_041380022.1|1947347_1949096_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	32.1	1.0e-66
WP_011145922.1|1949092_1950088_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_041380023.1|1950669_1950885_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	46.8	1.3e-08
WP_011145924.1|1951263_1951443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011145925.1|1951446_1952196_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011145926.1|1952424_1953264_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_011145927.1|1953542_1954322_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_011145928.1|1954332_1955655_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_041380024.1|1955635_1956358_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_011145930.1|1956354_1960803_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_011145931.1|1961110_1961794_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_011145932.1|1961832_1962453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145933.1|1962696_1962936_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011145934.1|1963082_1964045_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	62.7	4.8e-82
WP_109791445.1|1964438_1965239_-	photopexin B	NA	NA	NA	NA	NA
WP_011144786.1|1965346_1966231_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011145935.1|1966540_1967338_-|tail	tail fiber protein	tail	F2Y385	Organic_Lake_phycodnavirus	28.5	6.2e-11
WP_011145938.1|1969767_1970754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145939.1|1970858_1971761_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_011145940.1|1971784_1973884_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	33.6	1.3e-07
WP_011145941.1|1973893_1975858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145942.1|1975921_1977139_-|tail	tail fiber protein	tail	F2Y385	Organic_Lake_phycodnavirus	25.1	2.0e-05
WP_011145943.1|1977248_1980602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145944.1|1980598_1983307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145945.1|1983349_1983766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145946.1|1983762_1984254_-	GPW/gp25 family protein	NA	M4SKQ1	Cyanophage	28.8	9.7e-07
WP_011145947.1|1984266_1985868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145948.1|1985864_1986548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145949.1|1986534_1986714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145950.1|1986710_1987169_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011145951.1|1987182_1988418_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145952.1|1988465_1989899_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145953.1|1989910_1990993_-|tail	phage tail sheath family protein	tail	D5LGY7	Escherichia_phage	27.0	7.4e-07
WP_011145954.1|1991046_1991496_-|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	28.2	9.8e-06
WP_011145956.1|1992244_1993171_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	61.4	3.9e-81
WP_082302904.1|1993271_1993568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145957.1|1993598_1994573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145959.1|1996911_1998996_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	9.8e-08
WP_011145960.1|1999005_2000685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145961.1|2000741_2001773_-|tail	tail fiber protein	tail	R4TQ39	Phaeocystis_globosa_virus	35.0	1.8e-07
WP_011145962.1|2001915_2004795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145963.1|2004787_2007490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145964.1|2007566_2007983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145965.1|2007979_2008426_-	GPW/gp25 family protein	NA	A0A0E3ETF4	Synechococcus_phage	30.5	1.6e-08
WP_011145966.1|2008438_2010040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145967.1|2010036_2010720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145968.1|2010706_2010886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145969.1|2010882_2011341_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011145970.1|2011376_2012552_-|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	31.0	5.7e-05
WP_011145971.1|2012607_2013993_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145972.1|2014004_2015087_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145973.1|2015262_2015712_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011145974.1|2016642_2017590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145976.1|2018791_2019694_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_011145977.1|2019718_2021785_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	4.4e-08
WP_011145978.1|2021794_2023357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|2023535_2024561_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011145979.1|2024610_2025561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145980.1|2025762_2028669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145981.1|2028665_2031368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145982.1|2031464_2031881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145983.1|2031877_2032369_-	GPW/gp25 family protein	NA	M4SKQ1	Cyanophage	27.9	2.8e-06
WP_011145984.1|2032381_2033983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145985.1|2033979_2034663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145986.1|2034649_2034829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145987.1|2034825_2035284_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011145988.1|2035297_2036503_-|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	31.9	5.3e-06
WP_011145989.1|2036551_2038036_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145990.1|2038047_2039124_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145991.1|2039177_2039627_-|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	28.2	1.3e-05
WP_011145993.1|2040654_2041677_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.4	4.2e-60
>prophage 9
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	2049817	2116982	5688987	tRNA,protease,tail,transposase	Enterobacteria_phage(28.57%)	52	NA	NA
WP_011146000.1|2049817_2051122_-|tail	tail fiber protein	tail	I3PUX0	Vibrio_phage	47.9	4.4e-06
WP_011146001.1|2051309_2054216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146002.1|2054208_2056926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146003.1|2056969_2057386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789826.1|2057382_2057814_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_011146005.1|2058114_2059716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146006.1|2059712_2060396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146007.1|2060382_2060562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146008.1|2060558_2061017_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_041380029.1|2061030_2062209_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146010.1|2062263_2063655_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146011.1|2063666_2064731_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146012.1|2064745_2065195_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_041380030.1|2065315_2065498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146013.1|2065880_2067668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146014.1|2068345_2068918_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011146015.1|2069075_2069870_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_011146017.1|2071201_2071726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146019.1|2071829_2072171_+	TcpQ domain-containing protein	NA	NA	NA	NA	NA
WP_011146020.1|2072175_2073780_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_011146021.1|2073783_2075076_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_041380786.1|2075098_2075605_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_011146023.1|2075626_2077189_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_011146024.1|2077195_2078293_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011146025.1|2078965_2080279_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011146026.1|2080441_2081116_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011144714.1|2081919_2083536_+|transposase	IS1634-like element ISPlu4 family transposase	transposase	NA	NA	NA	NA
WP_109791465.1|2083576_2084938_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011146027.1|2085030_2085579_+	YcbK family protein	NA	NA	NA	NA	NA
WP_011146028.1|2085624_2086272_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	30.1	3.0e-24
WP_011146029.1|2086688_2087879_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_110826480.1|2088100_2089264_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.0	5.3e-112
WP_011146031.1|2089772_2090918_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.2	1.1e-104
WP_011146032.1|2091254_2092655_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	38.5	9.0e-82
WP_011146033.1|2092859_2094074_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011146034.1|2094419_2097032_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.1	9.7e-21
WP_011146035.1|2097207_2097375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146037.1|2097718_2098729_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011146038.1|2099045_2099591_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_011146039.1|2099976_2101272_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011144786.1|2101393_2102278_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011146040.1|2102495_2103794_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011146041.1|2104071_2105187_-	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_011146042.1|2105289_2107407_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_011146043.1|2107412_2109323_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	2.3e-48
WP_011146044.1|2109412_2110660_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_011146045.1|2110680_2112330_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_011146046.1|2112326_2112890_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_011146047.1|2113136_2113304_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_011146048.1|2113885_2114224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146050.1|2114649_2115168_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_011146051.1|2115251_2116982_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 10
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	2361469	2405104	5688987	integrase,tail	Enterobacteria_phage(50.0%)	42	2357318:2357350	2401674:2401706
2357318:2357350	attL	CGTCATCTTTCAAGTTGCCTCTTTGTTGGCTGC	NA	NA	NA	NA
WP_011146249.1|2361469_2362090_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	48.5	3.0e-53
WP_011146250.1|2362664_2363792_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_041380052.1|2363864_2365532_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011146252.1|2365684_2366590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146253.1|2366613_2366970_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_011146254.1|2367086_2368265_+	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_082303121.1|2368215_2369199_+	phosphotriesterase-related protein	NA	NA	NA	NA	NA
WP_011146256.1|2369210_2369570_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_041380053.1|2369580_2370942_+	YhfT family protein	NA	NA	NA	NA	NA
WP_011146258.1|2370989_2372126_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011146259.1|2372412_2373108_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011146260.1|2373255_2373927_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011146261.1|2373954_2374635_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146262.1|2374926_2375607_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146263.1|2375636_2376317_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146264.1|2376347_2377028_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146265.1|2377057_2377738_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146266.1|2377768_2378449_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146267.1|2378709_2379393_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146268.1|2379663_2380344_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146269.1|2380504_2381185_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146270.1|2381345_2382026_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146271.1|2382052_2382733_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011146272.1|2382893_2383571_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146273.1|2383626_2384319_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_041380057.1|2385749_2386418_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011146275.1|2387124_2387799_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011146276.1|2388848_2389757_-	lipopolysaccharide core biosynthesis protein RfaZ	NA	NA	NA	NA	NA
WP_041380058.1|2389792_2390368_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_011146278.1|2390995_2391913_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	39.6	3.5e-34
WP_041380819.1|2393561_2394188_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	45.9	1.1e-34
WP_011146280.1|2394242_2394992_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	56.7	6.8e-44
WP_011146282.1|2396417_2396966_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011146283.1|2397023_2398856_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011146284.1|2398839_2399505_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_011146285.1|2399939_2400164_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_011146286.1|2400523_2400952_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.0	4.2e-22
WP_011146287.1|2401212_2401551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146288.1|2401729_2402167_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.8	1.4e-25
2401674:2401706	attR	GCAGCCAACAAAGAGGCAACTTGAAAGATGACG	NA	NA	NA	NA
WP_011146289.1|2402658_2403354_+	aquaporin Z	NA	NA	NA	NA	NA
WP_011146290.1|2403736_2404456_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	46.6	4.0e-33
WP_011146291.1|2404477_2405104_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	39.6	2.7e-33
>prophage 11
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	2646925	2700857	5688987	plate,transposase	Escherichia_phage(12.5%)	47	NA	NA
WP_011144722.1|2646925_2647810_-|transposase	IS982-like element ISPlu11 family transposase	transposase	NA	NA	NA	NA
WP_109791971.1|2647754_2648126_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	47.7	4.8e-06
WP_011146505.1|2649008_2649305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146506.1|2649524_2649809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071824108.1|2649923_2650142_-	DUF4184 family protein	NA	NA	NA	NA	NA
WP_011146507.1|2650220_2651414_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_011146508.1|2651779_2654191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146509.1|2654311_2655643_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011146510.1|2655899_2657012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146511.1|2657677_2661124_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011146512.1|2661327_2662239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146513.1|2662394_2662682_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	6.4e-19
WP_011146514.1|2662678_2662930_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011146515.1|2663259_2664180_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	32.5	9.6e-40
WP_125043766.1|2664516_2665560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146517.1|2666117_2666579_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.6	9.1e-31
WP_011146518.1|2666797_2667088_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011146519.1|2667084_2667363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146520.1|2667666_2668545_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_109791558.1|2668731_2670048_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_011146522.1|2670086_2671529_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_109791559.1|2671569_2672754_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011146524.1|2673061_2674381_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011146525.1|2674800_2675373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380079.1|2675664_2676039_+	VOC family protein	NA	NA	NA	NA	NA
WP_011146527.1|2676126_2676366_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_011146528.1|2676367_2676673_+	CcdB family protein	NA	NA	NA	NA	NA
WP_071824109.1|2676791_2676884_-	type II toxin-antitoxin system YoeB family toxin	NA	NA	NA	NA	NA
WP_011146529.1|2676943_2677198_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011146530.1|2677253_2677712_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_011145223.1|2677693_2678662_-|transposase	IS30-like element ISPlu1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	5.3e-41
WP_011146531.1|2678804_2679005_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_041380849.1|2679149_2682713_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.5	8.6e-28
WP_011146533.1|2682764_2683391_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011146534.1|2683421_2684681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146535.1|2684730_2687313_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.1	7.5e-90
WP_011146536.1|2687305_2690815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791564.1|2690830_2691454_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011146538.1|2691450_2692848_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011146539.1|2692851_2693529_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_109791565.1|2693521_2694646_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_173362525.1|2694638_2694938_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011146542.1|2694937_2695534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146543.1|2695568_2697575_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.5	6.3e-28
WP_011146544.1|2697599_2698610_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011146545.1|2698600_2700412_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_110826451.1|2700416_2700857_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 12
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	2800482	2823282	5688987	tail,protease	Streptomyces_phage(20.0%)	17	NA	NA
WP_011146620.1|2800482_2800932_+|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	29.5	4.4e-06
WP_011146621.1|2801005_2802082_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146622.1|2802139_2803432_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	38.7	6.9e-28
WP_011146623.1|2803486_2804653_+|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	29.5	5.7e-05
WP_011146624.1|2804671_2805130_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011146625.1|2805126_2805306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146626.1|2805292_2805976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146627.1|2805972_2807577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146628.1|2807589_2808012_+	GPW/gp25 family protein	NA	A0A0E3ETF4	Synechococcus_phage	32.3	1.8e-09
WP_011146629.1|2808008_2808425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146630.1|2808508_2812561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146631.1|2812586_2815622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146632.1|2815664_2817095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146633.1|2817104_2819186_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	4.4e-08
WP_011146634.1|2819210_2820113_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_109791580.1|2820414_2822034_+	membrane-targeted effector domain-containing toxin	NA	NA	NA	NA	NA
WP_011146636.1|2822310_2823282_+|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
>prophage 13
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	2834275	2914540	5688987	protease,transposase	Acinetobacter_phage(30.0%)	55	NA	NA
WP_011144774.1|2834275_2835289_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_071824113.1|2835376_2836444_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_049789776.1|2836326_2836785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158538214.1|2836745_2837090_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_071824115.1|2837020_2837296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|2837742_2838768_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011146648.1|2839043_2843954_+	cytotoxic necrotizing factor	NA	NA	NA	NA	NA
WP_011146649.1|2844041_2845391_-	Fic family protein	NA	NA	NA	NA	NA
WP_011146650.1|2845658_2846021_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011146651.1|2846017_2847298_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011146652.1|2847397_2847877_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011146653.1|2847901_2848507_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011146654.1|2848896_2849223_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_011146655.1|2849212_2849959_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011146656.1|2850003_2851173_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_011146657.1|2851179_2851491_-	LapA family protein	NA	NA	NA	NA	NA
WP_109791587.1|2851651_2851783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380089.1|2852008_2852605_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.8	8.1e-40
WP_011146659.1|2852754_2855430_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_011146660.1|2855682_2856510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146661.1|2856685_2857660_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_011146662.1|2857964_2860565_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	35.9	8.9e-91
WP_011146664.1|2861326_2862157_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011146665.1|2862215_2862395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146666.1|2862685_2863732_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.7	2.1e-22
WP_158536432.1|2865369_2865531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380092.1|2865700_2870992_-	hypothetical protein	NA	B6SD27	Bacteriophage	28.0	4.3e-108
WP_011146670.1|2871102_2871630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146671.1|2872007_2872613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145548.1|2874756_2875761_-|transposase	IS110-like element ISPlu13 family transposase	transposase	NA	NA	NA	NA
WP_011146673.1|2876554_2877193_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	47.8	8.1e-62
WP_011146674.1|2877522_2878287_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_109791974.1|2878292_2878883_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011146676.1|2878919_2879852_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_158538216.1|2880073_2880220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146678.1|2885420_2885690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791591.1|2886285_2887434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146680.1|2887753_2888374_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_049789779.1|2888401_2889262_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_011146682.1|2889463_2891332_-	glycoside hydrolase family 18 protein	NA	NA	NA	NA	NA
WP_011146683.1|2891459_2895548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146684.1|2895540_2899062_-	toxin	NA	NA	NA	NA	NA
WP_011146685.1|2899158_2900793_-	glycoside hydrolase family 18 protein	NA	W5VKF1	Buzura_suppressaria_nuclear_polyhedrosis_virus	31.4	5.1e-36
WP_011146686.1|2901649_2903224_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_011146687.1|2903223_2903802_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	36.5	1.3e-29
WP_011146688.1|2903815_2904814_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.4	5.3e-52
WP_011146689.1|2904816_2906181_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.1	5.4e-39
WP_011146690.1|2906257_2907448_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011146691.1|2907447_2908254_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_157866902.1|2908960_2909101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146692.1|2909091_2910738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146693.1|2910739_2911504_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	2.8e-16
WP_011146694.1|2911493_2912246_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_011146695.1|2912238_2913009_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_011146697.1|2913499_2914540_-|transposase	IS630-like element ISPlu16 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	2948274	2956586	5688987		Escherichia_phage(57.14%)	8	NA	NA
WP_011146727.1|2948274_2949123_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.7	2.2e-14
WP_011146729.1|2949553_2949967_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	55.0	4.8e-31
WP_011146730.1|2951053_2951959_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	59.9	1.4e-91
WP_011146731.1|2951958_2953236_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	50.2	8.7e-108
WP_041380095.1|2953228_2953870_+	aldolase	NA	A0A077SK32	Escherichia_phage	54.1	4.9e-59
WP_011146733.1|2953888_2954668_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_011146734.1|2954680_2955448_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	41.9	9.4e-49
WP_011146735.1|2955620_2956586_+	SDR family oxidoreductase	NA	A0A1V0SAI6	Catovirus	24.8	8.0e-05
>prophage 15
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	2965715	2980853	5688987	tail	Cyanophage(100.0%)	13	NA	NA
WP_011146742.1|2965715_2966972_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_011146743.1|2967099_2970003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146744.1|2969995_2972725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146745.1|2972807_2973224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146746.1|2973220_2973637_-	GPW/gp25 family protein	NA	M4SKQ1	Cyanophage	32.3	8.8e-09
WP_011146747.1|2973650_2975252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146748.1|2975248_2975932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146749.1|2975918_2976098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146750.1|2976094_2976553_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011146751.1|2976566_2977763_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146752.1|2977811_2979218_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_041380096.1|2979229_2980324_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146754.1|2980403_2980853_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 16
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	3110949	3124193	5688987	tRNA	Tupanvirus(44.44%)	12	NA	NA
WP_011146880.1|3110949_3112932_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.6	1.5e-21
WP_011146881.1|3112932_3113910_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	Q76H32	Enterobacteria_phage	33.3	9.5e-38
WP_011146882.1|3113910_3115056_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	25.9	1.0e-35
WP_041380894.1|3115216_3115963_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1V0SE00	Indivirus	28.1	1.0e-07
WP_011146884.1|3115996_3117004_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_011146885.1|3117069_3117366_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	7.1e-13
WP_011146886.1|3117370_3119758_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.2	4.6e-09
WP_011146887.1|3119773_3120757_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.1	2.9e-34
WP_011146888.1|3121028_3121385_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_011146889.1|3121426_3121624_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071824118.1|3121721_3122261_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.5	2.9e-12
WP_011146891.1|3122264_3124193_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.3e-126
>prophage 17
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	3409530	3466582	5688987	head,plate,holin,integrase,lysis,terminase,tail,transposase	Haemophilus_phage(17.02%)	87	3409319:3409378	3456149:3456251
3409319:3409378	attL	CGTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCATGCCGACCAAATTTCCCCAG	NA	NA	NA	NA
WP_011147093.1|3409530_3410157_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	39.2	4.7e-30
WP_011147094.1|3410156_3411479_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	44.5	1.6e-27
WP_011147095.1|3411465_3412122_-	DUF2612 domain-containing protein	NA	NA	NA	NA	NA
WP_011147096.1|3412114_3413248_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	37.9	3.8e-70
WP_011147097.1|3413231_3413594_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	52.3	8.1e-27
WP_011147098.1|3413590_3414262_-	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	58.8	1.6e-44
WP_011147099.1|3414236_3415082_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	53.6	1.3e-83
WP_011147100.1|3415056_3415395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147101.1|3415391_3416111_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	39.8	6.1e-34
WP_021327110.1|3416257_3416407_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	75.0	9.7e-11
WP_041380929.1|3416644_3417403_-	antirepressor	NA	A0A2L1IV39	Escherichia_phage	58.4	2.9e-82
WP_041380931.1|3417865_3418135_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	42.7	1.0e-10
WP_011147106.1|3418152_3418440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147107.1|3418508_3420497_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	31.9	2.7e-15
WP_011147109.1|3420644_3421040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380124.1|3421039_3421474_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_011147111.1|3421477_3422989_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	44.0	7.9e-108
WP_049789837.1|3422991_3423366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380126.1|3423409_3423748_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	31.2	2.6e-11
WP_011147114.1|3423740_3424334_-	hypothetical protein	NA	A0A1L2JY56	Aeribacillus_phage	33.2	7.6e-14
WP_011147115.1|3424330_3424693_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	46.2	4.5e-17
WP_011147116.1|3424707_3425667_-	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_011147117.1|3425671_3426157_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_011147118.1|3426159_3427317_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	36.4	9.6e-21
WP_041380933.1|3427320_3428172_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q7Y5U5	Haemophilus_phage	31.8	2.7e-28
WP_041380127.1|3428092_3429466_-	DUF1073 domain-containing protein	NA	A0A1W6JTH9	Shewanella_phage	24.3	1.6e-19
WP_011147121.1|3429465_3430695_-|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	78.9	1.4e-195
WP_011147122.1|3430691_3431093_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	54.0	1.3e-28
WP_011147123.1|3431137_3431806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380128.1|3432170_3432512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380129.1|3432504_3432732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147125.1|3432928_3433378_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.6	2.3e-18
WP_011147126.1|3433374_3433599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147127.1|3433610_3434021_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	51.5	6.4e-28
WP_011147128.1|3434017_3434341_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	50.5	1.0e-25
WP_041380131.1|3434492_3434678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380132.1|3434667_3434877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380133.1|3434901_3435366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147131.1|3435549_3436365_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	48.9	4.5e-65
WP_041380134.1|3436551_3436737_-	hypothetical protein	NA	E5AGG1	Erwinia_phage	32.2	7.3e-08
WP_011147132.1|3436733_3437114_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	40.7	6.3e-14
WP_011147133.1|3437222_3437459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147134.1|3437458_3437902_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	47.1	4.8e-29
WP_036841551.1|3438095_3438302_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_011147136.1|3438314_3439271_-	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	57.2	3.1e-102
WP_011147137.1|3439233_3440775_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	70.9	2.4e-213
WP_154097931.1|3440846_3441320_-	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_049789838.1|3441541_3441871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147140.1|3441948_3442266_-	hypothetical protein	NA	I6PCV6	Cronobacter_phage	52.3	4.3e-16
WP_011147141.1|3442388_3442592_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	67.2	1.1e-17
WP_011147142.1|3442701_3443340_+	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	56.9	3.7e-59
WP_011147143.1|3443402_3443741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147144.1|3443733_3444144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147146.1|3444471_3444690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147147.1|3444879_3445164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791976.1|3445315_3445462_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011147149.1|3445568_3446099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147150.1|3446175_3446355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147151.1|3446573_3446831_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	42.4	5.2e-12
WP_011147152.1|3446860_3447283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147153.1|3447352_3448255_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	54.9	2.1e-39
WP_011147154.1|3448645_3448903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147155.1|3448899_3449820_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	69.6	1.3e-121
WP_041380943.1|3449823_3450504_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	74.8	4.7e-100
WP_082303152.1|3450500_3450902_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_011147159.1|3451109_3451547_+	hypothetical protein	NA	A9YX19	Burkholderia_phage	49.6	1.4e-36
WP_011147160.1|3451552_3452209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380137.1|3452205_3452388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380138.1|3452371_3452596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380139.1|3452598_3452853_+	DUF5405 family protein	NA	A0A192YCJ9	Morganella_phage	48.2	1.7e-15
WP_041380141.1|3452887_3453517_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	57.6	1.1e-66
WP_011147163.1|3453503_3453743_+	hypothetical protein	NA	S4TWM3	Salmonella_phage	42.4	5.6e-08
WP_040154027.1|3453766_3454069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147165.1|3454314_3454611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147166.1|3454620_3454839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147167.1|3454840_3456019_+|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.9	5.5e-32
WP_082302955.1|3456284_3456401_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
3456149:3456251	attR	CGTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCATGCCGACCAAATTTCCCCAGAAAAACCAACCTGTTAGGGTTGGTTTTTTTATGGCTGGGATTT	NA	NA	NA	NA
WP_011147171.1|3456819_3457116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147172.1|3457230_3458046_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	44.3	8.7e-61
WP_082303128.1|3458359_3458731_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_011146066.1|3458760_3459786_-|transposase	IS630-like element ISPlu3 family transposase	transposase	NA	NA	NA	NA
WP_011147174.1|3459818_3460118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147175.1|3460368_3460791_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	45.3	9.5e-27
WP_011147177.1|3462412_3462835_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.6	1.4e-25
WP_011147178.1|3462837_3463425_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	45.5	1.0e-10
WP_011147179.1|3463958_3464723_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	41.0	7.3e-09
WP_011147180.1|3465166_3466582_-|tail	tail fiber assembly protein	tail	A5X9J3	Aeromonas_virus	57.6	1.4e-18
>prophage 18
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	3509123	3537385	5688987	plate,tail,transposase	Salmonella_phage(18.18%)	27	NA	NA
WP_011147226.1|3509123_3509636_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	37.3	1.3e-22
WP_011147227.1|3509677_3510775_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_041380156.1|3512833_3513460_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	43.1	1.5e-39
WP_011147230.1|3513459_3514161_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	43.5	1.8e-30
WP_011147232.1|3515847_3516825_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	42.9	2.9e-10
WP_011147233.1|3517194_3518163_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.8e-41
WP_011147235.1|3519440_3520397_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011147236.1|3520608_3521364_+	glycosyltransferase family 25 protein	NA	A0A1V0SJT4	Klosneuvirus	31.4	1.1e-09
WP_071824123.1|3521520_3522294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147238.1|3522744_3523173_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	35.2	1.7e-15
WP_125026241.1|3523660_3524143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147240.1|3524145_3524568_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	44.2	9.8e-24
WP_011147241.1|3524612_3525239_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	41.0	3.8e-32
WP_011147242.1|3525238_3526675_-|tail	tail fiber protein	tail	A0A219YBC2	Aeromonas_phage	49.2	2.4e-37
WP_113042590.1|3526677_3527238_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	44.5	3.3e-35
WP_011147244.1|3527246_3528440_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	50.6	1.0e-102
WP_011147245.1|3528432_3528780_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	56.0	1.2e-27
WP_011147246.1|3528776_3529532_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.7	4.4e-75
WP_011147247.1|3529528_3530485_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	39.0	6.8e-65
WP_011147248.1|3530575_3530881_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	41.1	1.1e-13
WP_011147249.1|3530865_3531471_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	51.2	1.4e-47
WP_011147250.1|3531473_3533243_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	34.8	2.1e-14
WP_011147251.1|3533435_3533846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147252.1|3533959_3534400_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	67.8	2.7e-48
WP_011147253.1|3534409_3535879_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	47.6	2.3e-120
WP_011147254.1|3535882_3536446_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.0	1.5e-48
WP_011147255.1|3536965_3537385_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	45.5	2.6e-29
>prophage 19
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	3617378	3722172	5688987	transposase	Tupanvirus(18.18%)	57	NA	NA
WP_011144854.1|3617378_3618392_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011147316.1|3618510_3619155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147317.1|3619961_3620591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147318.1|3621254_3622079_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_041380178.1|3622090_3623245_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_011147320.1|3623256_3624141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147321.1|3625037_3626492_-	amino acid permease	NA	NA	NA	NA	NA
WP_011147322.1|3626596_3627574_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_011147323.1|3627586_3628930_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_011147324.1|3628980_3630456_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011147325.1|3630458_3631490_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_011147326.1|3631511_3632720_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.3e-33
WP_011147327.1|3634812_3635061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789715.1|3635423_3635789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144475.1|3635782_3636118_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011145417.1|3636181_3637687_+|transposase	IS66-like element ISPlu20 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	1.3e-89
WP_011147329.1|3637872_3638253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147332.1|3639118_3639466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147333.1|3639470_3643967_-	PAAR domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.8	4.4e-21
WP_011147334.1|3643982_3644150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147336.1|3646118_3662492_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.3	4.5e-140
WP_157852163.1|3663955_3664093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147338.1|3664485_3666606_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.9	1.4e-41
WP_011147339.1|3666605_3667994_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011147340.1|3667993_3670153_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.6	1.0e-47
WP_173362511.1|3670305_3677427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147342.1|3677816_3678092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147343.1|3678527_3688463_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.1	8.2e-145
WP_011147344.1|3690388_3691363_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.4	2.3e-60
WP_125026243.1|3691948_3692191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147346.1|3692923_3694246_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_011147347.1|3694555_3696166_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.7	1.6e-29
WP_011147348.1|3696158_3697325_-	MFS transporter	NA	NA	NA	NA	NA
WP_011147349.1|3697349_3698714_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011147350.1|3698710_3699922_-	citrate/2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_041380187.1|3700083_3701097_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011144720.1|3701219_3702245_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011147352.1|3703028_3704621_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_173362512.1|3704836_3705838_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_011147354.1|3706069_3707605_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	6.5e-25
WP_011147355.1|3707598_3708600_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_162096546.1|3708596_3709601_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_011147357.1|3709663_3710683_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_011147358.1|3710751_3711627_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_011147359.1|3711638_3711938_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_011145659.1|3712013_3712442_-|transposase	IS200/IS605-like element ISPlu2 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
WP_011147360.1|3712843_3713248_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_011147361.1|3713250_3713430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147362.1|3713420_3713735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147363.1|3714421_3714901_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_125043777.1|3715010_3715373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380192.1|3715365_3715719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147365.1|3715711_3716482_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_011147366.1|3717068_3717353_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011147367.1|3717522_3718089_-	NUDIX hydrolase YfcD	NA	NA	NA	NA	NA
WP_011147368.1|3718570_3720448_-	lipase family protein	NA	NA	NA	NA	NA
WP_011146697.1|3721131_3722172_+|transposase	IS630-like element ISPlu16 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	3777826	3956324	5688987	tRNA,tail,plate,transposase	uncultured_Caudovirales_phage(15.0%)	109	NA	NA
WP_011144786.1|3777826_3778711_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_082303130.1|3778698_3785883_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	NA	NA	NA	NA
WP_011147415.1|3787106_3787361_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011147416.1|3787540_3788479_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.8	6.3e-63
WP_011147417.1|3788969_3789986_-	formamidase	NA	NA	NA	NA	NA
WP_011147418.1|3790471_3792025_+	Fic family protein	NA	NA	NA	NA	NA
WP_011147419.1|3792543_3792945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147420.1|3792944_3793505_-	SocA family protein	NA	NA	NA	NA	NA
WP_041380207.1|3793998_3804579_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	NA	NA	NA	NA
WP_011147422.1|3805729_3806371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147423.1|3807330_3808020_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011147424.1|3808059_3808746_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011147425.1|3809058_3809727_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011147426.1|3810051_3810480_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011147427.1|3810484_3811024_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011147428.1|3811001_3812090_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011147429.1|3812053_3813814_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011147430.1|3814340_3815324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147431.1|3815367_3817845_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011147432.1|3817832_3818345_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011147433.1|3818396_3818909_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_157866904.1|3819483_3819624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147435.1|3819696_3823068_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_041380211.1|3823064_3824183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789784.1|3824736_3825786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380217.1|3825839_3827453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147441.1|3827456_3829982_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	1.6e-04
WP_165828660.1|3830820_3834207_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_011147443.1|3834187_3835339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147444.1|3835335_3835593_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011147445.1|3835589_3838079_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011147446.1|3838066_3838579_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011147447.1|3838630_3839143_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011147448.1|3839194_3839710_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011147449.1|3839719_3840502_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011147450.1|3840505_3842905_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.0	3.2e-18
WP_157866905.1|3843427_3843568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147451.1|3843640_3847012_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_011147452.1|3847008_3848127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147454.1|3848668_3849718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147455.1|3849896_3850988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147456.1|3850980_3852591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147457.1|3852593_3855122_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.7	5.5e-05
WP_011147458.1|3855298_3855790_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011147459.1|3855808_3857536_-	OmpA family protein	NA	NA	NA	NA	NA
WP_071824125.1|3857532_3857802_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_162096530.1|3857756_3857915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049789715.1|3857848_3858214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144475.1|3858207_3858543_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011145417.1|3858606_3860112_+|transposase	IS66-like element ISPlu20 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	1.3e-89
WP_041380999.1|3860161_3860554_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011147460.1|3860550_3861900_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011147461.1|3861915_3863442_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011147462.1|3863473_3863971_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011147463.1|3865126_3880777_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.8	1.1e-175
WP_011147464.1|3880896_3881043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|3882982_3884008_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011144714.1|3884608_3886225_-|transposase	IS1634-like element ISPlu4 family transposase	transposase	NA	NA	NA	NA
WP_011144854.1|3886592_3887606_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011147465.1|3888387_3888597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147468.1|3889624_3889876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147469.1|3889862_3891659_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_011147470.1|3891750_3892173_-	enhanced serine sensitivity protein SseB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011147471.1|3892208_3893504_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	42.3	1.5e-38
WP_011147472.1|3893812_3894013_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_011147473.1|3894031_3894367_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011147474.1|3894369_3896220_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	3.9e-109
WP_011147475.1|3896231_3896753_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_011147476.1|3896790_3897114_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	49.5	5.4e-22
WP_011147477.1|3897223_3897610_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	3.5e-52
WP_011147478.1|3897634_3898849_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	2.7e-34
WP_011147479.1|3898898_3899393_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_011147480.1|3899479_3900205_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_011147481.1|3900338_3901142_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_011147482.1|3901244_3902906_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_011147483.1|3903005_3904427_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011147484.1|3904575_3905523_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_011147485.1|3905595_3906741_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_011147486.1|3907060_3908314_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.3	1.9e-99
WP_011147487.1|3908685_3909876_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_011147489.1|3910531_3910954_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_011147490.1|3910950_3912345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147491.1|3912404_3912986_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	36.6	2.0e-22
WP_041380228.1|3913333_3913744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071824126.1|3914152_3914356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082302899.1|3914352_3914484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147494.1|3914459_3915485_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_041380234.1|3915776_3916427_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_041380236.1|3916423_3917512_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011147497.1|3918071_3918659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146748378.1|3918582_3918924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791981.1|3919143_3920247_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_109791982.1|3920688_3921891_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_109791723.1|3922079_3923141_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011144786.1|3923574_3924459_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011147501.1|3924819_3925158_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_011147502.1|3925173_3926796_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	1.1e-94
WP_011147503.1|3926862_3928200_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.8e-10
WP_162096542.1|3928196_3928916_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_041381009.1|3929045_3930485_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.3	2.0e-15
WP_011147507.1|3931260_3931533_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011147508.1|3931519_3931867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041381011.1|3931983_3935871_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.0	2.1e-128
WP_049789787.1|3936137_3937553_+	membrane-bound lytic murein transglycosylase MltF	NA	A0A1V0E6L2	Klebsiella_phage	36.6	1.1e-07
WP_011147511.1|3937683_3939990_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_011147512.1|3939978_3940500_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_011147513.1|3942669_3953265_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	NA	NA	NA	NA
WP_011147515.1|3955227_3955728_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	44.5	1.2e-31
WP_011147516.1|3955724_3956324_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	45.2	1.7e-45
>prophage 21
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	3959756	4077258	5688987	protease,head,plate,capsid,integrase,lysis,tRNA,terminase,tail,transposase	Burkholderia_virus(15.85%)	131	4006395:4006425	4085185:4085215
WP_011147519.1|3959756_3960584_+|tail	tail fiber protein	tail	F1BUP1	Erwinia_phage	39.2	2.7e-17
WP_109791728.1|3960623_3960743_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_011147520.1|3961156_3961984_+|tail	tail fiber protein	tail	Q858V4	Yersinia_virus	42.7	2.7e-09
WP_011147521.1|3961985_3962420_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	5.7e-27
WP_011147522.1|3962808_3963528_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	42.4	4.0e-17
WP_011147523.1|3964215_3964476_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	1.0e-18
WP_011147524.1|3964478_3964859_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_011147525.1|3964858_3965590_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_011147526.1|3965784_3966510_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011147527.1|3966521_3967430_-	GTPase Era	NA	NA	NA	NA	NA
WP_011147528.1|3967426_3968107_-	ribonuclease III	NA	M1HK80	Acanthocystis_turfacea_Chlorella_virus	32.0	2.1e-20
WP_011147529.1|3968281_3969262_-	signal peptidase I	NA	NA	NA	NA	NA
WP_011147530.1|3969282_3971079_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_011147531.1|3971272_3971737_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_011147532.1|3971736_3972693_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_011147533.1|3972698_3973349_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_011147534.1|3973388_3973958_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_011147535.1|3974161_3975766_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_011147536.1|3975833_3976568_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011147537.1|3976850_3978188_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	4.2e-44
WP_011147538.1|3978358_3978877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147539.1|3979434_3980649_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011144720.1|3981235_3982261_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011147540.1|3983533_3984280_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011144854.1|3984962_3985976_+|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011147543.1|3986351_3987242_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011147544.1|3987279_3987984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147545.1|3987990_3989205_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011147546.1|3989473_3990088_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011147547.1|3990109_3991219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147548.1|3991707_3993126_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011147549.1|3993322_3993853_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_011147550.1|3993868_3994612_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_011147551.1|3994858_3995998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147552.1|3995999_3996848_-	SPASM domain-containing protein	NA	A0A1B1ITW6	uncultured_Mediterranean_phage	24.8	5.4e-13
WP_011147553.1|3997547_3998135_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011147554.1|3998150_3999167_-	phospholipase	NA	NA	NA	NA	NA
WP_011147555.1|3999925_4000606_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	46.7	4.3e-53
WP_011147556.1|4000674_4001256_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011147557.1|4001380_4002259_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_011147558.1|4002347_4004009_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011147559.1|4004247_4004595_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_011147560.1|4004650_4004944_-	RnfH family protein	NA	NA	NA	NA	NA
WP_011147561.1|4004936_4005371_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_011147562.1|4005527_4006010_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	7.3e-31
4006395:4006425	attL	ACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_071824172.1|4006926_4007076_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011147564.1|4007218_4007503_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011147565.1|4007650_4008097_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	60.7	1.1e-09
WP_082302866.1|4008097_4009210_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	35.9	6.6e-11
WP_011147567.1|4009427_4010033_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	37.7	2.0e-30
WP_041380244.1|4010033_4011275_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	50.2	7.4e-104
WP_011147569.1|4011274_4011631_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	50.9	1.9e-20
WP_011147570.1|4011729_4011903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147571.1|4012059_4012593_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	54.1	2.0e-53
WP_109791732.1|4013056_4013656_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	45.9	3.0e-42
WP_011147574.1|4014508_4014814_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	52.1	3.9e-22
WP_011147575.1|4014810_4015632_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	7.8e-25
WP_041380246.1|4015631_4017749_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	57.1	5.4e-46
WP_011147577.1|4017957_4018365_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	45.7	1.6e-18
WP_011147578.1|4018364_4018802_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	36.7	2.3e-20
WP_011147579.1|4018801_4020289_-	DUF3383 domain-containing protein	NA	E2GLU1	Acinetobacter_phage	31.7	3.0e-59
WP_173362531.1|4020269_4020701_-	hypothetical protein	NA	Q6UJ27	Burkholderia_virus	33.8	2.8e-10
WP_011147581.1|4020811_4021183_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	46.7	3.2e-26
WP_011147582.1|4021179_4021638_-	hypothetical protein	NA	A0A068C8K8	Acinetobacter_phage	40.8	5.7e-17
WP_011147583.1|4021637_4022087_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	45.9	1.0e-18
WP_011147584.1|4022091_4022418_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	38.6	3.5e-13
WP_011147585.1|4022418_4023453_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	47.0	1.3e-82
WP_011147586.1|4023452_4023929_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	44.2	5.3e-26
WP_011147587.1|4023931_4025257_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	42.7	1.8e-71
WP_040149365.1|4025274_4025967_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	45.1	2.0e-50
WP_109791985.1|4026052_4027477_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.5	4.2e-103
WP_071824128.1|4027535_4028741_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4JCM3	uncultured_Caudovirales_phage	64.0	1.4e-144
WP_011147591.1|4028800_4029520_-|terminase	terminase small subunit	terminase	A0A077KBY7	Edwardsiella_phage	37.3	6.4e-07
WP_011147592.1|4029598_4029916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147593.1|4031309_4032209_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_011147594.1|4032228_4032747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147595.1|4032877_4033327_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	46.6	1.3e-18
WP_011147596.1|4033419_4033956_-	lysozyme	NA	K7PM52	Enterobacteria_phage	67.8	3.7e-68
WP_011147597.1|4033939_4034122_-	hypothetical protein	NA	B6SD15	Bacteriophage	58.6	4.2e-16
WP_011147598.1|4034282_4034684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147600.1|4036100_4036349_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041380249.1|4036437_4036692_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011147602.1|4036796_4037054_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.2	1.9e-17
WP_011147603.1|4037154_4037607_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	43.8	1.2e-11
WP_109791986.1|4038586_4039165_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	62.2	9.5e-62
WP_011147606.1|4039154_4040258_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	50.7	1.1e-98
WP_041380251.1|4040248_4040602_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	60.2	2.5e-33
WP_011147608.1|4040648_4041254_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.1	7.0e-15
WP_011147609.1|4041250_4042429_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	50.1	3.5e-87
WP_036777198.1|4042416_4042629_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_011147610.1|4042631_4043516_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	47.1	2.4e-56
WP_011147611.1|4043515_4046068_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.0	4.8e-166
WP_109791733.1|4046071_4046281_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011147613.1|4046734_4047259_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	70.1	6.0e-71
WP_011147614.1|4047258_4048686_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	73.2	2.3e-205
WP_011147615.1|4048675_4048888_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	41.9	5.4e-07
WP_011147616.1|4048884_4049352_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	53.4	1.4e-39
WP_041380252.1|4049351_4049789_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	47.7	3.6e-29
WP_011147618.1|4049790_4050141_-	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	46.9	7.4e-17
WP_011147619.1|4050154_4051090_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.9	1.9e-67
WP_011147620.1|4051121_4052216_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	1.3e-99
WP_011147621.1|4052420_4052870_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	40.6	4.0e-23
WP_041380253.1|4052862_4053693_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	62.9	9.7e-100
WP_011147623.1|4053673_4055167_-	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	59.3	5.5e-170
WP_011147624.1|4055166_4056690_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	61.8	5.4e-181
WP_011147625.1|4056686_4057232_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	65.4	4.3e-56
WP_011147626.1|4057231_4057543_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	61.0	2.3e-30
WP_011147627.1|4057535_4057868_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	6.8e-20
WP_011147628.1|4057864_4058488_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	33.3	2.0e-09
WP_011147629.1|4058477_4059095_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J7R8	uncultured_Caudovirales_phage	51.7	4.6e-54
WP_011147630.1|4059097_4059448_-	membrane protein	NA	A4JWP3	Burkholderia_virus	52.3	7.1e-20
WP_011147631.1|4059698_4060469_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	1.3e-98
WP_011147632.1|4060516_4060954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125043781.1|4060971_4061337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380254.1|4061437_4061782_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_041380255.1|4062301_4062487_+	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	71.4	1.9e-16
WP_011147637.1|4062542_4062851_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	49.0	2.0e-18
WP_041380256.1|4062870_4063827_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	44.1	1.1e-62
WP_011147639.1|4063880_4065665_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	54.3	1.3e-181
WP_011147640.1|4065903_4067076_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	58.8	8.0e-116
WP_011147641.1|4067534_4067726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147643.1|4068247_4068616_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.4	4.4e-28
WP_011147645.1|4069365_4069566_-	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	53.1	1.4e-09
WP_011147649.1|4070561_4071155_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	54.1	9.2e-60
WP_011147650.1|4071255_4072455_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.0	6.6e-49
WP_011147652.1|4073567_4074935_-	DNA helicase	NA	K7P852	Enterobacteria_phage	44.1	1.1e-92
WP_011147653.1|4074936_4075521_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	48.1	6.7e-47
WP_011147654.1|4075529_4076282_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	48.1	1.6e-29
WP_011147655.1|4076284_4076509_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	47.9	6.6e-11
WP_011147656.1|4076523_4076973_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	53.7	5.7e-30
WP_041380257.1|4077030_4077258_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD1	Pseudomonas_phage	42.0	1.4e-05
4085185:4085215	attR	ACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
>prophage 22
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	4080519	4089619	5688987		Pectobacterium_phage(37.5%)	11	NA	NA
WP_011147662.1|4080519_4082280_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.3	3.1e-119
WP_011147663.1|4082276_4082774_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.2	1.4e-50
WP_011147664.1|4082825_4083014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147665.1|4083583_4083754_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	53.6	3.0e-08
WP_011147666.1|4083758_4083974_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	71.7	3.0e-21
WP_049789790.1|4085554_4085770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147669.1|4085833_4086064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147670.1|4086060_4086330_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	61.5	2.1e-16
WP_036808644.1|4086677_4087088_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	57.9	3.2e-35
WP_011147672.1|4087141_4087315_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	66.7	3.7e-14
WP_041380260.1|4089082_4089619_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	54.9	2.0e-42
>prophage 23
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	4179207	4187673	5688987	tRNA,transposase	Sodalis_phage(16.67%)	7	NA	NA
WP_011147726.1|4179207_4180215_-|transposase	ISNCY-like element ISPlu15 family transposase	transposase	Q2A0A7	Sodalis_phage	64.3	6.3e-77
WP_011147727.1|4180418_4181042_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	38.7	1.5e-20
WP_011147728.1|4181517_4183032_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	5.2e-83
WP_109791750.1|4183041_4184140_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_011147730.1|4184297_4186031_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.6	9.8e-62
WP_011147731.1|4186030_4186738_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_011147732.1|4186761_4187673_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.4	2.2e-28
>prophage 24
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	4357608	4421733	5688987	holin,lysis,transposase	Wolbachia_phage(16.67%)	49	NA	NA
WP_011144727.1|4357608_4358991_+|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
WP_125026219.1|4359035_4359296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147852.1|4359525_4360656_-	site-specific tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	31.4	3.8e-14
WP_011147856.1|4360642_4363957_-	toprim domain-containing protein	NA	C7F4F5	Cyanophage	23.9	1.9e-13
WP_011147857.1|4364089_4364452_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011147858.1|4364524_4364752_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_109791993.1|4364804_4365131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041381087.1|4365166_4365502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144727.1|4366498_4367881_+|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
WP_157866891.1|4367925_4368183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011145673.1|4368412_4369543_-	site-specific tyrosine recombinase XerC	NA	A0A1B1P7C7	Bacillus_phage	23.6	1.6e-07
WP_011147861.1|4369529_4372847_-	toprim domain-containing protein	NA	C7F4F5	Cyanophage	24.1	3.9e-14
WP_011147857.1|4372979_4373342_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011147858.1|4373414_4373642_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_109791993.1|4373694_4374021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147862.1|4374056_4383140_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.6	2.8e-46
WP_011147863.1|4383188_4384853_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	27.8	1.2e-37
WP_011147864.1|4385661_4386342_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011147865.1|4386395_4387088_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011144720.1|4387629_4388655_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_082303134.1|4388687_4389122_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011147866.1|4389399_4390926_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_011147867.1|4391035_4392484_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011147868.1|4392476_4393799_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_011147869.1|4394073_4394973_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011144720.1|4395510_4396536_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011147870.1|4396578_4397145_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_041381091.1|4397837_4398047_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	67.2	2.7e-19
WP_011147872.1|4398180_4399359_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011147873.1|4399345_4400800_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_011147874.1|4400957_4401959_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011147875.1|4402189_4402864_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_041380308.1|4403543_4403750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147876.1|4403987_4404653_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011147877.1|4405166_4406237_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011147878.1|4406659_4406992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380310.1|4407261_4407519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147879.1|4407508_4408645_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011147880.1|4409210_4410695_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011147881.1|4410740_4412108_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_041381095.1|4412850_4414440_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_011147883.1|4414484_4415342_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_011147884.1|4415589_4417737_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_011147885.1|4417798_4418227_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_011147886.1|4418226_4419372_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_011147887.1|4420052_4420448_+	VOC family protein	NA	NA	NA	NA	NA
WP_011147888.1|4420536_4420986_-|lysis	lysis protein	lysis	G0ZNC9	Cronobacter_phage	41.9	7.2e-17
WP_011147889.1|4420995_4421397_-	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	55.4	2.7e-39
WP_011147890.1|4421406_4421733_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	61.4	5.2e-25
>prophage 25
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	4682834	4747496	5688987	holin,tail,protease,transposase	Cronobacter_phage(18.75%)	59	NA	NA
WP_011148127.1|4682834_4683236_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011148128.1|4683228_4683489_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_011148129.1|4683708_4684104_+	DoxX family protein	NA	A0A0E3HFP9	Synechococcus_phage	32.2	1.1e-05
WP_011148130.1|4684774_4685671_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148131.1|4685781_4686483_+	pirin family protein	NA	NA	NA	NA	NA
WP_011148133.1|4686978_4687845_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.4	1.4e-48
WP_041381128.1|4687908_4689651_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_011148135.1|4689727_4690108_+	YraN family protein	NA	NA	NA	NA	NA
WP_011148136.1|4690132_4690723_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	33.3	3.2e-12
WP_011148137.1|4690733_4691309_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_011148138.1|4691440_4692166_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_011148139.1|4692170_4692824_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_011148140.1|4693061_4695407_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.8	9.3e-39
WP_011148141.1|4696154_4700612_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011148142.1|4700621_4702040_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011148143.1|4702278_4702785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148144.1|4702836_4703352_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	6.8e-27
WP_011148145.1|4703355_4703997_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011148146.1|4704343_4704736_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011148147.1|4704751_4705180_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011148148.1|4705434_4706565_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011148149.1|4706908_4707313_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_011148150.1|4707550_4708927_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	1.9e-20
WP_109791427.1|4709078_4710472_-|transposase	IS5-like element ISPlu14 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.0	3.8e-80
WP_011148151.1|4711726_4712785_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	4.4e-12
WP_011148153.1|4713571_4715014_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011148154.1|4715022_4717518_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011148155.1|4717684_4718173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148156.1|4718276_4719836_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_011148157.1|4720260_4721526_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011148158.1|4721577_4721832_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_011148159.1|4722230_4722524_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_011148160.1|4722525_4723155_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_011148161.1|4723188_4723695_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011148162.1|4723699_4724482_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_011148163.1|4724492_4725296_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.7	1.1e-20
WP_011148164.1|4725524_4726499_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_011148165.1|4726523_4727492_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.5	1.5e-35
WP_011148166.1|4727509_4728073_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	79.3	1.5e-56
WP_011148167.1|4728093_4728672_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011148168.1|4728652_4729186_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_011148169.1|4729192_4729918_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-22
WP_011148170.1|4729945_4731388_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011148171.1|4731411_4731699_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_011148172.1|4731822_4732290_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_011148173.1|4732373_4733225_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
WP_011148174.1|4733224_4733497_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_011148175.1|4733685_4734096_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_157866908.1|4735639_4735804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148177.1|4736108_4737758_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	50.4	1.3e-159
WP_041380260.1|4737757_4738294_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	54.9	2.0e-42
WP_011148178.1|4738265_4738874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148179.1|4739609_4741418_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	52.5	4.2e-79
WP_041380349.1|4742604_4742919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148183.1|4743156_4744497_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011148184.1|4744698_4745238_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011148185.1|4745269_4745539_-	barstar family protein	NA	NA	NA	NA	NA
WP_011148186.1|4745543_4746008_-	ribonuclease	NA	NA	NA	NA	NA
WP_011148187.1|4746050_4747496_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 26
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	4799568	4922642	5688987	plate,lysis,transposase	Catovirus(12.5%)	93	NA	NA
WP_011144722.1|4799568_4800453_+|transposase	IS982-like element ISPlu11 family transposase	transposase	NA	NA	NA	NA
WP_011148233.1|4802079_4803180_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_011148234.1|4803370_4803952_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_109791998.1|4803948_4804836_-	hypothetical protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	38.4	1.5e-21
WP_011148236.1|4805532_4805964_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	47.6	3.9e-28
WP_011148237.1|4806467_4807820_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_011148238.1|4807999_4809076_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	48.4	6.0e-09
WP_011148239.1|4809125_4810103_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	24.8	1.1e-22
WP_011148240.1|4810634_4811048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158536443.1|4811061_4811205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|4811365_4812391_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011148241.1|4813329_4815126_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.8	2.0e-17
WP_011148242.1|4815118_4815853_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011148243.1|4815869_4816262_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_011148244.1|4816278_4816632_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_011144786.1|4816834_4817719_+|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011148245.1|4817908_4818223_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_011148246.1|4818448_4819015_-	elongation factor P	NA	NA	NA	NA	NA
WP_011148247.1|4819052_4820081_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011148248.1|4820140_4820485_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011148249.1|4821268_4822177_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148250.1|4822823_4824470_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.7	1.8e-185
WP_011148251.1|4824519_4824813_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	1.4e-08
WP_011148252.1|4825010_4825499_-	FxsA family protein	NA	NA	NA	NA	NA
WP_011148253.1|4825876_4827301_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_011148254.1|4827441_4828743_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_011148255.1|4828927_4830655_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_041380362.1|4830672_4831245_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011148258.1|4832189_4841183_-	cytotoxin	NA	NA	NA	NA	NA
WP_011148259.1|4842061_4843321_-	arginase family protein	NA	NA	NA	NA	NA
WP_041380364.1|4843317_4844043_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011148261.1|4844035_4845889_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.4	4.3e-23
WP_011148262.1|4845897_4846335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157866909.1|4846485_4846791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148264.1|4846857_4850541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|4851038_4852064_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_041380367.1|4852624_4854292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380369.1|4854809_4855100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148265.1|4855315_4855780_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148266.1|4856041_4856656_+	LysE family translocator	NA	NA	NA	NA	NA
WP_125026256.1|4856997_4857309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145659.1|4857557_4857986_-|transposase	IS200/IS605-like element ISPlu2 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
WP_041381140.1|4858054_4859137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145659.1|4859527_4859956_+|transposase	IS200/IS605-like element ISPlu2 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
WP_162096543.1|4860011_4860200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148268.1|4860327_4861377_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_011148269.1|4861437_4862541_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	21.2	5.0e-19
WP_041380373.1|4863267_4863534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148270.1|4863572_4865078_-|transposase	IS66-like element ISPlu20 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	1.7e-89
WP_011144475.1|4865141_4865477_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_049789715.1|4865470_4865836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157866910.1|4865842_4866016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148271.1|4866096_4869228_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011148272.1|4869361_4874056_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011148273.1|4874150_4877051_-	insecticidal toxin complex protein TccA1	NA	NA	NA	NA	NA
WP_011148274.1|4877478_4877946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148275.1|4878054_4878522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148276.1|4878613_4879081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148277.1|4879190_4879652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148278.1|4879759_4880227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148279.1|4880335_4880803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148280.1|4880911_4881370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148281.1|4881366_4883028_-	S-type pyocin domain-containing protein	NA	A4PE23	Ralstonia_virus	48.1	3.6e-05
WP_011148282.1|4883428_4884352_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011148283.1|4884348_4885620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148284.1|4885649_4888055_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011148285.1|4888056_4889187_-	acyl-protein synthase	NA	NA	NA	NA	NA
WP_011148286.1|4890899_4893797_+	toxin	NA	NA	NA	NA	NA
WP_049789799.1|4894113_4895214_-	cytochrome P450	NA	NA	NA	NA	NA
WP_011148288.1|4896245_4896590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148289.1|4897233_4897935_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011148290.1|4898887_4900042_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011148291.1|4900061_4901504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148292.1|4901503_4903051_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.4	4.4e-13
WP_011148293.1|4903074_4903323_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_011148294.1|4903357_4904473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148295.1|4904465_4905752_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_011148296.1|4906403_4907219_-	cyclase family protein	NA	NA	NA	NA	NA
WP_011148297.1|4907211_4907925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148298.1|4907927_4908704_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011148299.1|4909678_4909996_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148300.1|4910086_4910500_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011148301.1|4911019_4911514_-	hypothetical protein	NA	A0A2L1IV91	Escherichia_phage	75.3	5.3e-29
WP_011148302.1|4911699_4913079_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011148303.1|4913130_4913565_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011148304.1|4913568_4914105_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_041380379.1|4914085_4915162_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011148306.1|4915125_4916892_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011148307.1|4916970_4918569_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_041380381.1|4918734_4919496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148310.1|4919688_4920690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125043791.1|4920766_4921054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144727.1|4921259_4922642_+|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
>prophage 27
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	5040237	5102153	5688987	tRNA,tail,transposase	Lactobacillus_prophage(11.76%)	53	NA	NA
WP_011144786.1|5040237_5041122_+|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011148410.1|5041962_5042175_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_011148411.1|5042174_5043050_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.5	3.8e-30
WP_011148412.1|5043965_5045522_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.1	4.3e-101
WP_114538532.1|5045527_5046616_+	restriction endonuclease subunit S	NA	A0A2H4UVW8	Bodo_saltans_virus	22.9	3.3e-07
WP_011148414.1|5046617_5047772_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011148415.1|5047797_5050914_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_011148417.1|5051685_5053311_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	48.9	6.1e-90
WP_011148418.1|5054140_5055013_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_011148419.1|5055210_5057196_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_011148420.1|5057198_5057681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148421.1|5057683_5058892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148422.1|5059324_5059582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148423.1|5059683_5059989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157866911.1|5060024_5060168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148425.1|5060496_5061606_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	1.6e-33
WP_011148426.1|5061728_5062577_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011148427.1|5063488_5063818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148429.1|5064177_5065650_+	carotenoid oxygenase family protein	NA	NA	NA	NA	NA
WP_011148430.1|5065884_5066787_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.9	1.0e-09
WP_049789804.1|5066809_5067232_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_011144786.1|5067244_5068129_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_082303141.1|5068246_5068837_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_011148431.1|5068950_5070126_+	lycopene beta-cyclase CrtY	NA	NA	NA	NA	NA
WP_011148432.1|5070118_5071600_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_011148433.1|5071596_5072523_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_011148434.1|5073286_5076445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148435.1|5076445_5077006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148436.1|5076995_5078321_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011148437.1|5078310_5079393_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011148439.1|5080306_5080843_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	8.9e-54
WP_011148440.1|5081201_5084036_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	5.2e-312
WP_011148441.1|5084096_5085035_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_011148442.1|5085037_5086123_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041381194.1|5086811_5086988_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	50.0	1.3e-09
WP_041380398.1|5087039_5087447_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	78.4	1.2e-50
WP_011148445.1|5087518_5087773_-	cloacin	NA	NA	NA	NA	NA
WP_011148446.1|5087821_5088835_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011148447.1|5089227_5090427_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011148448.1|5090476_5091556_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	1.3e-27
WP_011148449.1|5091595_5093005_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	76.8	2.7e-195
WP_011148450.1|5093175_5094159_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_011148451.1|5094369_5094747_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	54.4	1.6e-30
WP_158538253.1|5094724_5095357_-	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	44.0	1.7e-40
WP_011148452.1|5095363_5096389_-|transposase	IS630-like element ISPlu3 family transposase	transposase	NA	NA	NA	NA
WP_011148453.1|5096438_5096885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148454.1|5097465_5098503_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011148455.1|5098919_5099204_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	57.6	3.9e-24
WP_082303155.1|5099200_5099356_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	71.7	2.9e-10
WP_011148457.1|5099644_5099941_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041380399.1|5100143_5100722_-	VOC family protein	NA	NA	NA	NA	NA
WP_041380400.1|5100888_5101314_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	48.6	6.2e-26
WP_011148460.1|5101316_5102153_-|tail	tail fiber protein	tail	NA	NA	NA	NA
>prophage 28
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	5185076	5223433	5688987	integrase,holin,transposase	Phage_PS3(14.29%)	27	5215178:5215192	5224707:5224721
WP_011146066.1|5185076_5186102_-|transposase	IS630-like element ISPlu3 family transposase	transposase	NA	NA	NA	NA
WP_011148524.1|5186647_5186974_-|holin	phage holin family protein	holin	O80283	Phage_PS3	42.4	9.0e-17
WP_011148525.1|5187748_5188096_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162096544.1|5188298_5188661_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011144854.1|5188975_5189989_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011148527.1|5193037_5193559_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011148528.1|5193560_5194526_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_011148529.1|5194610_5196971_+	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_011148530.1|5197030_5197939_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_011148531.1|5197935_5198934_+	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.2	1.3e-10
WP_011148532.1|5198930_5199887_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_011148533.1|5199887_5200655_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W5SAS9	Pithovirus	28.5	2.3e-18
WP_041380409.1|5201183_5204495_+	helicase	NA	NA	NA	NA	NA
WP_011148535.1|5204662_5206765_+	RecQ family ATP-dependent DNA helicase	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	31.8	3.1e-41
WP_011148536.1|5206761_5208183_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_049789806.1|5208779_5209061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380411.1|5210411_5210834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148538.1|5211178_5212300_+	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	28.8	1.8e-16
WP_011148539.1|5212322_5214548_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_011148540.1|5214641_5215073_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	43.4	1.2e-24
5215178:5215192	attL	AAAGAGATAAAACGA	NA	NA	NA	NA
WP_011148541.1|5215486_5216752_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	33.3	3.8e-63
WP_011148542.1|5217248_5218241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148547.1|5220897_5221221_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011148548.1|5221204_5221564_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_125026260.1|5221666_5221894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125026261.1|5222071_5222251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148551.1|5222566_5223433_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
5224707:5224721	attR	AAAGAGATAAAACGA	NA	NA	NA	NA
>prophage 29
NC_005126	Photorhabdus laumondii subsp. laumondii TTO1, complete genome	5688987	5323659	5381222	5688987	plate,tRNA,protease,transposase	Lactococcus_phage(18.18%)	53	NA	NA
WP_011144720.1|5323659_5324685_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011148636.1|5325127_5325748_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011148637.1|5326018_5326735_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148638.1|5326771_5328082_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_049789808.1|5328092_5329280_-	MFS transporter	NA	NA	NA	NA	NA
WP_011148640.1|5329531_5331229_-	hypothetical protein	NA	E3SL39	Synechococcus_phage	29.2	1.6e-64
WP_011148641.1|5331252_5332056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148642.1|5332052_5333243_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011148643.1|5333232_5334261_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	39.0	1.5e-57
WP_011144786.1|5335047_5335932_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011148644.1|5336223_5336676_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5336714_5336942_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_011148645.1|5336946_5337264_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_011148646.1|5337269_5337665_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_011148647.1|5337968_5338703_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011148648.1|5338830_5341272_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.0	2.8e-62
WP_011148649.1|5341316_5341742_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_011148650.1|5341932_5343231_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.1	9.9e-67
WP_011148651.1|5343378_5344389_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011148652.1|5344394_5345615_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011148653.1|5345720_5347001_-	GTPase HflX	NA	NA	NA	NA	NA
WP_011148654.1|5347097_5347406_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_011148655.1|5347516_5348458_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_011148656.1|5348450_5350346_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.3	2.0e-60
WP_041380420.1|5350355_5351639_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.7	4.9e-18
WP_041381219.1|5352290_5353448_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011148660.1|5353934_5354129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148661.1|5354316_5354748_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_011148662.1|5354877_5355795_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148663.1|5355943_5357134_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011148664.1|5357152_5358148_+	DMT family transporter	NA	NA	NA	NA	NA
WP_109791896.1|5358411_5358723_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011148666.1|5359025_5359301_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011148667.1|5359300_5359633_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011148668.1|5360191_5360737_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	2.6e-29
WP_011148669.1|5360830_5361886_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_011148670.1|5361960_5362854_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_011148671.1|5362880_5366216_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_109791898.1|5366824_5368558_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011148674.1|5368572_5370549_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011148675.1|5370545_5371037_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	4.4e-15
WP_011148676.1|5371039_5371384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148677.1|5371385_5371994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148678.1|5372017_5372740_+	immunity 52 family protein	NA	NA	NA	NA	NA
WP_011148679.1|5372742_5373006_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	43.8	5.0e-10
WP_011148680.1|5373169_5373802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148681.1|5373850_5374585_+	immunity 52 family protein	NA	NA	NA	NA	NA
WP_011148682.1|5374587_5374851_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	41.2	2.5e-09
WP_011148683.1|5375014_5375641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148684.1|5375667_5376402_+	immunity 52 family protein	NA	NA	NA	NA	NA
WP_011148685.1|5378108_5378558_+	Ati1 family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_011148686.1|5378600_5380094_+	VPA0450 family T3SS effector inositol phosphatase	NA	NA	NA	NA	NA
WP_011148688.1|5380766_5381222_-|transposase	IS200/IS605-like element ISPlu5 family transposase	transposase	I4AZI8	Saccharomonospora_phage	36.4	2.3e-18
