The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	810	61040	3325165	tRNA,transposase	Sodalis_phage(16.67%)	53	NA	NA
WP_012548912.1|810_2178_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_012548913.1|2276_3902_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_081091604.1|3904_4162_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.5	1.6e-16
WP_012548914.1|4128_4482_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_012548915.1|4498_4633_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_012548916.1|4819_5557_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	7.7e-16
WP_012548917.1|5553_6225_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012548918.1|6379_7132_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012548919.1|7426_8833_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_012548920.1|8865_9975_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	29.0	1.8e-45
WP_012548921.1|9988_11068_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_012548922.1|11085_13503_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.0	1.3e-104
WP_012548923.1|14048_15239_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012548924.1|16294_16642_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012548925.1|16638_16953_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548926.1|17171_18809_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.2	2.0e-189
WP_012548927.1|18901_19189_-	co-chaperone GroES	NA	A0A221S331	uncultured_virus	38.7	8.4e-11
WP_012548928.1|19715_20909_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012548929.1|21268_21523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583140.1|21613_21763_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_012548930.1|22529_23489_+	DUF1738 domain-containing protein	NA	M1UGR4	Cyanophage	32.6	4.7e-29
WP_012548931.1|23915_25109_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012548932.1|25188_26034_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012548933.1|26436_26988_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_012548934.1|27381_27747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548935.1|27775_28180_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_012548936.1|28435_29215_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_012548937.1|29601_30555_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_012548938.1|30806_31769_-|transposase	ISNCY-like element ISVsa17 family transposase	transposase	Q2A0A7	Sodalis_phage	53.9	2.3e-68
WP_044583142.1|32177_32456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548940.1|33192_35412_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1L5C2A4	Pseudoalteromonas_phage	38.2	9.4e-25
WP_044583358.1|35519_35801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548941.1|35943_36303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012548942.1|36381_37035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012548943.1|37275_38466_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_158306875.1|39513_40041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548944.1|40118_41000_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012548945.1|41288_42239_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.7	8.6e-68
WP_012548946.1|42739_43933_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012548947.1|44866_46393_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_012548948.1|46480_47350_+	acyltransferase	NA	NA	NA	NA	NA
WP_173362133.1|47416_48016_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_012548950.1|48065_49049_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_012548951.1|49107_50526_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_012548952.1|50751_51015_-	YihD family protein	NA	NA	NA	NA	NA
WP_012548953.1|51532_52318_+	sporulation protein	NA	NA	NA	NA	NA
WP_012548954.1|52419_53067_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_012548955.1|53363_54557_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012548956.1|54710_54920_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	69.6	8.0e-19
WP_012548957.1|55197_56730_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_012548958.1|56734_58207_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_012548959.1|58233_58482_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_012548955.1|59846_61040_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	145901	205308	3325165	transposase,protease	Leptospira_phage(40.0%)	51	NA	NA
WP_012549007.1|145901_146783_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012548925.1|146903_147218_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|147214_147562_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549008.1|147633_149121_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_044583154.1|149311_151078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549010.1|151286_151856_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012549011.1|151959_153300_-	serine/threonine protein kinase	NA	A0A2H4UV96	Bodo_saltans_virus	30.1	5.0e-13
WP_012549012.1|153608_154199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549013.1|154285_155641_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_012549014.1|155853_156693_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_012549015.1|156845_158888_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.0	8.1e-39
WP_148234216.1|158961_160395_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_012549017.1|160522_160837_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_083199069.1|160918_161038_+	lipoprotein	NA	NA	NA	NA	NA
WP_012549018.1|161113_162367_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012549019.1|162448_163279_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_012549020.1|163275_163977_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_012549021.1|163969_164881_+	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	30.7	1.7e-17
WP_012548925.1|165049_165364_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_049940314.1|165360_165636_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	51.6	4.3e-12
WP_012549022.1|165724_166915_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012549023.1|167269_167860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173362126.1|167852_169328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549025.1|169899_171447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549026.1|171463_172792_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_012549027.1|172802_175262_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012549028.1|175285_177451_+	TonB-dependent siderophore bisucaberin receptor BitA	NA	NA	NA	NA	NA
WP_012549029.1|177569_178520_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012549030.1|178516_179617_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012549031.1|179606_180632_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012549032.1|180646_181453_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	3.7e-11
WP_012548925.1|181577_181892_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|181888_182236_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549008.1|182307_183795_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012549033.1|185315_186620_-	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.1	7.7e-43
WP_012549034.1|186732_187059_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.9e-17
WP_012549035.1|187297_188557_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_012549036.1|188700_189723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549037.1|189819_191661_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_012549038.1|191657_191921_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_012549039.1|192019_192730_+	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_083799278.1|194391_194658_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.0	3.1e-15
WP_012548925.1|194734_195049_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012549040.1|195362_197342_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_012549041.1|197378_198197_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	31.0	1.8e-18
WP_012549042.1|198489_199431_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	37.9	7.5e-32
WP_012549043.1|199601_200828_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_012549044.1|200824_201895_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_012549045.1|201888_203151_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_012549046.1|203197_204199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549047.1|204351_205308_-|transposase	IS30-like element ISVsa7 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	6.0e-45
>prophage 3
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	431803	496130	3325165	integrase,transposase,tRNA	uncultured_Caudovirales_phage(18.18%)	48	426304:426319	486172:486187
426304:426319	attL	AACGGTAAATGTGTTG	NA	NA	NA	NA
WP_085941781.1|431803_432809_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_049940322.1|432810_433170_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_044583165.1|433432_434494_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	37.6	5.8e-49
WP_012549222.1|434539_435601_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	29.5	2.0e-33
WP_012549223.1|435735_436806_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	42.9	4.1e-74
WP_012549224.1|437013_438030_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012549225.1|438148_438847_+	TIGR04219 family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_035470606.1|438992_439223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583167.1|439357_441181_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_012549228.1|441180_442911_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_012549229.1|442903_443665_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_044583168.1|443741_444209_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_012549231.1|444331_444952_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_012549232.1|445091_445754_+	acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_012549233.1|445765_446635_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012549234.1|446634_447087_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012549235.1|447152_447725_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012549236.1|447734_449507_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_044583169.1|449510_449966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044583170.1|450039_450459_-	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_012549239.1|450477_451224_-	NRDE family protein	NA	NA	NA	NA	NA
WP_044583171.1|451223_451766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549241.1|451783_452914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549242.1|452913_453504_-	DedA family protein	NA	NA	NA	NA	NA
WP_012549243.1|453630_454044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583172.1|454083_456054_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_012549245.1|456433_457342_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_012549246.1|457370_458807_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.1	3.6e-33
WP_012549247.1|458829_460557_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_012549248.1|460571_461204_+	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.5	5.4e-26
WP_012549249.1|461247_462144_-	TIGR03899 family protein	NA	NA	NA	NA	NA
WP_012549250.1|462467_462953_-	DUF3299 domain-containing protein	NA	NA	NA	NA	NA
WP_012549251.1|462962_464222_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012549252.1|464215_464905_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	9.1e-19
WP_012549253.1|464941_465583_-	DUF2796 domain-containing protein	NA	NA	NA	NA	NA
WP_012549254.1|465634_465925_-	DUF2607 family protein	NA	NA	NA	NA	NA
WP_012549255.1|465990_466542_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_012549256.1|466790_467000_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_012549257.1|467068_467719_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_012549258.1|467760_469482_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_012549259.1|469478_473276_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_012549149.1|484734_485046_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|485042_485390_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549088.1|485461_486949_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
486172:486187	attR	AACGGTAAATGTGTTG	NA	NA	NA	NA
WP_085941782.1|488215_489392_+|transposase	IS3-like element ISVsa11 family transposase	transposase	Q716C2	Shigella_phage	62.5	1.2e-111
WP_012549262.1|489667_490945_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	39.8	8.3e-42
WP_044583175.1|491137_494806_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	77.0	3.3e-22
WP_012548944.1|495248_496130_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	799057	859318	3325165	transposase,tail,tRNA,capsid,protease,head	Synechococcus_phage(12.5%)	58	NA	NA
WP_173362135.1|799057_799813_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_023603716.1|799917_800721_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_012549520.1|800929_801658_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_012549521.1|801763_802270_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_044583191.1|802301_803516_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	29.4	1.8e-30
WP_012549523.1|803549_803927_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	75.0	5.8e-52
WP_012549524.1|804047_804371_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	44.9	3.2e-22
WP_012549525.1|804386_804902_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_012549526.1|804937_806791_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.8	1.8e-106
WP_012549527.1|806793_807132_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_012549528.1|807260_807461_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_012549529.1|807698_808985_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.3	3.0e-31
WP_012549530.1|809073_809508_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.9	1.2e-19
WP_012549531.1|809738_810890_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_012549532.1|810886_811648_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_012549533.1|811637_812528_+	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
WP_012549534.1|812540_813659_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_044583192.1|813699_814968_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012549536.1|814979_815591_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012549537.1|815601_816759_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_012549538.1|816939_818442_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_012549539.1|818496_819372_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_012549540.1|819668_819905_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_012549541.1|819906_821241_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.6	7.1e-36
WP_012549542.1|821450_822914_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	4.5e-92
WP_012549543.1|823130_824684_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_012549544.1|824962_826522_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_012549545.1|826618_827254_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_012549546.1|827314_828592_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_012549547.1|828609_828999_-	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_012548944.1|830385_831267_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012549548.1|831700_832543_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012549549.1|832819_833968_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.4	1.4e-32
WP_012549550.1|834156_835029_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012549551.1|835030_835564_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_158007247.1|835643_835802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549552.1|835972_837457_-	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	36.8	1.2e-12
WP_012549553.1|837820_841750_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	55.6	3.3e-121
WP_012549554.1|841968_842460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023603700.1|842459_842660_+	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_012549556.1|842677_842953_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_012549557.1|843129_843645_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_012549558.1|843715_844252_+	DUF3332 family protein	NA	NA	NA	NA	NA
WP_012549559.1|844659_844986_+	DUF3622 domain-containing protein	NA	NA	NA	NA	NA
WP_012549560.1|845054_847595_-	chitinase	NA	A0A2K9L6L9	Tupanvirus	26.7	8.9e-19
WP_044583389.1|847828_848317_+	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_012549562.1|848386_849481_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_012549563.1|849440_850346_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D8KN85	Synechococcus_phage	31.7	8.8e-38
WP_012549564.1|850345_850786_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_012549565.1|851280_852645_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_148234217.1|854920_855136_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	1.1e-10
WP_012548925.1|855264_855579_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_068938164.1|855656_855806_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_012549566.1|855806_856337_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_012549567.1|856327_856801_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_044583390.1|856804_857254_-|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_012549569.1|857359_858394_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	42.9	9.1e-63
WP_012549570.1|858445_859318_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	47.5	5.5e-21
>prophage 5
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1064842	1171501	3325165	transposase,tail,portal,tRNA,head,capsid,plate,terminase,integrase	Vibrio_phage(59.09%)	106	1103351:1103410	1156003:1157624
WP_012549733.1|1064842_1066204_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012549734.1|1066205_1066727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549735.1|1066727_1069151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549736.1|1069144_1071484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012548944.1|1072344_1073226_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012549737.1|1074319_1075774_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_012549738.1|1076577_1077870_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.4	4.2e-65
WP_012549739.1|1077907_1078366_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012549740.1|1078524_1079766_+	esterase FrsA	NA	NA	NA	NA	NA
WP_012549741.1|1079930_1081040_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	3.0e-64
WP_044583209.1|1081055_1082312_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.4	7.1e-102
WP_012549743.1|1082413_1083379_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_035470463.1|1083371_1084049_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_012549745.1|1084195_1084465_-	YbeD family protein	NA	NA	NA	NA	NA
WP_012549746.1|1084620_1085796_-	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	45.7	5.2e-91
WP_012549747.1|1086078_1086888_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.4	4.1e-18
WP_012549748.1|1086891_1088013_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_012549749.1|1088012_1089890_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_012549750.1|1089893_1090364_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012549751.1|1090367_1090685_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_012549752.1|1090733_1091771_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_164998984.1|1091773_1092331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549754.1|1092573_1095150_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	8.6e-187
WP_012549755.1|1095317_1095800_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_012549756.1|1095870_1097376_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_012549757.1|1097467_1098343_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_012549758.1|1098412_1098874_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_012549759.1|1098895_1099966_-	PhoH family protein	NA	A0A1L2C8V4	Pseudomonas_phage	47.1	8.5e-48
WP_012549760.1|1100109_1101534_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_173362137.1|1101752_1102907_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_012548925.1|1103103_1103418_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
1103351:1103410	attL	GATTAACATTGCCAGCTAATACTGAACCTCACTGGATAGGACTCTTATTAAAAGGGTATC	NA	NA	NA	NA
WP_012548924.1|1103414_1103762_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012548955.1|1105137_1106331_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012549762.1|1107541_1108141_-	WHG domain-containing protein	NA	NA	NA	NA	NA
WP_044583211.1|1108366_1109266_+	TIM44-like domain-containing protein	NA	NA	NA	NA	NA
WP_012549764.1|1109412_1109643_+	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_012549765.1|1109643_1109895_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_044583407.1|1110054_1110495_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_012549767.1|1110597_1111641_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7RNH5	Vibrio_phage	76.0	1.1e-148
WP_012549768.1|1111703_1112492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549769.1|1112514_1113471_-	helix-turn-helix domain-containing protein	NA	A0A166YHA0	Vibrio_phage	47.7	6.0e-53
WP_012549770.1|1113643_1113844_+	hypothetical protein	NA	A0A2I7RNG9	Vibrio_phage	43.9	4.3e-06
WP_012549771.1|1113930_1114473_+	phage regulatory CII family protein	NA	U3PIJ8	Vibrio_phage	66.3	1.7e-60
WP_012549772.1|1114482_1114806_+	hypothetical protein	NA	U3PDF0	Vibrio_phage	38.5	2.5e-11
WP_129546081.1|1114882_1115356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549774.1|1115352_1115754_+	hypothetical protein	NA	R9TRR4	Vibrio_phage	52.6	1.5e-34
WP_012549776.1|1115884_1116157_+	hypothetical protein	NA	R9TR78	Vibrio_phage	56.3	9.7e-25
WP_012549777.1|1116159_1116390_+	hypothetical protein	NA	A0A2I7RNG5	Vibrio_phage	50.0	4.8e-17
WP_012549778.1|1116386_1116746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549779.1|1116745_1119259_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	49.1	2.5e-223
WP_044583212.1|1119271_1119751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549781.1|1119971_1120886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549782.1|1121086_1121341_+	hypothetical protein	NA	U3PDF9	Vibrio_phage	60.0	1.3e-10
WP_129546082.1|1121337_1121775_-	ogr/Delta-like zinc finger family protein	NA	A0A2I7RNG8	Vibrio_phage	58.4	5.7e-43
WP_012549784.1|1121867_1122902_-|portal	phage portal protein	portal	A0A2I7RNI9	Vibrio_phage	84.7	2.9e-170
WP_012549785.1|1122898_1124671_-|terminase	terminase	terminase	A0A2I7RNI3	Vibrio_phage	93.5	0.0e+00
WP_012549786.1|1124839_1125715_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2I7RNH1	Vibrio_phage	74.0	4.9e-102
WP_012549787.1|1125728_1126739_+|capsid	phage major capsid protein, P2 family	capsid	A0A2I7RNH6	Vibrio_phage	86.9	3.5e-168
WP_012549788.1|1126755_1127472_+|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	83.2	1.6e-114
WP_012549789.1|1127600_1127942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549790.1|1127934_1128399_+|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	51.3	8.5e-37
WP_012549791.1|1128395_1128920_+|tail	phage tail protein	tail	R9TRS7	Vibrio_phage	36.3	5.8e-26
WP_044583213.1|1128906_1129284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049940334.1|1129270_1129618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549792.1|1129636_1130749_+	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	54.9	2.1e-102
WP_012549793.1|1130748_1131204_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	60.3	6.6e-50
WP_012549794.1|1131215_1131431_+	TraR/DksA C4-type zinc finger protein	NA	A0A2I7RNJ6	Vibrio_phage	53.2	1.2e-09
WP_012549795.1|1131427_1131850_+	hypothetical protein	NA	A0A2I7RB50	Vibrio_phage	51.8	1.3e-31
WP_012549796.1|1131852_1132098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549797.1|1132100_1132340_+	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	51.3	1.8e-11
WP_012549798.1|1132336_1132600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549799.1|1132787_1134902_+|tail	phage tail tape measure protein	tail	R9TRA2	Vibrio_phage	55.2	9.9e-165
WP_012549800.1|1134898_1135225_+	DUF2590 family protein	NA	R9TMS7	Vibrio_phage	53.0	3.0e-20
WP_012549801.1|1135221_1136406_+|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	58.5	1.9e-120
WP_012549802.1|1136398_1136989_+	hypothetical protein	NA	A5X9J2	Aeromonas_virus	55.6	7.2e-57
WP_012549803.1|1136991_1139064_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	46.9	7.6e-69
WP_085941843.1|1139060_1139507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549805.1|1139506_1140400_+	hypothetical protein	NA	U3PIM3	Vibrio_phage	41.6	7.3e-53
WP_012549806.1|1140396_1140945_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	49.1	1.3e-28
WP_012549807.1|1140941_1142567_+	hypothetical protein	NA	R9TNN7	Vibrio_phage	44.4	1.5e-133
WP_012549808.1|1142568_1142766_+	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	66.2	1.8e-12
WP_012548944.1|1143100_1143982_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012549809.1|1144548_1144848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549810.1|1145098_1145938_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_012549811.1|1146100_1146595_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012549812.1|1146708_1147524_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_012549813.1|1147950_1148658_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012549814.1|1149432_1151238_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_012549815.1|1151257_1151485_-	YejL family protein	NA	NA	NA	NA	NA
WP_012549816.1|1151561_1152578_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	57.2	1.7e-101
WP_012549817.1|1152719_1153910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549818.1|1154091_1155579_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.5e-74
WP_012548924.1|1155650_1155998_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549819.1|1156365_1157490_+	ribonuclease D	NA	NA	NA	NA	NA
WP_012549820.1|1157565_1157826_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
1156003:1157624	attR	GATACCCTTTTAATAAGAGTCCTATCCAGTGAGGTTCAGTATTAGCTGGCAATGTTAATCTTTTGTTTCCATCGTGCTTTACGTGCACTAAATGTCTTTGGCAGAATATTATGGTTACGACAAAATTCAGCGGCACTAAGCTTGCTAGATTGCTGAGATTCAAATAGAGCGTGCCATTGCTCTGGTGTTCTCTTTTTATCTTTTTGCATAATTACGTTCTCGTTAAATGAAAGATCGTAAGATACGCATAATGAATTTTATTTGTTAGGTGTAGTTCCCCGCACGCTTACAGTTTTTCTAACGTTAAGCTATCTTGCCTTAGACCAATTAATAGAAGCGTTACAGATTTTTAAGGAAGAAATTGTGGAATTTGAAATCGTTAAACACAGCCAACGTTTAGCTGAAATTTGCCAACAGGCAAGTAATAAACCTTTTTTAATGCTGGATACTGAGTTCGTACGTACGAGAACTTTGTATGCACGTTTAGGTTTAATTCAAATGTTTGATGGTGAAACATTAGCATTAGTTGATCCTGTTGAAATTGATGATTTAACGCCGCTTTGGGATTTATTAAAAAACGAAAGTGTGACAAAAGTTCTTCATGCTTGTGGTGAAGATTTAGAAGTATTTCAACATTATGCTGGCTGTATGCCGACACCAATGATTGATACTCAAATTATGGCGGCATTTTTAGGCTATGGTTTGTCGACAGGCTTTGCGAAATTAGTGTCTGATTATTTAGGTGTTGATCTCGATAAAGGTGAATCTCGTACTGATTGGATGGCGCGTCCTTTATCAGATAAACAATTGGATTATGCCGCAGCCGATGTGCATTATTTATTACCATTGTTTGAGAAACTACAAGCAGAATTAGCTCAAACAGAGTGGGAAAAAGCAGCGTATCAAGAATCGTTACTTGCGGTTAAAAAACGTGAAAAACAACCTGATCCTGAGAAAGCGTATTTAGATATTAAAAATGCTTGGCAGTTAAATGGTAAGCAGTTAGCTATTTTAAAAATGGCAGCACAATGGCGATTAGAAGAAGCAAGAAAGCGCGATTTGGCGGTTAACTTTGTTGTACAAGAATTAAACTTATGGAAATTAGCTCGATTTGGACTTCGCAGTAAAGAGCAAATGCTAAAAGAAGAGTTTGATTCGAGAGAGGTTCAACGTCATGGTGGAAAACTATTGCGTTTCACATACCTTGCAGATGAGCTAAATGAAAACGAATATCCAGAAACGTTAACACGATTAATGGATTATCCGGGCTATAAGCAAATTTTTAAGTTGTTAAAAGATGAAGTAAAAGCGGCCTCTGATCAATCGGGTTTGATGCCTGAGTTTTTAGCGTCTAAAAAACAGCTTAATCAATTATTGTCTTGGAAATGGAAGAAAAACAGTCACCCTGATTTAAAACCAGACGTATTAAAAGAGTGGAGAGAAGGGCTGCTTGCTGAGCGCTTTATGGCGGTGTTAGATAAAAGCTAATCTCAATAAACAGAAACAAAAAAGGTGACTCTGATAGGTCACCTTTTTTATAGACTTTGATTAACGAAATAGTGTTTAATTATCGTCTTCTGGCAGAGTGATATTTAGCTCTAATACTGAGAGGTCTTCTTCTT	NA	NA	NA	NA
WP_012549821.1|1157828_1158641_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_012549822.1|1158664_1159330_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_012549823.1|1159541_1159823_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_012549824.1|1159824_1160799_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_012549825.1|1160920_1162963_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_012549826.1|1163083_1164295_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_012549827.1|1164454_1165585_+	4-phosphoerythronate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	30.1	1.1e-21
WP_012549828.1|1165584_1166598_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_044583214.1|1166631_1166814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549829.1|1166801_1170623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549830.1|1170712_1171501_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 6
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1214071	1271517	3325165	transposase,plate,protease	Acinetobacter_phage(37.5%)	47	NA	NA
WP_012549862.1|1214071_1215394_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012549863.1|1215405_1215894_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_044583218.1|1215927_1217217_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_012549865.1|1218904_1221523_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.4	4.3e-93
WP_044583219.1|1221519_1222548_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012549867.1|1222511_1224263_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012549868.1|1224259_1224685_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012549869.1|1224772_1226248_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012549870.1|1226251_1226746_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012549871.1|1226760_1228302_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012549872.1|1228553_1228763_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
WP_044583220.1|1228749_1229307_-	primosomal replication protein	NA	NA	NA	NA	NA
WP_012549874.1|1229340_1230111_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_012549875.1|1230177_1232262_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_012549876.1|1233859_1234483_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_012549877.1|1234970_1235969_+	porin	NA	NA	NA	NA	NA
WP_012549878.1|1236477_1237374_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012549879.1|1237379_1238675_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_012549880.1|1238689_1239730_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_012549881.1|1239807_1240881_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_012549882.1|1240889_1241504_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_012549883.1|1241618_1242356_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_012549884.1|1242337_1243111_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_012549885.1|1243107_1243728_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_012549886.1|1243865_1244357_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_012549887.1|1244481_1245168_+	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_012549888.1|1245164_1246130_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012549889.1|1246207_1246606_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_012549890.1|1246624_1246927_-	YciI family protein	NA	NA	NA	NA	NA
WP_026025295.1|1247049_1247460_-	acyl-CoA thioester hydrolase YciA	NA	A0A292GK23	Xanthomonas_phage	30.4	1.4e-06
WP_012549892.1|1247570_1248116_-	septation protein A	NA	NA	NA	NA	NA
WP_012549893.1|1249889_1250696_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_012549894.1|1250695_1251886_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_012549895.1|1251896_1253309_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.4	1.9e-34
WP_158306887.1|1253314_1254313_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.3	7.4e-54
WP_012549897.1|1254332_1254941_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	38.9	4.5e-30
WP_044583416.1|1254940_1256524_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_012549899.1|1256940_1257786_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_012549900.1|1257858_1258479_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_012549901.1|1258539_1261008_-	response regulator	NA	A0A2K9L1Q0	Tupanvirus	33.9	9.9e-07
WP_012549902.1|1261019_1262210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549903.1|1262543_1263608_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_012549904.1|1263712_1264453_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_012549905.1|1264619_1265681_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.5	2.6e-17
WP_012549906.1|1265753_1265999_-	YciN family protein	NA	NA	NA	NA	NA
WP_012549908.1|1266400_1269040_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	32.9	2.3e-86
WP_012548955.1|1270323_1271517_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1278702	1326340	3325165	plate,transposase	Leptospira_phage(40.0%)	45	NA	NA
WP_012549916.1|1278702_1280484_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012549917.1|1280465_1281449_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012549918.1|1281455_1284074_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.3	4.3e-85
WP_012549919.1|1284154_1284313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549920.1|1284375_1285320_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_129546083.1|1285331_1285781_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012549922.1|1285783_1287100_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012549923.1|1287107_1288232_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_049940337.1|1288233_1290672_+	IcmF-related protein	NA	NA	NA	NA	NA
WP_012549425.1|1290746_1292054_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_044583221.1|1292054_1293113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549924.1|1293109_1293727_+	type VI secretion protein VasX-1	NA	A0A1V0SBL5	Catovirus	37.3	1.2e-06
WP_012549925.1|1293880_1294516_-	LysE family translocator	NA	NA	NA	NA	NA
WP_173362138.1|1294732_1295566_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012549927.1|1295638_1296352_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_012549928.1|1296348_1296669_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_012549929.1|1296671_1297286_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012549930.1|1297497_1298334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012549931.1|1298405_1299218_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012549932.1|1299496_1300726_+	peptidase T	NA	NA	NA	NA	NA
WP_012549933.1|1300728_1302093_+	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_012549934.1|1302209_1303466_-	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	29.3	2.3e-44
WP_044583222.1|1303601_1304492_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012549936.1|1304768_1306163_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_012549937.1|1306259_1308137_+	transporter	NA	NA	NA	NA	NA
WP_012549938.1|1308199_1309102_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012549939.1|1309249_1310101_+	pirin family protein	NA	NA	NA	NA	NA
WP_012549940.1|1310163_1311135_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012549941.1|1311318_1311840_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_026025288.1|1311947_1312157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549943.1|1312373_1314290_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012549088.1|1314394_1315882_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
WP_012548924.1|1315952_1316300_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012548925.1|1316296_1316611_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_044583223.1|1316659_1317643_-	DUF2860 domain-containing protein	NA	NA	NA	NA	NA
WP_012549007.1|1317706_1318588_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012549944.1|1318899_1319895_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012549945.1|1319906_1321394_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012549946.1|1321383_1322226_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012549947.1|1322228_1322831_-	LysE family translocator	NA	NA	NA	NA	NA
WP_012549948.1|1323028_1323775_+	ALI family subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_012549949.1|1323926_1324475_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_012549950.1|1324484_1324712_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012549951.1|1324785_1325310_-	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_012548944.1|1325458_1326340_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1385663	1455925	3325165	tRNA,transposase,protease	Leptospira_phage(40.0%)	59	NA	NA
WP_012548944.1|1385663_1386545_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012548925.1|1387429_1387744_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|1387740_1388088_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549088.1|1388159_1389647_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
WP_012549995.1|1390095_1391400_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012549996.1|1392049_1393654_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.4	6.4e-23
WP_012549997.1|1393884_1394196_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	42.7	4.9e-12
WP_012549998.1|1394216_1394594_+	DNA-binding protein	NA	A0A222YXG1	Escherichia_phage	50.4	6.1e-25
WP_129546084.1|1395030_1396188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550000.1|1396331_1397294_-	phosphotransferase	NA	NA	NA	NA	NA
WP_012550001.1|1397326_1397785_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_012550002.1|1397880_1398354_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_012550003.1|1398516_1399893_+	alpha-amylase	NA	NA	NA	NA	NA
WP_049940344.1|1399999_1400443_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012548925.1|1400495_1400810_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|1400806_1401154_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012550004.1|1401225_1402713_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	3.3e-74
WP_083799286.1|1402625_1403384_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_012550005.1|1403517_1405509_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.2	1.7e-20
WP_012550006.1|1405806_1406157_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_012550007.1|1406224_1407622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550008.1|1407621_1408011_+	YcfL family protein	NA	NA	NA	NA	NA
WP_012550009.1|1408057_1408648_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_012550010.1|1408862_1412438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550011.1|1412440_1413328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550012.1|1413480_1413819_+	YggL family protein	NA	NA	NA	NA	NA
WP_012550013.1|1413902_1414646_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012550014.1|1414908_1415691_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_012550015.1|1415701_1416598_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012550016.1|1416607_1417630_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_012550017.1|1417790_1419131_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_012550018.1|1419147_1419978_+	phosphotransferase	NA	NA	NA	NA	NA
WP_012550020.1|1421217_1421769_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012550021.1|1422123_1423413_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012550022.1|1423586_1424891_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	33.0	2.0e-51
WP_012550023.1|1424900_1425347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548925.1|1425528_1425843_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_083799287.1|1425839_1426052_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.7	6.7e-05
WP_158306877.1|1426006_1426186_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.6	9.6e-05
WP_012550024.1|1429490_1430207_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_012550025.1|1430199_1431882_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	57.0	7.1e-166
WP_012550027.1|1432802_1432964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550028.1|1433271_1434147_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_012550029.1|1434290_1434785_+	DUF1456 family protein	NA	NA	NA	NA	NA
WP_012550030.1|1434876_1435389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550031.1|1435502_1436786_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012550032.1|1437216_1438626_+	amidohydrolase	NA	NA	NA	NA	NA
WP_012550033.1|1438826_1440365_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_012550034.1|1440530_1441082_+	YcbK family protein	NA	NA	NA	NA	NA
WP_012550035.1|1441204_1442605_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	36.6	3.4e-81
WP_012550036.1|1442861_1443224_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	36.1	6.9e-10
WP_085941796.1|1443278_1444256_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012550038.1|1444488_1445733_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_012550039.1|1445729_1449410_+	AAA family ATPase	NA	G3MAB6	Bacillus_virus	27.4	8.3e-10
WP_012550040.1|1449466_1449952_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012548955.1|1450388_1451582_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012550041.1|1452556_1453711_+	tyrosine transporter	NA	NA	NA	NA	NA
WP_044583230.1|1453793_1454966_+	tyrosine transporter	NA	NA	NA	NA	NA
WP_012548944.1|1455043_1455925_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1485913	1542980	3325165	transposase	Leptospira_phage(25.0%)	58	NA	NA
WP_012548944.1|1485913_1486795_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012550062.1|1487014_1487869_+	DNA ligase	NA	F2Y1N0	Organic_Lake_phycodnavirus	32.5	9.9e-31
WP_012550063.1|1487924_1488926_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012550064.1|1489001_1489919_-	ribokinase	NA	NA	NA	NA	NA
WP_012550065.1|1490099_1490978_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.6	5.1e-06
WP_017022796.1|1491114_1492101_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_012550067.1|1492097_1493612_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	2.9e-17
WP_012550068.1|1493672_1494092_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_012550069.1|1494475_1494637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550070.1|1494708_1495161_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_012550073.1|1496285_1496651_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_085941784.1|1496779_1497786_-|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_083799288.1|1497915_1498407_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_012550074.1|1498416_1499034_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_012550075.1|1499111_1500494_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012550076.1|1500752_1501364_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	36.5	3.7e-24
WP_012550077.1|1501379_1501583_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_012550078.1|1501812_1502679_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_012550079.1|1502923_1503259_+	DUF3802 family protein	NA	NA	NA	NA	NA
WP_012550080.1|1503334_1503823_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	1.1e-13
WP_012550081.1|1504125_1505718_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_012550082.1|1505860_1506550_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_012550083.1|1506585_1507389_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_012550084.1|1507475_1508219_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_012550085.1|1508345_1509254_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_012550086.1|1509378_1509711_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_012550087.1|1510486_1512079_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_129546042.1|1512079_1512886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550089.1|1513087_1513318_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_044583233.1|1513310_1513529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550090.1|1513834_1515616_-	bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_012550091.1|1515612_1516197_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_017022731.1|1516893_1517592_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012550093.1|1517595_1518417_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012550094.1|1520142_1522170_+	HAMP domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	5.8e-05
WP_012550095.1|1522196_1522598_+	VOC family protein	NA	NA	NA	NA	NA
WP_012550096.1|1522686_1522869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550097.1|1523085_1523517_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_012550098.1|1523868_1524600_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012550099.1|1524622_1525201_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_012550100.1|1526494_1527376_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012550101.1|1528351_1528810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550102.1|1528915_1529311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550103.1|1529361_1529850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083799289.1|1529921_1530089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012548925.1|1530170_1530485_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|1530481_1530829_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549088.1|1530900_1532388_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
WP_012550104.1|1534102_1534549_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012550105.1|1534589_1535009_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012550106.1|1535017_1535806_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012550107.1|1535829_1536660_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012550108.1|1536687_1536906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550109.1|1537499_1537976_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085941784.1|1538050_1539057_-|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_044583234.1|1539187_1539382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550111.1|1540075_1540750_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_012548955.1|1541786_1542980_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1553949	1601275	3325165	transposase	uncultured_Caudovirales_phage(37.5%)	46	NA	NA
WP_012548944.1|1553949_1554831_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012549008.1|1555100_1556588_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012550119.1|1556715_1557957_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_012548931.1|1558821_1560015_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_044583235.1|1560065_1561910_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	73.4	7.4e-15
WP_012550120.1|1562146_1563268_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	36.8	2.8e-09
WP_044583236.1|1563336_1565457_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044583237.1|1565542_1566382_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_012550123.1|1566535_1567543_+	DUF3305 domain-containing protein	NA	NA	NA	NA	NA
WP_012550124.1|1567749_1569426_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_012550125.1|1569430_1570042_+	molecular chaperone	NA	NA	NA	NA	NA
WP_012550126.1|1570120_1570318_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_012550127.1|1570329_1573185_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	22.7	3.1e-12
WP_012550128.1|1573196_1573805_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_012550129.1|1573821_1574841_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_012550130.1|1575086_1575620_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012550131.1|1575813_1576692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583238.1|1577386_1578010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548944.1|1578103_1578985_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012550132.1|1579164_1579944_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044583239.1|1579969_1580212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583240.1|1580233_1580713_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_044583241.1|1580871_1581411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941784.1|1581619_1582626_-|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_049940351.1|1582827_1583601_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.3	2.2e-21
WP_012550133.1|1583624_1583840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549047.1|1583875_1584832_-|transposase	IS30-like element ISVsa7 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	6.0e-45
WP_012535033.1|1585900_1586185_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	53.2	3.4e-20
WP_012550135.1|1586174_1586423_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012550136.1|1586715_1587504_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_012550137.1|1587525_1587978_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_044583243.1|1588059_1588503_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049940353.1|1588765_1589356_+	porin family protein	NA	NA	NA	NA	NA
WP_044583244.1|1589518_1589914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941784.1|1590019_1591025_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_044583245.1|1591032_1592025_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_129546086.1|1592619_1592919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550142.1|1592964_1593717_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	33.7	6.7e-23
WP_012550143.1|1593891_1594086_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_173362129.1|1594165_1594876_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012550145.1|1595113_1595812_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_012550146.1|1596112_1596643_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_012550147.1|1596737_1597091_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_012550148.1|1597366_1598788_+	DUF3859 domain-containing protein	NA	NA	NA	NA	NA
WP_012550149.1|1599130_1599523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941784.1|1600269_1601275_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1684329	1737788	3325165	tRNA,transposase	Leptospira_phage(25.0%)	55	NA	NA
WP_012550223.1|1684329_1685253_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	75.9	6.5e-113
WP_012548925.1|1685409_1685724_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|1685720_1686068_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549008.1|1686139_1687627_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012550224.1|1687650_1688304_-	DUF2987 domain-containing protein	NA	NA	NA	NA	NA
WP_012550225.1|1688305_1689043_-	glucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_012550226.1|1689050_1689860_-	membrane protein	NA	NA	NA	NA	NA
WP_012550227.1|1690196_1691315_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.0	6.4e-30
WP_012550228.1|1691298_1692156_+	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_012550229.1|1692155_1692926_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_173362139.1|1693018_1694068_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012550231.1|1694250_1695294_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012550232.1|1695382_1696096_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.9e-20
WP_012550233.1|1696299_1697211_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012550234.1|1697450_1698671_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.5	2.1e-18
WP_012550235.1|1698751_1699042_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012550236.1|1699159_1699471_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012550237.1|1699483_1700140_-	QnrAS family quinolone resistance pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_012550238.1|1700574_1700991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550240.1|1701632_1701962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550241.1|1701979_1702384_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012550242.1|1702527_1703538_+	hydrolase	NA	NA	NA	NA	NA
WP_012550243.1|1703555_1704059_-	YgjV family protein	NA	NA	NA	NA	NA
WP_158306888.1|1704212_1706138_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	37.3	5.9e-15
WP_012550245.1|1706246_1706543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550246.1|1706724_1708062_+	polysaccharide deacetylase family protein	NA	M1I5W9	Paramecium_bursaria_Chlorella_virus	24.7	4.7e-11
WP_012550247.1|1708106_1708508_-	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
WP_012548944.1|1708786_1709668_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012550248.1|1710844_1711087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583258.1|1711175_1711502_+	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_012548944.1|1711526_1712408_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012550249.1|1712534_1712927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550250.1|1713041_1714034_-	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
WP_012550251.1|1714288_1715311_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012550252.1|1715447_1716902_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_012550253.1|1716911_1718084_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_044583259.1|1718164_1719001_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012550255.1|1719059_1719956_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012550256.1|1720036_1721143_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_012550257.1|1721142_1722312_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_012550258.1|1722393_1723971_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_085941784.1|1724093_1725099_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012550259.1|1725339_1726362_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_012550260.1|1726445_1727318_-	DMT family transporter	NA	NA	NA	NA	NA
WP_085941784.1|1727438_1728444_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012550261.1|1728577_1728988_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012550262.1|1729422_1730166_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012550263.1|1730342_1730993_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_012550264.1|1731256_1731661_+	VOC family protein	NA	NA	NA	NA	NA
WP_012550265.1|1731712_1732441_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_012550266.1|1732608_1733025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550267.1|1733065_1734028_+	arsenosugar biosynthesis radical SAM protein ArsS	NA	NA	NA	NA	NA
WP_012550268.1|1734709_1735324_+	TIGR04282 family arsenosugar biosynthesis glycosyltransferase	NA	NA	NA	NA	NA
WP_044583442.1|1735364_1736681_+	sodium:proline symporter	NA	NA	NA	NA	NA
WP_085941784.1|1736782_1737788_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1741944	1788784	3325165	tRNA,transposase	Leptospira_phage(66.67%)	51	NA	NA
WP_012549047.1|1741944_1742901_+|transposase	IS30-like element ISVsa7 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	6.0e-45
WP_044583260.1|1743095_1743371_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_012550273.1|1743367_1743871_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012550274.1|1744159_1744405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550275.1|1744394_1744658_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_129546088.1|1744837_1745896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550277.1|1745948_1746257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550278.1|1746238_1746901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550279.1|1747081_1747396_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_023603298.1|1747382_1747715_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044583261.1|1747923_1748373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550282.1|1748537_1748993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550283.1|1749137_1749884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550285.1|1750560_1751307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012548944.1|1751426_1752308_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_158306878.1|1752412_1752619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012549601.1|1753064_1753376_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|1753372_1753720_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549008.1|1753791_1755279_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012550286.1|1756763_1757726_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_012550287.1|1757740_1758046_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012550288.1|1758056_1758377_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_158306879.1|1758413_1758566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012548925.1|1758748_1759063_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|1759059_1759407_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549088.1|1759478_1760966_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
WP_012550289.1|1761155_1761431_+	DUF3081 domain-containing protein	NA	NA	NA	NA	NA
WP_012550290.1|1761433_1761961_+	CIA30 family protein	NA	NA	NA	NA	NA
WP_012550291.1|1761997_1762663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550292.1|1763022_1763442_+	Hsp20 family protein	NA	A0A1D8KPX5	Synechococcus_phage	30.9	3.5e-13
WP_012550293.1|1763656_1765555_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.4	1.5e-140
WP_012549601.1|1765749_1766061_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|1766057_1766405_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549008.1|1766476_1767964_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012550294.1|1768021_1768630_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_012550295.1|1768822_1769839_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_012550296.1|1769970_1770141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550297.1|1770233_1770923_-	aquaporin Z	NA	NA	NA	NA	NA
WP_129546047.1|1771571_1772036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550299.1|1772085_1773774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550300.1|1775607_1777032_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_129546048.1|1777036_1777387_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_012548955.1|1777580_1778774_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012550303.1|1779189_1780098_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_012550304.1|1780152_1781319_-|tRNA	glutamyl-tRNA(Gln) amidotransferase	tRNA	NA	NA	NA	NA
WP_012550305.1|1781537_1782713_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_044583262.1|1782911_1784102_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_012550307.1|1784224_1785415_-	methyltransferase	NA	NA	NA	NA	NA
WP_012550308.1|1785449_1786424_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_012550309.1|1786701_1787466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548944.1|1787902_1788784_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	1802252	1875639	3325165	integrase,transposase,tRNA,protease	Leptospira_phage(23.08%)	51	1826967:1826990	1859970:1859993
WP_012550319.1|1802252_1803134_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_129546049.1|1803582_1803990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550320.1|1804058_1804385_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A060BH02	Podovirus	33.7	4.0e-09
WP_012550321.1|1804403_1804676_-	acylphosphatase	NA	NA	NA	NA	NA
WP_012548943.1|1805104_1806295_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012550322.1|1806798_1807989_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_148234222.1|1818131_1821290_-	retention module-containing protein	NA	NA	NA	NA	NA
WP_012550323.1|1821512_1821863_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_012550324.1|1821977_1823036_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_044583267.1|1823159_1824524_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_012548925.1|1824757_1825072_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012549126.1|1825068_1825416_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
1826967:1826990	attL	AGGTGTAGTTCCCCGCACGCTTAC	NA	NA	NA	NA
WP_012550326.1|1827459_1828080_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_012549022.1|1828913_1830104_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012550328.1|1830386_1831628_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	48.9	4.8e-111
WP_012549047.1|1832986_1833943_-|transposase	IS30-like element ISVsa7 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	6.0e-45
WP_044583452.1|1834850_1835684_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012550330.1|1835773_1837129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012550331.1|1837281_1838166_-	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
WP_012550332.1|1838387_1839440_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	46.0	1.8e-82
WP_012550333.1|1839455_1839938_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_012550334.1|1840007_1841789_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_012550335.1|1841898_1842912_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_012550336.1|1843114_1843411_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	4.9e-14
WP_012550337.1|1843934_1846322_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.3	1.6e-06
WP_012550338.1|1846339_1847323_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.7	3.1e-36
WP_044583268.1|1847686_1849852_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_085941784.1|1850438_1851444_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012550339.1|1852071_1852803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044583269.1|1852832_1853564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550341.1|1853550_1854279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148234223.1|1854271_1854895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049940370.1|1854949_1857565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550342.1|1857561_1858416_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_012548925.1|1860050_1860365_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
1859970:1859993	attR	GTAAGCGTGCGGGGAACTACACCT	NA	NA	NA	NA
WP_012548924.1|1860361_1860709_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549008.1|1860780_1862268_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012550343.1|1863103_1863634_-	heme utilization protein HutZ	NA	NA	NA	NA	NA
WP_012550344.1|1863659_1864166_-	heme utilization cystosolic carrier protein HutX	NA	NA	NA	NA	NA
WP_044583271.1|1864186_1865551_-	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_012550346.1|1866456_1867137_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_012550347.1|1867136_1867562_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_044583272.1|1867539_1868424_+	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012550349.1|1868427_1869465_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012550350.1|1869461_1870244_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	1.4e-15
WP_012550351.1|1870334_1870688_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_012550352.1|1870729_1870924_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_012550353.1|1871031_1871583_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.0	2.9e-15
WP_012550354.1|1871586_1873515_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	8.0e-129
WP_012550355.1|1873743_1874490_-	sporulation protein	NA	NA	NA	NA	NA
WP_012550356.1|1874556_1875639_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 14
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	2135105	2198878	3325165	transposase	Leptospira_phage(33.33%)	47	NA	NA
WP_012548944.1|2135105_2135987_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012550552.1|2136896_2137670_+	phospholipase A	NA	NA	NA	NA	NA
WP_012550553.1|2137807_2138452_+	formate-dependent nitrite reductase complex NrfG subunit	NA	NA	NA	NA	NA
WP_012550554.1|2138552_2139989_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_012550555.1|2140481_2141075_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_012550556.1|2141076_2141763_+	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_012550557.1|2141764_2142721_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_012550558.1|2142794_2144681_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_012550559.1|2144677_2145205_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_012550560.1|2145204_2145660_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_012550561.1|2145662_2146376_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_012550562.1|2146410_2147712_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_012550563.1|2148039_2148921_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012550564.1|2148917_2149679_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012548924.1|2152274_2152622_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012548925.1|2152618_2152933_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548944.1|2157060_2157942_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_173362141.1|2158772_2160326_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_012550566.1|2160395_2161100_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_012550567.1|2161266_2162472_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_012550568.1|2162472_2163162_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_012550569.1|2164795_2166175_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012550570.1|2166289_2166961_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	9.5e-29
WP_012550571.1|2166941_2169395_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012550572.1|2169394_2170516_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_012550573.1|2170672_2171821_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	54.5	5.6e-98
WP_012549425.1|2171878_2173186_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012550574.1|2173802_2175005_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_012550575.1|2175148_2176831_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_012550576.1|2176976_2177240_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	74.4	3.5e-27
WP_012550577.1|2177491_2178346_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012550578.1|2178697_2180341_-	putative pyridoxal-dependent aspartate 1-decarboxylase	NA	S4W1T5	Pandoravirus	25.8	3.0e-20
WP_012550579.1|2180519_2181032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550581.1|2182126_2183053_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_085941784.1|2183808_2184815_-|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012550582.1|2185048_2185600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012550583.1|2185905_2187207_+	DUF945 family protein	NA	NA	NA	NA	NA
WP_012550584.1|2187396_2188479_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	2.5e-87
WP_012549008.1|2188556_2190044_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012548924.1|2190115_2190463_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012548925.1|2190459_2190774_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_023603484.1|2191657_2192140_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012550586.1|2192148_2193606_+	phosphatase PAP2 family protein	NA	A0A1L6UW58	Biomphalaria_virus	39.7	3.2e-05
WP_012550587.1|2193661_2194351_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012550588.1|2194500_2195376_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_044583294.1|2195377_2197729_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012548944.1|2197996_2198878_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	2380543	2438347	3325165	tRNA,protease,transposase	Leptospira_phage(33.33%)	52	NA	NA
WP_012550729.1|2380543_2380864_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.2	2.6e-13
WP_012550730.1|2380906_2383159_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	7.0e-169
WP_005420180.1|2383272_2383491_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012550731.1|2383580_2384273_-	arginyltransferase	NA	NA	NA	NA	NA
WP_012550732.1|2384276_2384987_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_012550733.1|2385185_2386469_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_012550734.1|2386624_2387299_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_012550735.1|2387395_2389069_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_012550736.1|2389128_2389410_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	34.4	1.0e-08
WP_012550737.1|2389598_2389883_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_012550738.1|2389890_2391060_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_012550739.1|2391115_2391820_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_012550740.1|2391896_2393957_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	30.4	2.0e-61
WP_012550741.1|2394089_2395157_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_012550742.1|2395268_2395916_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.5	6.7e-32
WP_012550743.1|2396080_2398240_+	AsmA family protein	NA	NA	NA	NA	NA
WP_012550744.1|2398308_2398911_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_012550746.1|2400551_2402099_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.8	9.0e-91
WP_012550747.1|2402273_2405321_-	ribonuclease E	NA	NA	NA	NA	NA
WP_012550748.1|2405764_2406712_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_012550749.1|2406790_2407372_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_012550750.1|2407505_2408027_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_012550751.1|2408043_2408214_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_012550752.1|2408224_2409250_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_012550753.1|2409255_2410209_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_012550754.1|2410269_2411193_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_044583480.1|2411212_2411947_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	8.5e-15
WP_017022099.1|2412115_2412349_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	3.8e-09
WP_012550756.1|2412441_2413683_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_012550757.1|2413781_2414588_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_012550758.1|2414581_2415592_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_012550759.1|2415594_2416227_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	34.0	2.5e-23
WP_012550760.1|2416216_2417188_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_012550761.1|2417189_2417960_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_012548925.1|2418148_2418463_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|2418459_2418807_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012550762.1|2418878_2420366_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.0	7.4e-74
WP_012548944.1|2420805_2421687_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012550763.1|2421737_2423168_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012550764.1|2423226_2423868_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_017022092.1|2423943_2424039_-	MetS family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_012550765.1|2424040_2425507_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_012550766.1|2425888_2426470_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017022089.1|2426621_2426711_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_012550767.1|2430851_2431079_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_012550768.1|2431080_2433357_+	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_012550769.1|2433353_2433596_+	FeoC-like transcriptional regulator	NA	NA	NA	NA	NA
WP_012548925.1|2433748_2434063_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|2434059_2434407_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549088.1|2434478_2435966_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
WP_129546060.1|2435883_2436600_-	hypothetical protein	NA	A0A1J0GUY9	Halomonas_phage	26.0	6.0e-05
WP_012550770.1|2436859_2438347_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.9e-74
>prophage 16
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	2684814	2695358	3325165	tRNA	uncultured_Mediterranean_phage(25.0%)	12	NA	NA
WP_044583323.1|2684814_2685462_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FFL6	Cedratvirus	33.5	4.2e-18
WP_012550977.1|2685454_2686081_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_012550978.1|2686175_2687141_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.6	5.2e-36
WP_012550979.1|2687196_2688189_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	33.7	3.7e-05
WP_012550980.1|2688195_2688822_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.9	7.7e-33
WP_044583495.1|2688821_2689577_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	2.1e-64
WP_012550982.1|2689616_2690663_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_012550983.1|2690677_2691157_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_012550984.1|2691153_2691873_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	27.1	1.7e-07
WP_012550985.1|2691876_2692161_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_012550986.1|2692342_2693641_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.6	1.1e-134
WP_012550987.1|2693717_2695358_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.1	7.4e-152
>prophage 17
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	2931787	2992031	3325165	tRNA,transposase,protease	Leptospira_phage(53.85%)	52	NA	NA
WP_012551158.1|2931787_2933275_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.5e-74
WP_012548924.1|2933346_2933694_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012548925.1|2933690_2934005_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012551159.1|2934249_2936124_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_012551160.1|2936276_2936540_-	DUF3624 domain-containing protein	NA	NA	NA	NA	NA
WP_012551161.1|2936667_2938134_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_012551162.1|2938223_2938952_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.3	5.1e-44
WP_012551163.1|2939131_2940040_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_012551164.1|2940106_2942605_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_012551165.1|2942743_2943742_+	type IV pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_012551166.1|2943726_2944296_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_012551167.1|2944288_2944870_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_012551168.1|2944862_2945381_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_012549007.1|2946773_2947655_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012551169.1|2948360_2948879_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_012551170.1|2948917_2950006_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_012551171.1|2950009_2951527_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012551172.1|2951598_2952429_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	1.5e-71
WP_012551173.1|2952551_2953229_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_012551174.1|2953234_2953918_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_012551175.1|2954037_2955054_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012551176.1|2955150_2955729_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.6	4.4e-67
WP_012548925.1|2955954_2956269_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|2956265_2956613_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549088.1|2956684_2958172_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
WP_012551177.1|2958359_2959574_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.5	9.4e-27
WP_044583334.1|2959738_2960755_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_012551179.1|2960767_2962225_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012551180.1|2962237_2963032_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_005421074.1|2963116_2963749_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_012551181.1|2963994_2964396_+	OsmC family protein	NA	NA	NA	NA	NA
WP_012551182.1|2964468_2965803_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.1e-41
WP_012551183.1|2965815_2966346_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012551184.1|2966524_2967094_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012551185.1|2967265_2968273_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_012551186.1|2968476_2970678_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_012551187.1|2970933_2971152_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_012551188.1|2971384_2972632_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_012551189.1|2972972_2973293_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_012551190.1|2973480_2974647_+	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
WP_012551191.1|2974646_2977067_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_012551192.1|2977408_2978383_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_012551193.1|2978630_2980466_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.5	1.2e-41
WP_012548925.1|2980852_2981167_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|2981163_2981511_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012549818.1|2981582_2983070_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.5e-74
WP_012551194.1|2983187_2985818_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_012551195.1|2985995_2987132_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_012551196.1|2987338_2988343_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_044583335.1|2988358_2989138_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_012551198.1|2989205_2990417_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_012549088.1|2990543_2992031_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
>prophage 18
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	3060370	3115178	3325165	tRNA,transposase	Feldmannia_species_virus(12.5%)	44	NA	NA
WP_012549425.1|3060370_3061678_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_023604486.1|3061884_3062151_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_012551259.1|3062161_3063865_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_012551260.1|3063959_3067406_-	sensor histidine kinase	NA	B5LWA6	Feldmannia_species_virus	26.4	4.9e-12
WP_044583500.1|3067538_3068684_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_012551262.1|3068889_3070722_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012551263.1|3070723_3071356_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_012551264.1|3071561_3073511_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	3.5e-84
WP_012551265.1|3073969_3074419_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_012551266.1|3074449_3074905_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_012551267.1|3074917_3076261_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_012551268.1|3076377_3077262_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_049940420.1|3077430_3078426_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005421285.1|3078448_3078745_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_023604480.1|3078884_3079187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012551271.1|3079277_3079697_-	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012551272.1|3079981_3081574_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.3	9.6e-72
WP_012551273.1|3081755_3083048_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012549425.1|3083181_3084489_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012551274.1|3084534_3085239_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_012551275.1|3085278_3085551_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	59.6	2.9e-21
WP_012551276.1|3085773_3086835_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012551277.1|3086931_3087525_-	DUF416 family protein	NA	NA	NA	NA	NA
WP_012551278.1|3087596_3088511_+	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_012551279.1|3088551_3089007_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_012551280.1|3089203_3090271_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_012551281.1|3091003_3092197_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_026025616.1|3092851_3093334_+	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_012551283.1|3094232_3094634_-	curli production assembly protein CsgF	NA	NA	NA	NA	NA
WP_012551284.1|3094643_3095105_-	curli production assembly protein CsgE	NA	NA	NA	NA	NA
WP_012551285.1|3095101_3095749_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085941784.1|3096148_3097155_-|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012548944.1|3097956_3098838_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012551286.1|3099391_3100336_+	curlin associated precursor, CsgA like	NA	NA	NA	NA	NA
WP_012551287.1|3100410_3104616_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	9.1e-69
WP_012551288.1|3104687_3108716_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.6	6.1e-22
WP_012551289.1|3108947_3109313_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_012551290.1|3109368_3109863_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_012551291.1|3110108_3110813_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_012551292.1|3110817_3111246_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_012551293.1|3111365_3111911_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.0	2.9e-12
WP_012551294.1|3111923_3112301_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_012549148.1|3112530_3113715_-	elongation factor Tu	NA	D0UIL0	Aggregatibacter_phage	78.1	5.8e-05
WP_012548944.1|3114296_3115178_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NC_011312	Aliivibrio salmonicida LFI1238 chromosome 1, complete sequence	3325165	3205840	3269529	3325165	tRNA,transposase	uncultured_Mediterranean_phage(20.0%)	55	NA	NA
WP_012549425.1|3205840_3207148_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012551365.1|3207538_3208786_-	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_012551366.1|3209004_3209937_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_012551367.1|3209939_3212006_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012551368.1|3212150_3213815_+	alpha-amylase	NA	NA	NA	NA	NA
WP_012551369.1|3213953_3214214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551370.1|3214246_3214498_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	77.8	2.6e-08
WP_012548931.1|3214659_3215853_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012551371.1|3216113_3216305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551372.1|3216465_3217407_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012551373.1|3217529_3218510_-	oxidoreductase	NA	NA	NA	NA	NA
WP_012551374.1|3219284_3220448_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_012551375.1|3220461_3222642_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_012551376.1|3222884_3223499_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.5	1.6e-22
WP_012551377.1|3223556_3225014_+	potassium transporter	NA	NA	NA	NA	NA
WP_012551378.1|3225041_3225566_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_012551380.1|3226205_3228962_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	9.6e-11
WP_012551381.1|3229063_3229258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551382.1|3229349_3229730_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	5.6e-10
WP_012551383.1|3229911_3230334_+	universal stress protein	NA	NA	NA	NA	NA
WP_012551384.1|3230775_3232722_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_012551385.1|3232794_3233475_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_012551386.1|3233467_3234316_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_012551387.1|3234308_3234521_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012551388.1|3234522_3235293_+	thiazole synthase	NA	NA	NA	NA	NA
WP_012551389.1|3235315_3236428_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_012551390.1|3236552_3238976_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012551391.1|3239241_3241035_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	34.3	3.5e-94
WP_012551392.1|3241115_3242081_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012551393.1|3242185_3243391_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_012551394.1|3243511_3243796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551395.1|3243866_3244778_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012551396.1|3244905_3246426_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	79.2	1.4e-14
WP_012551397.1|3246485_3247250_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_012551398.1|3247262_3247886_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_012551399.1|3247882_3249514_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	G9E4X0	Ostreococcus_lucimarinus_virus	27.0	4.1e-33
WP_012551400.1|3249569_3249818_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_012551401.1|3249821_3250199_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_012551402.1|3250201_3250957_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.3	4.8e-29
WP_012548944.1|3251157_3252039_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_044583347.1|3253912_3254674_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012551404.1|3254842_3255859_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_012549325.1|3256156_3256426_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|3256422_3256770_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.2	7.1e-20
WP_012551405.1|3258779_3259088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551406.1|3259571_3260684_+|transposase	ISAs1-like element ISVsa13 family transposase	transposase	NA	NA	NA	NA
WP_012551407.1|3260888_3261512_+	acetyltransferase	NA	NA	NA	NA	NA
WP_012551408.1|3261536_3262577_+	N-acetylneuraminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	35.0	5.2e-34
WP_012551409.1|3262581_3263835_+	N-acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012551410.1|3263834_3265001_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_044583348.1|3265014_3266274_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_012551412.1|3266266_3267163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158306885.1|3267429_3268269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083799300.1|3268403_3269036_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_129546075.1|3269016_3269529_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	7795	96307	1206461	transposase,protease,tRNA	Leptospira_phage(36.36%)	54	NA	NA
WP_012548944.1|7795_8677_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_044583515.1|8680_9043_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012551456.1|10762_12406_-	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_012551457.1|12518_14438_-	RecQ family ATP-dependent DNA helicase	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	36.1	1.7e-59
WP_012551458.1|14437_14851_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012551459.1|14937_15294_+	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
WP_173362147.1|15534_16461_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_012551461.1|16638_17757_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012551462.1|18607_19798_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012551463.1|19930_20536_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012551464.1|20538_21861_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_044583617.1|22395_31047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551466.1|31163_31799_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012549088.1|32122_33610_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.5e-74
WP_012548924.1|33681_34029_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012551467.1|34582_35080_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_012551468.1|35193_36138_-	TerC/Alx family metal homeostasis membrane protein	NA	I7HPH5	Enterobacteria_phage	33.8	9.2e-38
WP_012551469.1|36528_37692_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012549008.1|41154_42642_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012548924.1|42713_43061_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012548925.1|43057_43372_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012551470.1|44607_45717_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012551471.1|45893_46502_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012551472.1|46583_47504_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_012551473.1|47610_50316_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
WP_012551474.1|50712_53166_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	3.7e-14
WP_012551475.1|53223_55404_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_044583519.1|55457_57641_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_012548944.1|57715_58597_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012551476.1|58696_59011_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|59007_59355_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012549008.1|60912_62400_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012548924.1|62471_62819_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012548925.1|62815_63130_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012551477.1|63563_66209_-	carbohydate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012551478.1|66734_67235_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_012551479.1|67914_68814_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.1	1.6e-15
WP_012551480.1|68852_71309_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.5	1.5e-42
WP_012551481.1|71441_78503_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_044583522.1|78682_79012_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_012551483.1|79066_80395_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012551484.1|80401_82627_+	response regulator	NA	NA	NA	NA	NA
WP_012551485.1|82626_83997_+	TolC family protein	NA	NA	NA	NA	NA
WP_012551486.1|83993_85577_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_012551487.1|85577_87731_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.1	6.2e-13
WP_012551488.1|87781_88576_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012551489.1|88568_90053_-	DUF3131 domain-containing protein	NA	NA	NA	NA	NA
WP_012551490.1|90231_91932_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	36.2	4.4e-22
WP_012551491.1|91946_93236_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012551492.1|93245_93488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551493.1|93523_94282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551494.1|94417_94579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012551495.1|94575_94767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012551496.1|94819_96307_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.9	4.5e-79
>prophage 2
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	105882	154305	1206461	transposase,integrase	Leptospira_phage(33.33%)	42	118419:118478	155995:156796
WP_012549008.1|105882_107370_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012548924.1|107441_107789_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012551505.1|108267_109188_-	permease	NA	NA	NA	NA	NA
WP_012551506.1|109325_110519_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012551507.1|110721_110889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551509.1|111424_111577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551510.1|111581_111908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551511.1|112005_112983_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_012551512.1|113253_114390_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_012551513.1|114393_115371_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_012551514.1|115401_117141_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_044583526.1|117845_118451_+	LysE family translocator	NA	NA	NA	NA	NA
118419:118478	attL	GTAAGCGTGCGGGGAACTACACCTAACAAATAAAATTCATTATGCGTATCTTACGATCTT	NA	NA	NA	NA
WP_012548925.1|118499_118814_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|118810_119158_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012548944.1|119314_120196_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012551496.1|120236_121724_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.9	4.5e-79
WP_012551516.1|122302_123475_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044583528.1|124529_125636_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_012551519.1|125863_127009_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_012551520.1|127078_127834_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	45.4	4.0e-52
WP_173362145.1|128121_129027_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	68.8	7.1e-104
WP_012548923.1|129528_130719_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012548955.1|130964_132158_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012551522.1|135156_137238_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012551523.1|137338_138106_+	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_012551524.1|138107_139463_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_012551525.1|139462_139972_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_012551526.1|139968_140373_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_012551527.1|140372_140993_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_012551528.1|140989_142192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548955.1|142367_143561_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012551529.1|143790_144435_+	PepSY-associated TM helix domain-containing protein	NA	NA	NA	NA	NA
WP_012551530.1|144468_144993_+	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_085941893.1|145043_145874_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_012551532.1|145931_146249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551533.1|146245_146809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173362148.1|146834_147755_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012551535.1|147754_148519_+	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	1.8e-15
WP_012551536.1|148518_149394_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012551537.1|149436_150321_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012551538.1|150663_151485_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SFD7	Streptococcus_phage	38.7	5.2e-05
WP_012548955.1|153111_154305_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
155995:156796	attR	AAGATCGTAAGATACGCATAATGAATTTTATTTGTTAGGTGTAGTTCCCCGCACGCTTACGGAACACTTCGTTAAGGTTTGGCTTTAATAGAAAGTACAACAGACCAACCGTGATCGGTAATAGAACCAGCGTGACTGGCACACCAAAGGCCATCCATTCCGTAAAGCTTAACCCCACTTCTGCCGCGGCAATCGCGTTTGGTGGGCTACCAACGATGGTTGCAATGCCACCGATACTGGCACAATAAGCGATACCAAGCAGAACGAACACATACGTATTGTGACCTGTTTTAGAATTTACTTTATTCAATACACCCAGCACGAGTGGCAGCATCATGGCTGTGGTTGCTGTGTTGCTTATCCACATTGATAAACCGGCCGTTACCCCAAACAGCATAAAGACGGCGGTGCTCATTTTTCCCTTTGCTAATACAAGAACTTTATCTGCAATGGCTTTATCTAATTCTTGTCTGTGTAATGCGGCTGCAAGAGCGAACCCGCCTAAGAATAAAAAGATAATTGGGTTCGAAAAATTACTCAAGGCTTTGCCTGTATCAAAGATCCCAAAAGCCACGGTAAGTACAGGGACAAGAAGGGCGGTAATACTCACATGCAGTGCTTCTGTGAGCCATAGAATGGCGACAAAGACTAAGATGCTTAATCCAAGCACAACGTCTCGTTCGAAAGGTAAGAAATTATAGAGAAGAGCAAAAAGAATAACGTCGAAGAGAATGATCAGACTGTTTTTATTCAGGAACCATTCCGTGGTATTTGTGGGTAAAGGTATGTTTTCGTTTTTGTG	NA	NA	NA	NA
>prophage 3
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	184825	232207	1206461	transposase	uncultured_Caudovirales_phage(37.5%)	47	NA	NA
WP_012548944.1|184825_185707_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012551563.1|186184_187057_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_012551564.1|187065_187395_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_012551565.1|187394_188003_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_012551566.1|190045_190969_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012551567.1|191626_192361_+	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
WP_012551568.1|192357_193143_+	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
WP_012551569.1|193157_193508_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012551570.1|193504_193903_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012551571.1|193963_195088_-	DUF3103 domain-containing protein	NA	NA	NA	NA	NA
WP_012551572.1|195407_195875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551573.1|195934_197566_-	CHASE3 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.1	7.0e-17
WP_012551574.1|197678_197969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012551575.1|197989_198322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012548925.1|198405_198720_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|198716_199064_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012549008.1|199135_200623_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012551576.1|200731_202702_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_012551577.1|202972_203296_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_023602828.1|203428_204292_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_012551579.1|204362_205406_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_012551580.1|205698_207045_+	magnesium transporter	NA	NA	NA	NA	NA
WP_158306890.1|207354_207528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551581.1|207606_208383_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012551582.1|208503_209349_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.6	8.7e-64
WP_012551583.1|209360_210848_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	76.7	9.6e-207
WP_012551584.1|211359_212235_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012551585.1|212315_212690_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012548955.1|214522_215716_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012548924.1|216725_217073_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012548925.1|217069_217384_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548944.1|217483_218365_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012551586.1|219029_220415_-	histidine kinase sensor domain-containing protein	NA	W8CYF6	Bacillus_phage	25.9	1.6e-22
WP_012551587.1|221324_221684_+	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_012551588.1|221795_222479_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.9	1.3e-28
WP_012551589.1|222483_223824_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	4.5e-14
WP_083799312.1|223827_224718_-	potassium channel protein	NA	NA	NA	NA	NA
WP_012551590.1|224955_225429_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	48.7	4.6e-30
WP_012551591.1|225433_225739_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012548955.1|225927_227121_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_044583535.1|227194_227395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551592.1|227748_227946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551593.1|228253_228511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551594.1|228600_229203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551595.1|229266_229827_+	acyltransferase	NA	NA	NA	NA	NA
WP_044583536.1|230141_230873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548955.1|231013_232207_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	244431	307848	1206461	transposase	Leptospira_phage(62.5%)	51	NA	NA
WP_012549008.1|244431_245919_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012548924.1|245990_246338_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012549325.1|246334_246604_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_044583538.1|246932_247592_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	38.2	3.9e-19
WP_012551606.1|247648_247861_-	TIGR02450 family Trp-rich protein	NA	NA	NA	NA	NA
WP_012551607.1|248031_248610_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012551608.1|248665_249112_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_012551609.1|249753_250005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|250509_250857_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012549008.1|250928_252416_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012551610.1|252510_253752_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_012551611.1|253943_254885_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_044583539.1|255228_257184_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_012548925.1|257773_258088_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|258084_258432_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012551613.1|258503_259991_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012551614.1|260102_260735_-	YdcF family protein	NA	NA	NA	NA	NA
WP_044583540.1|261035_262253_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_012551616.1|262242_263691_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_012551617.1|263815_264478_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_012548925.1|264607_264922_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|264918_265266_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012551618.1|265337_266825_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	1.3e-73
WP_044583541.1|268478_271004_+	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_044583542.1|271023_271356_+	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_012551621.1|271365_272835_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_012551622.1|272872_274645_+	bifunctional protein-serine/threonine kinase/phosphatase	NA	A0A1D6Y777	Golden_Marseillevirus	31.4	5.8e-09
WP_012551623.1|274815_276681_+	LruC domain-containing protein	NA	NA	NA	NA	NA
WP_012551624.1|276692_277187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551625.1|277233_278424_-	protein kinase	NA	NA	NA	NA	NA
WP_083799313.1|278579_278708_+	lipocalin/fatty-acid binding family protein	NA	NA	NA	NA	NA
WP_012551626.1|278787_280092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012551627.1|280344_281604_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_044583628.1|281883_283794_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_012548931.1|284384_285578_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012548924.1|287879_288227_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012548925.1|288223_288538_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548944.1|288637_289519_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_044583631.1|289654_290092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551630.1|290084_291440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551631.1|291526_292363_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012551632.1|292387_292888_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012551633.1|292991_293657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012551634.1|293741_294731_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0M3ZHF0	Turkeypox_virus	27.0	2.7e-08
WP_012551635.1|294890_295898_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012551636.1|295926_296832_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_012551637.1|297157_300256_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_012551638.1|300386_301874_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012548924.1|301945_302293_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012551639.1|304224_305136_+	acetyltransferase	NA	NA	NA	NA	NA
WP_085941784.1|306842_307848_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	471380	532173	1206461	transposase,protease	Bacillus_phage(20.0%)	48	NA	NA
WP_012548944.1|471380_472262_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_012551763.1|472311_473238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551764.1|473386_474292_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_012551765.1|474384_475398_-	acyltransferase	NA	NA	NA	NA	NA
WP_012551766.1|475617_476589_+|protease	serine protease	protease	Q6JPG5	Neodiprion_lecontei_nucleopolyhedrovirus	27.1	2.9e-10
WP_012551767.1|476654_477782_-	fatty acid desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	33.1	1.9e-34
WP_012551768.1|477967_478204_+	DUF3389 domain-containing protein	NA	NA	NA	NA	NA
WP_012551769.1|478200_479442_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.0	2.3e-20
WP_012551770.1|480173_481196_+	porin	NA	NA	NA	NA	NA
WP_012551771.1|481327_484492_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012551772.1|484568_485825_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.4	9.3e-54
WP_012551773.1|487020_488145_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_012551774.1|488156_489209_+	DUF4056 domain-containing protein	NA	NA	NA	NA	NA
WP_012551775.1|489280_490876_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.1	2.4e-22
WP_012551776.1|491076_492207_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_012551777.1|492206_492587_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_012551778.1|492787_494020_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	27.8	1.6e-13
WP_012551779.1|494165_494525_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_012551780.1|494597_496613_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	25.2	2.8e-31
WP_012551781.1|496943_498869_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.8e-51
WP_044583561.1|499163_499688_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_012551783.1|500089_500770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548955.1|501097_502291_-|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_044583643.1|504287_505166_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012551785.1|505171_505972_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012551786.1|505987_506782_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_173362149.1|506783_507500_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	5.7e-32
WP_173362150.1|507779_508835_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	49.4	5.2e-82
WP_026025325.1|508912_510547_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_012551790.1|510698_512438_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_012551791.1|512915_513107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012551792.1|513186_514773_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.2	1.4e-17
WP_012549047.1|515046_516003_+|transposase	IS30-like element ISVsa7 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	6.0e-45
WP_012551793.1|517425_518406_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012551794.1|518414_519884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012551795.1|519938_520649_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_012551796.1|520976_521639_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_012551797.1|521635_523000_+	Ktr system potassium transporter B	NA	NA	NA	NA	NA
WP_012551798.1|523091_524165_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_012551799.1|524183_524825_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_012551800.1|524838_525306_-	cytochrome c	NA	NA	NA	NA	NA
WP_012551801.1|525510_526029_+	NUDIX domain-containing protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	43.9	7.3e-29
WP_012551802.1|526029_526251_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_012548944.1|526425_527307_-|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_044583562.1|527861_528770_+	aldo/keto reductase family oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	25.8	1.0e-09
WP_012551804.1|528862_529891_-	dihydroorotase	NA	NA	NA	NA	NA
WP_012551805.1|530093_530288_+	ribosome alternative rescue factor ArfA	NA	NA	NA	NA	NA
WP_012549008.1|530685_532173_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
>prophage 6
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	559880	568463	1206461		Vibrio_phage(33.33%)	6	NA	NA
WP_012551832.1|559880_560924_+	GMP reductase	NA	A0A1B1IS93	uncultured_Mediterranean_phage	53.2	1.5e-97
WP_049940457.1|560877_561741_-	hypothetical protein	NA	R9TMQ4	Vibrio_phage	46.5	1.3e-59
WP_012551833.1|561921_563085_+	DNA cytosine methyltransferase	NA	A0A191SAU1	Nostoc_phage	35.8	8.7e-46
WP_012551834.1|563171_566165_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	32.4	5.8e-78
WP_012551835.1|566161_567949_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	21.9	1.1e-20
WP_012551836.1|568019_568463_-	hypothetical protein	NA	A0A2I7RNF9	Vibrio_phage	38.9	1.2e-16
>prophage 7
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	681508	687830	1206461	integrase	Vibrio_phage(66.67%)	11	677454:677471	698287:698304
677454:677471	attL	ATATCTCGGCTTTTTTAT	NA	NA	NA	NA
WP_012551949.1|681508_681685_-	hypothetical protein	NA	Q9MBU8	Vibrio_virus	77.6	4.4e-18
WP_044583576.1|681808_682000_+	hypothetical protein	NA	R9TRU0	Vibrio_phage	49.2	3.6e-10
WP_012551950.1|681996_683244_+	replication initiation factor domain-containing protein	NA	A0A1W6UG38	Vibrio_phage	51.0	3.1e-102
WP_044583577.1|683174_683495_+	DUF1293 family protein	NA	R9TRB6	Vibrio_phage	56.0	2.6e-13
WP_012551949.1|683520_683697_-	hypothetical protein	NA	Q9MBU8	Vibrio_virus	77.6	4.4e-18
WP_044583576.1|683820_684012_+	hypothetical protein	NA	R9TRU0	Vibrio_phage	49.2	3.6e-10
WP_012551950.1|684008_685256_+	replication initiation factor domain-containing protein	NA	A0A1W6UG38	Vibrio_phage	51.0	3.1e-102
WP_044583578.1|685186_685534_+	DUF1293 family protein	NA	A0A1W6UG87	Vibrio_phage	55.6	2.2e-29
WP_012551951.1|686042_686354_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_012551952.1|686397_686748_-	DUF3319 domain-containing protein	NA	NA	NA	NA	NA
WP_012551953.1|686912_687830_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	23.2	7.4e-08
698287:698304	attR	ATAAAAAAGCCGAGATAT	NA	NA	NA	NA
>prophage 8
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	805301	866014	1206461	transposase,capsid,protease,tRNA	uncultured_Caudovirales_phage(25.0%)	58	NA	NA
WP_012552032.1|805301_806081_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_012552033.1|806215_807079_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_012552034.1|807158_807908_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017023132.1|807889_808087_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_012552036.1|808067_809075_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_012552037.1|809074_810823_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.8	5.8e-62
WP_012552038.1|810857_813164_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	26.3	2.3e-18
WP_012552039.1|813170_813695_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_164998988.1|813967_814135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012552040.1|814197_815118_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_158306894.1|815416_815851_+	hypothetical protein	NA	A0A2P1CKY6	Pseudoalteromonas_phage	35.3	7.2e-14
WP_012552042.1|815847_816135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583586.1|816183_816411_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_012552044.1|816530_817196_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_012552045.1|817200_818445_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012552046.1|818981_819254_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_012552047.1|819320_820337_+|capsid	P2 family phage major capsid protein	capsid	A0A0U4K5I9	Pseudomonas_phage	40.2	8.9e-63
WP_049940468.1|820428_821295_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_085941784.1|821413_822419_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_049940469.1|822420_823209_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_012548925.1|823510_823825_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|823821_824169_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012549008.1|824240_825728_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012552048.1|825848_826406_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_012552049.1|826563_827232_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012552050.1|827376_827547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012552051.1|827603_828302_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_012552052.1|828379_830056_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.1	1.2e-27
WP_012552053.1|830287_830674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012552054.1|830727_832836_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012552055.1|832835_833372_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_129546105.1|834152_835781_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_012550319.1|835910_836792_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_085941886.1|836846_837455_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012552058.1|837751_838132_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_012552059.1|838155_841023_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	53.3	2.0e-277
WP_012548925.1|841209_841524_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|841520_841868_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_044583662.1|843439_845173_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	4.2e-20
WP_044583588.1|845392_847129_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_012552060.1|847403_849389_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.1e-16
WP_012552061.1|849628_852091_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	28.5	4.2e-74
WP_012552062.1|852114_853293_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_012552063.1|853356_853533_-	trimethylamine N-oxide reductase system protein TorE	NA	NA	NA	NA	NA
WP_012552064.1|853864_854173_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_012552065.1|854290_854809_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_012552066.1|854813_855002_+	DUF2986 domain-containing protein	NA	NA	NA	NA	NA
WP_012548944.1|855159_856041_+|transposase	IS982-like element ISVsa6 family transposase	transposase	NA	NA	NA	NA
WP_044583589.1|856074_856755_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_012552068.1|856792_857884_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	6.5e-19
WP_012552069.1|857885_858575_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012552070.1|858574_859309_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012552071.1|859321_860809_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_012552072.1|861044_861422_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_012552073.1|861504_862044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583590.1|862402_863698_+	lytic transglycosylase F	NA	NA	NA	NA	NA
WP_012552075.1|863815_865234_+	lytic transglycosylase F	NA	A0A0S2SXN2	Bacillus_phage	32.4	6.3e-06
WP_012552076.1|865345_866014_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 9
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	959425	1017321	1206461	transposase	Leptospira_phage(28.57%)	49	NA	NA
WP_012548955.1|959425_960619_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012549008.1|960910_962398_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012552147.1|963450_963768_+	cytochrome c	NA	NA	NA	NA	NA
WP_044583602.1|963734_964967_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_012552149.1|964950_965607_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_012552150.1|965845_967030_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_012552151.1|967108_967981_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012552152.1|968096_968717_+	LysE family translocator	NA	NA	NA	NA	NA
WP_012552153.1|968889_969447_+	glutathione S-transferase N-terminal domain-containing protein	NA	A0A2D1GNB1	Pseudoalteromonas_phage	45.9	9.0e-09
WP_148234227.1|969727_971851_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012552155.1|971853_972033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012552156.1|972175_972919_+	phosphatase	NA	NA	NA	NA	NA
WP_012552157.1|973014_973890_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012552158.1|973943_974546_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_012552159.1|974814_975030_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_012552160.1|975029_975254_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	60.0	8.3e-06
WP_012552161.1|975253_975652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012552162.1|975666_976521_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012552163.1|976823_978725_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012552164.1|978783_980001_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_012552165.1|980065_980857_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_044583603.1|980853_981153_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_012548955.1|983458_984652_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_044583604.1|984740_985958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012552167.1|985954_986578_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_012552168.1|986577_986982_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_012552169.1|986978_987512_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_012552170.1|987511_988873_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_083799328.1|988874_989636_-	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_012552172.1|989718_991734_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_012552173.1|992663_993431_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	1.4e-12
WP_012552174.1|993560_995711_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012552175.1|995855_996752_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017021398.1|996957_998553_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	25.9	1.2e-50
WP_044583668.1|998796_999297_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_012552178.1|999319_1000417_-	alkene reductase	NA	NA	NA	NA	NA
WP_012552179.1|1000495_1001683_-	MFS transporter	NA	NA	NA	NA	NA
WP_012552180.1|1001919_1002855_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129546112.1|1003076_1003805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941784.1|1003830_1004837_-|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012552182.1|1005561_1006452_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_012552183.1|1006667_1007636_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.4	3.1e-20
WP_012552184.1|1007632_1008616_-	response regulator	NA	NA	NA	NA	NA
WP_044583605.1|1008927_1010121_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_083799321.1|1010509_1012486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083799322.1|1012492_1013371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083799323.1|1013426_1013750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941784.1|1013851_1014857_+|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012549818.1|1015833_1017321_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.5e-74
>prophage 10
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	1060537	1115951	1206461	transposase,tRNA	Leptospira_phage(44.44%)	37	NA	NA
WP_012548943.1|1060537_1061728_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_129546113.1|1063811_1064381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012549008.1|1065187_1066675_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012548924.1|1066746_1067094_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012548925.1|1067090_1067405_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012552221.1|1068012_1068870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012552222.1|1069348_1070086_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_012552223.1|1070185_1071073_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012552224.1|1071201_1071921_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012552225.1|1071972_1073079_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012552226.1|1073091_1073763_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012552227.1|1073891_1074794_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012552228.1|1075046_1076009_+	DUF3187 family protein	NA	NA	NA	NA	NA
WP_012552229.1|1076164_1077121_-	AEC family transporter	NA	NA	NA	NA	NA
WP_049940471.1|1082798_1083749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548955.1|1083819_1085013_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_012549008.1|1085304_1086792_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012548924.1|1087959_1088307_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012548925.1|1088303_1088618_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012552233.1|1088782_1090186_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_012552234.1|1090209_1090641_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012552235.1|1091150_1092890_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	4.5e-14
WP_012552236.1|1093125_1094028_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	23.8	6.8e-14
WP_012552237.1|1094103_1095420_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_012552238.1|1098379_1098850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012552239.1|1098950_1100453_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_012552240.1|1100750_1101083_-|tRNA	tRNA-binding protein	tRNA	A0A1V0SEZ7	Hokovirus	40.0	9.8e-11
WP_012548924.1|1102435_1102783_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012549008.1|1102854_1104342_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012552243.1|1107988_1109461_+	peptide MFS transporter	NA	NA	NA	NA	NA
WP_012552244.1|1109533_1111270_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.6	2.4e-44
WP_012552245.1|1111286_1111820_-	heme NO-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012552246.1|1112026_1112563_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	32.5	6.0e-18
WP_049940472.1|1112685_1113678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012548925.1|1113733_1114048_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012548924.1|1114044_1114392_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012549008.1|1114463_1115951_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
>prophage 11
NC_011313	Aliivibrio salmonicida LFI1238 chromosome 2, complete sequence	1206461	1124237	1187067	1206461	transposase,protease,tRNA	Bacillus_virus(28.57%)	53	NA	NA
WP_012552254.1|1124237_1125275_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012552255.1|1125647_1126715_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012552256.1|1126723_1127530_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_012552257.1|1127526_1128414_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012552258.1|1128400_1129189_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012552259.1|1129185_1130205_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	4.3e-33
WP_012552260.1|1130206_1130872_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_012552261.1|1130902_1131112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012552262.1|1131403_1131613_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	67.6	6.8e-18
WP_012552263.1|1132090_1132297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012552264.1|1132373_1133978_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_012552266.1|1134864_1135275_-	VOC family protein	NA	NA	NA	NA	NA
WP_012552267.1|1136307_1137156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012552268.1|1137282_1137870_-	LysE family translocator	NA	NA	NA	NA	NA
WP_012552269.1|1137979_1138423_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012552270.1|1138419_1139103_-	cation transporter	NA	NA	NA	NA	NA
WP_012552271.1|1139253_1140138_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012552272.1|1140273_1141248_-	GGGtGRT protein	NA	NA	NA	NA	NA
WP_012552273.1|1141262_1141955_-	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_085941892.1|1142538_1143363_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012548955.1|1143435_1144629_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_148234217.1|1144953_1145169_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012549008.1|1145240_1146728_+|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
WP_012552274.1|1147457_1148420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012552275.1|1149058_1149637_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012552276.1|1149642_1150770_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_012552277.1|1150999_1151827_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012552278.1|1152005_1152356_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_012552279.1|1152566_1153679_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_085941784.1|1153873_1154880_-|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012552281.1|1156459_1157008_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_044583613.1|1157796_1158249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941784.1|1158279_1159286_-|transposase	IS630-like element ISVsa8 family transposase	transposase	NA	NA	NA	NA
WP_012552282.1|1159758_1161951_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_012552283.1|1162001_1163321_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_012552284.1|1163633_1164245_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_173362154.1|1165440_1166634_+	MFS transporter	NA	NA	NA	NA	NA
WP_012552286.1|1166646_1168224_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.3	2.8e-23
WP_012552287.1|1168580_1169120_-	adenosyltransferase	NA	NA	NA	NA	NA
WP_012552288.1|1169173_1169761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012552289.1|1170039_1170957_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044583614.1|1170956_1171997_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012552291.1|1171993_1172773_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.5e-19
WP_023602578.1|1172855_1174226_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_012552293.1|1175572_1176295_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_026025609.1|1176490_1177048_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_012552295.1|1177431_1178340_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012549047.1|1178464_1179421_+|transposase	IS30-like element ISVsa7 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	6.0e-45
WP_012552296.1|1179484_1180249_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012552297.1|1180292_1181204_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_012548955.1|1181851_1183045_+|transposase	IS91-like element ISVsa9 family transposase	transposase	NA	NA	NA	NA
WP_044583615.1|1184191_1184767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012549008.1|1185579_1187067_-|transposase	IS66-like element ISVsa2 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.1e-74
