The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014810	Helicobacter felis ATCC 49179, complete genome	1672681	3815	33757	1672681	terminase,head,holin,integrase,transposase	Helicobacter_phage(50.0%)	39	3712:3771	35385:35487
3712:3771	attL	ATTTCTGCGCTTATGTCCCCACTCCTCGCGTTACCCTCAACAGCTTCAAGCGCACGCAAA	NA	NA	NA	NA
WP_041302643.1|3815_5402_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013468485.1|5595_6465_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	32.7	5.0e-30
WP_013468486.1|6474_6795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468487.1|6791_6968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468488.1|7033_7285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468489.1|7277_7700_+	host-nuclease inhibitor Gam family protein	NA	NA	NA	NA	NA
WP_013468490.1|7696_7969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468491.1|8065_8992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468493.1|9201_10329_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013468494.1|10401_10842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468495.1|10917_11382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013468496.1|11458_12676_+	DUF935 family protein	NA	NA	NA	NA	NA
WP_013468498.1|13054_13411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468499.1|13443_13674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468500.1|13666_15196_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	26.3	6.7e-38
WP_013468519.1|15217_16483_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	55.4	2.2e-127
WP_013468501.1|16622_17054_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_013468502.1|17104_18244_+|head	phage head morphogenesis protein	head	A0A2H4IYU7	uncultured_Caudovirales_phage	28.9	1.2e-07
WP_041302645.1|18386_18767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041302646.1|18761_19751_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5RGV0	Helicobacter_phage	63.2	7.7e-112
WP_041302647.1|19770_20046_-	helix-turn-helix domain-containing protein	NA	A0A1S5RGV0	Helicobacter_phage	70.5	3.2e-31
WP_013468786.1|20020_20671_-|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	83.2	4.0e-93
WP_013468504.1|20791_21304_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_013468505.1|21366_22146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468506.1|22147_22831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468507.1|22823_23189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041302649.1|23185_23419_-	hypothetical protein	NA	A0A1S5RG56	Helicobacter_phage	42.2	7.3e-05
WP_158305091.1|23417_23570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013468509.1|23591_23906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013468510.1|23892_24261_-|holin	holin	holin	A0A1S5RFV1	Helicobacter_phage	48.6	2.5e-23
WP_013468511.1|24253_24487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013468512.1|24486_24918_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2K9VHF1	Pseudomonas_phage	46.9	5.0e-31
WP_013468513.1|24919_25264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049776917.1|25260_25584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013468515.1|25606_26389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013468516.1|26388_27222_-	mu-like prophage i protein	NA	A0A2P9JZJ0	Alteromonadaceae_phage	32.0	2.0e-12
WP_013468517.1|27294_31257_+	hypothetical protein	NA	X2KR41	Campylobacter_phage	30.0	4.9e-24
WP_013468518.1|31308_32184_+|head	Mu-like prophage major head subunit gpT family protein	head	H7BVL8	unidentified_phage	35.1	5.2e-43
WP_013468519.1|32491_33757_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	55.4	2.2e-127
35385:35487	attR	TTTGCGTGCGCTTGAAGCTGTTGAGGGTAACGCGAGGAGTGGGGACATAAGCGCAGAAATCAGACATCCTAGCTCCTTTTGGCTTATTTAAAGCGTCCTAATG	NA	NA	NA	NA
>prophage 2
NC_014810	Helicobacter felis ATCC 49179, complete genome	1672681	159692	165620	1672681		Acinetobacter_phage(33.33%)	6	NA	NA
WP_013468647.1|159692_160325_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	43.7	1.2e-20
WP_013468648.1|160324_161368_-	ribonucleotide-diphosphate reductase subunit beta	NA	A2PYN0	Cyanophage	34.1	2.3e-53
WP_041303027.1|161418_162279_-	DNA glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	32.6	3.5e-12
WP_013468650.1|162388_163180_-	glycosyltransferase family 25 protein	NA	A0A1S5NQ44	Burkholderia_phage	27.3	2.8e-11
WP_013468651.1|163258_164269_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	33.8	1.9e-41
WP_013468652.1|164261_165620_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.7	1.1e-39
>prophage 3
NC_014810	Helicobacter felis ATCC 49179, complete genome	1672681	627062	633990	1672681	tRNA	Prochlorococcus_phage(50.0%)	7	NA	NA
WP_013469094.1|627062_628487_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	34.9	5.1e-48
WP_013469095.1|628495_628996_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.6	5.2e-24
WP_013469096.1|628992_629703_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	38.4	8.2e-39
WP_013469097.1|629705_631109_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	33.3	1.0e-48
WP_013469098.1|631118_632141_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.0	1.6e-67
WP_013469099.1|632128_632833_+	IMP cyclohydrolase	NA	NA	NA	NA	NA
WP_013469100.1|632832_633990_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	27.2	2.2e-25
>prophage 4
NC_014810	Helicobacter felis ATCC 49179, complete genome	1672681	1020487	1036233	1672681	transposase,holin	Helicobacter_phage(72.73%)	15	NA	NA
WP_013469483.1|1020487_1020991_+	hypothetical protein	NA	A0A1S5RG08	Helicobacter_phage	38.0	3.8e-30
WP_013469484.1|1020987_1021260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013469485.1|1021246_1021537_+|holin	phage holin family protein	holin	A0A1B0XWG7	Campylobacter_phage	30.3	5.2e-08
WP_013469486.1|1021533_1021863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148229940.1|1021834_1022452_-	DUF1804 family protein	NA	A0A1S5RFH0	Helicobacter_phage	36.6	1.4e-31
WP_013469488.1|1022461_1022941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013469489.1|1022937_1023828_-	hypothetical protein	NA	A0A1S5RG14	Helicobacter_phage	45.3	2.1e-44
WP_049776951.1|1023827_1024793_-	hypothetical protein	NA	A0A1S5RFN3	Helicobacter_phage	33.6	5.6e-14
WP_013469492.1|1026449_1027160_-	hypothetical protein	NA	A0A1D8KL30	Synechococcus_phage	29.9	2.4e-06
WP_013469493.1|1027169_1027379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041303250.1|1027655_1028771_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	65.4	3.9e-136
WP_013469496.1|1029590_1031348_-	hypothetical protein	NA	A0A1S5RGP0	Helicobacter_phage	64.0	3.3e-198
WP_041302824.1|1031649_1031862_-	hypothetical protein	NA	I6P014	Helicobacter_phage	54.5	7.3e-12
WP_041302826.1|1031912_1032671_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	44.5	1.4e-52
WP_158305107.1|1032804_1036233_-	hypothetical protein	NA	A0A1S5RFG7	Helicobacter_phage	30.6	1.1e-96
>prophage 5
NC_014810	Helicobacter felis ATCC 49179, complete genome	1672681	1562010	1571777	1672681		Helicobacter_phage(66.67%)	9	NA	NA
WP_041303413.1|1562010_1563606_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.3	2.6e-101
WP_013470039.1|1564456_1565161_+	hypothetical protein	NA	A0A1S5RH75	Helicobacter_phage	68.6	1.5e-93
WP_041302915.1|1565729_1566278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148229951.1|1566342_1567155_+	hypothetical protein	NA	A0A1S5RG15	Helicobacter_phage	35.0	6.1e-22
WP_148229952.1|1567236_1568445_+	hypothetical protein	NA	A0A1S5RG62	Helicobacter_phage	41.7	3.6e-71
WP_049776973.1|1568422_1568650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049776975.1|1568640_1569015_+	hypothetical protein	NA	A0A1S5REZ7	Helicobacter_phage	49.5	2.3e-16
WP_013470042.1|1569077_1569695_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_081458377.1|1569863_1571777_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.2	3.2e-13
