The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	43269	67810	3749411	integrase,transposase	uncultured_Caudovirales_phage(33.33%)	15	31651:31667	70207:70223
31651:31667	attL	GCCGATGAAGGTGGGCG	NA	NA	NA	NA
WP_013639139.1|43269_44481_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	24.6	4.1e-14
WP_158320266.1|45124_45925_+	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_013639141.1|45926_46574_+	LysE family translocator	NA	NA	NA	NA	NA
WP_013639142.1|46575_47943_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	43.2	4.4e-41
WP_013639144.1|49296_50796_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_013639145.1|50792_51620_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.5	4.6e-41
WP_011930570.1|52331_53372_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013639147.1|54083_56573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148361010.1|56834_58181_+	MFS transporter	NA	NA	NA	NA	NA
WP_052944955.1|58349_59009_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081479211.1|59034_60312_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_082088290.1|61288_62446_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_148361011.1|62498_63710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011930570.1|64762_65803_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013639153.1|66076_67810_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
70207:70223	attR	GCCGATGAAGGTGGGCG	NA	NA	NA	NA
>prophage 2
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	299394	360333	3749411	integrase,transposase	Streptococcus_phage(18.18%)	58	343637:343655	368497:368515
WP_013635054.1|299394_300429_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_148361012.1|300968_301199_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_007422159.1|301842_302157_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011941373.1|302172_302442_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_007422157.1|302504_303503_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_013639268.1|303499_304651_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.6	4.0e-51
WP_013639269.1|304666_305773_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_138919160.1|305894_306428_-	Cupredoxin	NA	NA	NA	NA	NA
WP_011941376.1|306507_307296_-	arginyltransferase	NA	NA	NA	NA	NA
WP_011941377.1|307292_307787_-	RDD family protein	NA	NA	NA	NA	NA
WP_007422151.1|307945_308878_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	33.2	1.6e-42
WP_007422150.1|308905_309526_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_007422149.1|309525_310110_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011941378.1|310156_311320_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_013639271.1|311391_312561_-	amidase	NA	NA	NA	NA	NA
WP_007422146.1|312667_313618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007422145.1|313614_314469_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013639272.1|314478_314784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007422143.1|314820_316908_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	6.3e-63
WP_013639273.1|317119_317410_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_148360930.1|317456_318686_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.1	1.2e-42
WP_007422140.1|318855_319614_+	signal peptidase I	NA	NA	NA	NA	NA
WP_013639275.1|319610_320276_+	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	36.6	1.5e-18
WP_013639276.1|320272_321160_+	GTPase Era	NA	NA	NA	NA	NA
WP_011941385.1|321198_322317_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013639277.1|322327_323539_-	pimeloyl-CoA dehydrogenase large subunit	NA	NA	NA	NA	NA
WP_013639278.1|323641_325345_-	dicarboxylate--CoA ligase PimA	NA	A0A2H4PQM9	Staphylococcus_phage	29.0	1.6e-27
WP_013639279.1|325341_327438_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_013639280.1|327536_328535_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013639281.1|328534_329908_-	glycosyltransferase family protein	NA	D6PFH9	uncultured_phage	25.3	3.7e-11
WP_013639282.1|329904_331785_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011941392.1|331916_332873_+	membrane protein	NA	NA	NA	NA	NA
WP_013639283.1|332904_333861_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_013639284.1|333868_334534_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011941394.1|334530_335358_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_013639285.1|335406_336303_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011941396.1|336299_337325_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013639286.1|337324_339070_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	25.7	1.4e-23
WP_013639287.1|339066_340395_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011941399.1|341048_341639_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007421756.1|341635_341950_-	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	42.7	7.8e-10
WP_013639288.1|342031_342994_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_013639289.1|342999_344073_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
343637:343655	attL	ACATTGGCGCCAAGATCGA	NA	NA	NA	NA
WP_011941402.1|344229_344433_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_048857876.1|344588_345155_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_007421753.1|345192_345690_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_013639291.1|345694_347284_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_013639292.1|347345_348824_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011941406.1|349071_350295_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	51.0	3.0e-105
WP_011941407.1|350291_350930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011941408.1|351191_351524_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013639293.1|351520_353578_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013639294.1|353582_354665_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_148360949.1|354746_355040_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_013639296.1|355041_355533_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011941414.1|356228_356771_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081479217.1|356826_358557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013639301.1|359109_360333_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.3	3.6e-42
368497:368515	attR	ACATTGGCGCCAAGATCGA	NA	NA	NA	NA
>prophage 3
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	1064404	1137148	3749411	integrase,protease,tRNA,transposase	Moraxella_phage(18.18%)	59	1062846:1062862	1144086:1144102
1062846:1062862	attL	GGCGAGATCGGCCTCGC	NA	NA	NA	NA
WP_007421380.1|1064404_1065100_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013639694.1|1065096_1066023_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_148360933.1|1066033_1066900_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_013639696.1|1066925_1068716_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_007422648.1|1068725_1069868_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_013639697.1|1069947_1070289_+	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_007422650.1|1070296_1071067_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_013639698.1|1071167_1072772_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041665238.1|1072839_1074645_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.1	3.8e-32
WP_007422393.1|1074604_1075075_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_013639700.1|1075064_1076003_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.9	1.7e-36
WP_013639701.1|1076025_1076703_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	1.2e-26
WP_007422396.1|1076695_1077943_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_007422397.1|1077942_1079256_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013639702.1|1079289_1080384_-	acyltransferase	NA	NA	NA	NA	NA
WP_013639703.1|1080635_1082282_-	ribonuclease J	NA	NA	NA	NA	NA
WP_007422400.1|1082316_1083117_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_007422401.1|1083138_1083867_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_011941877.1|1083863_1085300_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_013639704.1|1085308_1086826_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_013639705.1|1086839_1088768_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_011941875.1|1088774_1089086_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_013639706.1|1089082_1089733_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_035186180.1|1089739_1090228_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_013639707.1|1090243_1091260_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_013639708.1|1091265_1093326_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_007422410.1|1093393_1094689_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_007422411.1|1094690_1095302_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_011941872.1|1095305_1096526_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_007422413.1|1096522_1097164_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_007422414.1|1097156_1097717_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_007422415.1|1097792_1098158_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_172637322.1|1098894_1099167_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	58.9	4.7e-19
WP_007422417.1|1099351_1101793_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.0	5.6e-204
WP_011941871.1|1101928_1103185_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.0	1.1e-131
WP_007422419.1|1103329_1103959_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	58.5	4.8e-59
WP_013639709.1|1104116_1105439_-	trigger factor	NA	NA	NA	NA	NA
WP_013639710.1|1105705_1107682_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_013639711.1|1107846_1110663_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_013639712.1|1110664_1113313_-	DNA mismatch repair protein MutS	NA	F2QAG1	Chrysochromulina_ericina_virus	32.5	1.3e-20
WP_013639713.1|1113447_1114791_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_011941866.1|1114793_1118039_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_007422523.1|1118120_1118594_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_007422524.1|1118598_1119795_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_013639714.1|1119811_1121017_-	aminopeptidase	NA	NA	NA	NA	NA
WP_007422526.1|1121013_1121817_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013639715.1|1121813_1122587_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_007422527.1|1122683_1124201_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_013639716.1|1124200_1125379_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_007424440.1|1125451_1126825_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.6	6.5e-24
WP_013639718.1|1126829_1127795_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_007424438.1|1127791_1128286_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_011941859.1|1128288_1128954_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_007424436.1|1129026_1130589_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_013639720.1|1130896_1132111_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	54.2	6.6e-121
WP_148360952.1|1132107_1132635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947335.1|1132727_1133674_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	23.9	1.1e-09
WP_011930570.1|1134100_1135141_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013639724.1|1135414_1137148_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
1144086:1144102	attR	GGCGAGATCGGCCTCGC	NA	NA	NA	NA
>prophage 4
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	1460447	1507322	3749411	holin,transposase	Catovirus(22.22%)	36	NA	NA
WP_013639901.1|1460447_1462073_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	33.0	1.5e-59
WP_007424736.1|1462098_1463514_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007424737.1|1463529_1464069_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_013639902.1|1464061_1465780_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	23.5	6.0e-19
WP_013639903.1|1465791_1467078_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_041665253.1|1467089_1467932_-	dehydratase	NA	NA	NA	NA	NA
WP_041664651.1|1468023_1469424_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_013639906.1|1469423_1472000_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_013639907.1|1472032_1473103_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A222YX16	Synechococcus_phage	33.3	3.0e-08
WP_013639908.1|1473106_1474309_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	31.8	1.8e-25
WP_172637325.1|1474661_1475975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007421748.1|1476324_1477011_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_013639911.1|1477003_1477651_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_013639912.1|1477654_1478809_-	PrpF family protein	NA	NA	NA	NA	NA
WP_007421744.1|1478813_1479521_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_013639913.1|1479617_1480985_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_007421743.1|1481045_1482446_+	MFS transporter	NA	NA	NA	NA	NA
WP_013639914.1|1482477_1483539_+	isocitrate/isopropylmalate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013639915.1|1483563_1485348_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_013639916.1|1485363_1486638_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_013639917.1|1486652_1487390_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_013639918.1|1487389_1488208_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013639919.1|1488204_1489809_-	glucose-6-phosphate dehydrogenase	NA	C7BV85	Synechococcus_phage	35.2	1.3e-79
WP_011942122.1|1489805_1490810_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	H6WFR9	Cyanophage	46.4	2.5e-78
WP_013639920.1|1490929_1493761_-	bifunctional transaldolase/phosoglucose isomerase	NA	NA	NA	NA	NA
WP_011942124.1|1494026_1495832_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.8	1.0e-21
WP_013639921.1|1495837_1497193_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013639922.1|1497487_1497832_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.0	8.6e-18
WP_041664652.1|1497833_1498475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172637313.1|1498627_1498903_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013639925.1|1498980_1499409_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	29.2	1.7e-07
WP_011930570.1|1499677_1500718_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011942129.1|1501059_1501491_-	DoxX family protein	NA	NA	NA	NA	NA
WP_013639927.1|1501619_1502567_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011930570.1|1504274_1505315_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013634984.1|1505588_1507322_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	2136787	2155623	3749411	transposase	Saccharomonospora_phage(50.0%)	18	NA	NA
WP_013640286.1|2136787_2137366_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_013640289.1|2138359_2139403_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013639729.1|2139727_2140555_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_007424944.1|2140729_2141491_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_013640290.1|2141501_2142500_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_007424946.1|2142510_2143293_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_013640291.1|2143321_2144065_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_013640292.1|2144290_2144830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172637326.1|2144753_2146055_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_013640294.1|2146054_2149168_+	error-prone DNA polymerase	NA	Q8W6C3	Saccharomonospora_phage	27.3	1.9e-76
WP_013640295.1|2149240_2149753_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_172637327.1|2149803_2150328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138919228.1|2150317_2151052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148360983.1|2151048_2151438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007421341.1|2151421_2152438_-|transposase	IS1595-like element ISAcr1 family transposase	transposase	NA	NA	NA	NA
WP_148361028.1|2153072_2154485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640300.1|2155166_2155352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013640301.1|2155416_2155623_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	48.2	1.5e-09
>prophage 6
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	2163616	2230209	3749411	transposase	Klosneuvirus(25.0%)	53	NA	NA
WP_013640308.1|2163616_2164564_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007424761.1|2165627_2166074_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_007424760.1|2166188_2167148_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	31.2	2.0e-19
WP_007424759.1|2167150_2168221_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	50.3	1.5e-92
WP_048858054.1|2168317_2169286_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007424757.1|2169303_2169753_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_041664858.1|2169883_2171728_+	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_013640313.1|2172494_2173703_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.8	1.4e-94
WP_013635006.1|2175578_2176946_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.4	5.8e-41
WP_041664860.1|2177393_2178305_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013640318.1|2178408_2179161_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013640319.1|2179362_2180310_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013640320.1|2180344_2181223_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_007424997.1|2181342_2182242_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085947346.1|2182310_2182775_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_148360979.1|2182905_2183151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013640323.1|2183348_2183876_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007421404.1|2183880_2184105_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083818639.1|2184113_2184296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013640324.1|2184647_2185436_-	hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	33.7	5.9e-14
WP_007421407.1|2185474_2186497_-	amidohydrolase	NA	NA	NA	NA	NA
WP_007421408.1|2186523_2187828_-	MFS transporter	NA	NA	NA	NA	NA
WP_007421409.1|2187854_2188535_-	RraA family protein	NA	NA	NA	NA	NA
WP_007421410.1|2188631_2189540_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013640326.1|2190568_2191435_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_013640327.1|2191419_2195064_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_148360931.1|2195294_2195735_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_013640329.1|2195770_2197036_+	MFS transporter	NA	NA	NA	NA	NA
WP_013640088.1|2197930_2198806_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_081432838.1|2198802_2200332_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_152982804.1|2201230_2201644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640333.1|2201667_2202498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013640335.1|2203743_2204640_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013640336.1|2204829_2206395_+	amino acid permease	NA	NA	NA	NA	NA
WP_013640337.1|2206426_2207194_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	3.0e-10
WP_007421341.1|2207875_2208892_+|transposase	IS1595-like element ISAcr1 family transposase	transposase	NA	NA	NA	NA
WP_013640340.1|2209641_2210100_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013640341.1|2210194_2210506_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013640342.1|2210697_2211576_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013640343.1|2211753_2212677_+	EamA family transporter	NA	NA	NA	NA	NA
WP_013640344.1|2213267_2214635_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_013640345.1|2214606_2215848_+	methylitaconate delta2-delta3-isomerase	NA	NA	NA	NA	NA
WP_007421431.1|2215851_2216610_+	phosphosulfolactate synthase	NA	NA	NA	NA	NA
WP_007421432.1|2216620_2217559_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_013640346.1|2217536_2219210_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.5e-19
WP_013634879.1|2219142_2220276_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_041664916.1|2220359_2221358_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041664922.1|2221361_2222198_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007421436.1|2222197_2223025_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041664929.1|2223063_2223888_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	5.0e-32
WP_013640353.1|2226210_2226942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013640354.1|2226954_2228487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013634879.1|2229075_2230209_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	2239253	2283132	3749411	integrase,transposase	Leptospira_phage(16.67%)	34	2229069:2229128	2269810:2271038
2229069:2229128	attL	GCAGGGGTTACGCATGAAAGAAGCCGGTGAGCACTTGCTCCATGTAACGGTTATCCCAGG	NA	NA	NA	NA
WP_013640363.1|2239253_2240333_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_013640365.1|2242429_2242651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640366.1|2242643_2242898_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041665314.1|2243324_2244926_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013640368.1|2244925_2246050_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_013640369.1|2246250_2246574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640371.1|2247114_2248131_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011930570.1|2248984_2250025_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013634984.1|2250298_2252032_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_154653540.1|2252638_2253343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154653541.1|2253348_2254329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012039989.1|2254687_2255593_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	32.6	5.2e-30
WP_013639834.1|2255597_2256791_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013640374.1|2257415_2259320_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_172637328.1|2259762_2260230_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013640376.1|2260226_2260574_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	52.3	1.1e-25
WP_013640379.1|2262288_2263143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640380.1|2263410_2263662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640381.1|2264160_2264478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664952.1|2264508_2264748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664953.1|2265095_2266796_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	36.8	8.7e-79
WP_013640384.1|2267356_2268130_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_013640385.1|2268195_2269035_+	sterol desaturase family protein	NA	A0A1V0CNR7	Kaumoebavirus	29.5	7.5e-07
WP_013640386.1|2269334_2269826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634879.1|2269816_2270950_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_081479241.1|2270878_2271136_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
2269810:2271038	attR	GCAGGGGTTACGCATGAAAGAAGCCGGTGAGCACTTGCTCCATGTAACGGTTATCCCAGGCGGCCATTTTGCGGCGCCCCTTGAGACTGGCCTTTGATGCCTGATGGCGGCGAACGAGGTTGATTGCGATCTTGCGAAGCAGGGAGAAGTTCTGGACGGCGTTGCGATCCCGGATCCGGCAGTGATCTTCGTTGAAGGTGACGTCGAGCACCCAGTGTAGGCTGTTCTCGATCTGCCAATGTTGACGGATCGCTTTCGCCAGGATTTCGGGTTGATCGTCGCTGCTGGACAGGAAGTAGCGGATTTCGGCTTCGATCTTGCCGGATCCGTTGACGCCGCGGATGGTTTCCACGGCCAGAACGCTCTTCAACCCCGGCCAGTCGCGCAGCGGTTCCAGCGCTACGGCGTCCGGACAGACGAACACCCGGCGCCGAACAAGACGACCATGACCATCATCGAATTCGTCATGCACCGGCCGATCAACGGGTGAGCGGCTGAAGCAGGTGGTTGCGCAATACTCCTGCACGGCGCTGTGTTTCTTCCCCTGGTTTGCTTTGAGGGTGACGAGATAATCAGCACCCCGCTCGAGAATTTTGGACGCGATGGCTCGCTGGCACCCCATCGCGTCCAGCGTGACAATGGCGCCCTTGATGTCCAGCACATCCAGCAATTCCGGGATCGCGGTGATCTCGTTCGATTTGTCGCCGACCTGACGCTGGCCGAGCACCAGCCCCCGATCACTCGCCCATGCACTCACAACGTGAAGCGCCGCCTGGTCCCGGCTGCGATCAAACGAGCCGCGGATCGTTTTCCCGTCAATCGCCACCACTTCCCGGTCCAAAGTCGTCCCGAATGAGCGCGCCCACGCTTCGAAACATGCCTCGAAACGCCCGGTATCGATCAGCATGAACACACGCCGGAAGGTGTCGTGCGATGGAATGCCGTTCGGCAGCGCCAAAAACGTGCCCAGCCATTCCTGCTTGCTACGGCCATACAGTGCCATATCCTCCCAGCTTTCCGCCCCGGCAATCACCGCGCACACCGCAATCACCAGAATATCAATTAGCCGGTGCTCAACCTTGCCGCCGCAGCGGGGGTCTTCCAACGCCGAAAATTCCTCCACAAGCCGCCTCACCGACATGCACGTCTCCCAATCTCAAGGAGACTCCCCGAATCACACCCGATTCCATGCCGTCAACTATGCCCGAAATTTTCATGCGTAGCCCCTG	NA	NA	NA	NA
WP_013640387.1|2271443_2272121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013640392.1|2274915_2275239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154653542.1|2275642_2277115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640394.1|2277116_2277827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640395.1|2277956_2279156_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.8	1.2e-93
WP_085947338.1|2279273_2280040_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.7	4.3e-25
WP_011930570.1|2280313_2281354_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013634994.1|2282082_2283132_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	2790834	2844666	3749411	integrase,transposase	Staphylococcus_phage(25.0%)	46	2837426:2837443	2854542:2854559
WP_148360995.1|2790834_2791389_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081479250.1|2792199_2792769_-	bacteriochlorophyll 4-vinyl reductase	NA	NA	NA	NA	NA
WP_013640649.1|2792798_2794361_-	magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase	NA	NA	NA	NA	NA
WP_081479251.1|2794623_2794920_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013640651.1|2795135_2795297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665081.1|2795914_2796127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640652.1|2796185_2796941_-	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
WP_013640653.1|2797017_2797698_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_041665360.1|2797994_2798831_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013640655.1|2798855_2800790_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	1.2e-87
WP_012039939.1|2800874_2803148_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_013640656.1|2803405_2804092_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_012039941.1|2804096_2805563_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_013640657.1|2806005_2806812_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	48.5	2.7e-62
WP_007421521.1|2808087_2808882_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_013634948.1|2808913_2810752_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_013634947.1|2810748_2812659_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_007421524.1|2812727_2813531_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.9	3.7e-11
WP_013634946.1|2813532_2814600_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013640659.1|2814680_2815643_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013634944.1|2815806_2816595_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_013634943.1|2816603_2817614_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013634942.1|2817615_2818524_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_013634941.1|2818653_2819727_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_160321861.1|2820048_2820192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634939.1|2820254_2821067_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007421628.1|2821063_2821975_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_007421627.1|2822088_2823033_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013640660.1|2823356_2824148_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
WP_007421625.1|2824149_2825136_+	hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.7	7.9e-16
WP_013640661.1|2825206_2826199_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_007421623.1|2826203_2827325_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013640662.1|2827669_2830096_-	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
WP_013640663.1|2830115_2831675_-	oxidoreductase	NA	NA	NA	NA	NA
WP_035188059.1|2831782_2832658_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013640665.1|2832830_2833847_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012039978.1|2834844_2835465_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013640667.1|2835461_2835890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640668.1|2835886_2836423_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_013640669.1|2836512_2836701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148361044.1|2836840_2838385_+	DUF1800 family protein	NA	NA	NA	NA	NA
2837426:2837443	attL	GGCGGCACCGCGGCGCTG	NA	NA	NA	NA
WP_041665363.1|2838390_2839608_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_013640673.1|2839667_2841287_+	deoxyribodipyrimidine photo-lyase/cryptochrome family protein	NA	NA	NA	NA	NA
WP_049796633.1|2841414_2841741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640675.1|2841940_2843542_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013640676.1|2843541_2844666_+|integrase	integrase	integrase	NA	NA	NA	NA
2854542:2854559	attR	GGCGGCACCGCGGCGCTG	NA	NA	NA	NA
>prophage 9
NC_015186	Acidiphilium multivorum AIU301, complete genome	3749411	3090254	3125376	3749411	tail,tRNA,portal,transposase,plate,terminase	uncultured_virus(62.5%)	38	NA	NA
WP_013640853.1|3090254_3091490_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_013640854.1|3091486_3092320_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_007423315.1|3092362_3093832_-	APC family permease	NA	NA	NA	NA	NA
WP_012040101.1|3093828_3094551_-	endonuclease III	NA	NA	NA	NA	NA
WP_012040102.1|3094603_3095149_+	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_013640855.1|3095221_3096370_+	MFS transporter	NA	NA	NA	NA	NA
WP_007423234.1|3096466_3098116_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.2	2.6e-173
WP_007423235.1|3098160_3098475_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	58.5	1.8e-22
WP_172637333.1|3098737_3099019_+	Usg family protein	NA	NA	NA	NA	NA
WP_007423237.1|3099138_3099969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012040106.1|3100093_3101479_+|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	39.3	2.7e-70
WP_013640857.1|3101483_3102896_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_007423132.1|3102892_3103318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007423131.1|3103417_3104740_+	DUF4043 family protein	NA	NA	NA	NA	NA
WP_007423130.1|3104753_3105062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012040108.1|3105063_3105471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640858.1|3105478_3106123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640859.1|3106122_3106968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640860.1|3106978_3107116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007421564.1|3107119_3108676_+|tail	tail protein	tail	B3GAJ6	uncultured_virus	46.4	3.7e-100
WP_007421565.1|3108684_3109113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007421566.1|3109109_3109415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148360941.1|3109701_3110352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640862.1|3110368_3111055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007422926.1|3111051_3111246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640863.1|3111217_3112219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007422924.1|3112215_3112764_+|plate	phage baseplate assembly protein V	plate	B3GAJ7	uncultured_virus	38.7	3.1e-14
WP_012040115.1|3112763_3113132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640864.1|3113150_3114275_+|plate	baseplate J/gp47 family protein	plate	B3GAJ9	uncultured_virus	43.6	1.7e-51
WP_007422920.1|3114278_3114953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640865.1|3115045_3116299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640866.1|3116313_3116805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640867.1|3116814_3119358_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A2I7S0A8	Vibrio_phage	28.8	2.7e-07
WP_013640868.1|3119385_3121278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013640869.1|3121280_3123419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007422432.1|3123424_3123778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947342.1|3123794_3123974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013635006.1|3124008_3125376_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.4	5.8e-41
>prophage 1
NC_015178	Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence	271573	3008	44351	271573	integrase,transposase	Bacillus_phage(28.57%)	31	NA	NA
WP_013634862.1|3008_4136_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013634863.1|4609_5725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634864.1|5830_7021_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_154653560.1|7876_9202_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013634867.1|9681_10242_+	heme NO-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013634868.1|10247_12110_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.7	3.2e-10
WP_007424934.1|13413_13650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007424933.1|13655_13934_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_007421341.1|14935_15952_+|transposase	IS1595-like element ISAcr1 family transposase	transposase	NA	NA	NA	NA
WP_013634871.1|16115_16937_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007424852.1|16998_17520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138919265.1|17516_17990_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013634873.1|18175_19816_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	1.1e-41
WP_138919264.1|19812_20325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007424855.1|20509_20923_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007424858.1|22783_25222_+	DEAD/DEAH box helicase family protein	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	28.6	2.0e-28
WP_013634877.1|25401_25737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634878.1|25736_25982_+	HipA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013634879.1|25972_27106_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_154653554.1|27226_28234_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_007424861.1|28299_28539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081479275.1|28595_28976_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_013634882.1|29621_30344_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_013634884.1|31193_32234_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013634886.1|33936_34614_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	2.2e-33
WP_013634887.1|34642_35986_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.4	4.2e-28
WP_148361021.1|36187_37459_+	TolC family protein	NA	NA	NA	NA	NA
WP_013634889.1|37458_38385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634890.1|38394_41496_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	5.2e-37
WP_081479277.1|41573_42962_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_013634892.1|43079_44351_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.5	1.2e-101
>prophage 2
NC_015178	Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence	271573	75084	122325	271573	transposase	Acidithiobacillus_phage(20.0%)	46	NA	NA
WP_013634915.1|75084_76113_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_013634916.1|76399_77107_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013634917.1|77232_77514_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	46.2	6.8e-13
WP_148360965.1|77534_77726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634919.1|77763_78270_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013634920.1|78266_78557_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_081479279.1|78782_79019_+	recombinase family protein	NA	NA	NA	NA	NA
WP_013634879.1|78951_80085_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_013634921.1|80077_80569_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	52.9	2.2e-35
WP_013634879.1|82047_83181_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_013634922.1|83255_83393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634924.1|83661_83937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013634925.1|83902_85036_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_041665618.1|85075_86209_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013634927.1|86242_87301_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_013634928.1|87305_88118_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013634929.1|88117_89014_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_013634930.1|89017_90889_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	8.5e-19
WP_013634931.1|90990_91998_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_013634932.1|91994_93431_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_085947348.1|93437_94259_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
WP_013634934.1|94258_95230_+	hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	28.1	3.7e-18
WP_148361060.1|96013_96817_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_013634938.1|97250_98162_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_013634939.1|98158_98971_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.3	3.7e-11
WP_160321861.1|99033_99177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013634941.1|99498_100572_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013634942.1|100701_101610_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_013634943.1|101611_102622_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013634944.1|102630_103419_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_013640659.1|103582_104545_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013634946.1|104625_105693_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007421524.1|105694_106498_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.9	3.7e-11
WP_013634947.1|106566_108477_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_013634948.1|108473_110312_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E4WLQ6	Ostreococcus_tauri_virus	23.1	1.5e-20
WP_007421521.1|110343_111138_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_013634949.1|111372_113052_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013634950.1|113270_113492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013634951.1|113494_115102_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.6	8.4e-108
WP_013634952.1|115360_116377_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.6	4.1e-07
WP_013634953.1|116520_116868_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	54.2	1.1e-28
WP_013634954.1|116864_117290_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	37.0	6.0e-05
WP_013634956.1|118523_119279_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.1	2.7e-56
WP_158320272.1|119290_119761_-	hypothetical protein	NA	K4I413	Acidithiobacillus_phage	44.0	3.0e-29
WP_013634958.1|119819_121055_-|transposase	IS110 family transposase	transposase	A0A1B1P7S0	Bacillus_phage	46.2	2.1e-05
WP_158320273.1|121281_122325_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.7	8.2e-96
>prophage 3
NC_015178	Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence	271573	133576	192491	271573	transposase	Cronobacter_phage(14.29%)	50	NA	NA
WP_013634972.1|133576_134923_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_013634973.1|135209_136223_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013634972.1|136727_138074_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_039887465.1|138661_138916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013634976.1|139116_139830_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_013634977.1|139810_140176_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_013634978.1|140179_140512_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
WP_041665626.1|140501_142895_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_013634980.1|142904_143663_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_013634981.1|143892_144780_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_138919288.1|144818_144962_+	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
WP_013634982.1|144958_145660_+	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
WP_011930793.1|145656_146547_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_011930794.1|146536_147673_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_013634983.1|147669_147960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634984.1|148010_149744_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011930570.1|150017_151058_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011930796.1|151296_152364_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_011930797.1|152363_154184_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_011930798.1|154311_154794_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011930799.1|154859_155912_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011930800.1|155908_157078_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011930801.1|157074_158388_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_011930802.1|158484_159741_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	44.3	1.1e-83
WP_011930803.1|159746_160136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011930804.1|160180_160891_+	SOS response-associated peptidase	NA	B7SYF4	Stenotrophomonas_phage	38.4	1.6e-34
WP_013634985.1|161123_161723_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_007421341.1|161750_162767_-|transposase	IS1595-like element ISAcr1 family transposase	transposase	NA	NA	NA	NA
WP_007421341.1|163082_164099_-|transposase	IS1595-like element ISAcr1 family transposase	transposase	NA	NA	NA	NA
WP_013634986.1|164491_165166_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_011930806.1|165393_167589_-	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	29.2	3.1e-52
WP_013634987.1|167922_173028_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_011930808.1|173021_173360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049796646.1|173623_174178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634989.1|174187_175078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634990.1|175293_175779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634991.1|175783_176188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013634992.1|176777_177353_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_013634994.1|178165_179215_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013634996.1|179883_181110_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_013634997.1|181124_183569_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013634998.1|183568_183919_+	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_013634999.1|183915_186501_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013635000.1|186478_187264_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_013635001.1|187232_187817_-	siroheme synthase	NA	NA	NA	NA	NA
WP_013635002.1|188246_188534_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	41.6	4.0e-13
WP_041665735.1|188545_188815_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	39.3	1.0e-13
WP_013634879.1|188889_190023_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_013635004.1|190228_190798_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	38.7	1.1e-22
WP_013635006.1|191123_192491_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.4	5.8e-41
>prophage 4
NC_015178	Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence	271573	203539	261462	271573	integrase,transposase	Thermus_phage(13.33%)	57	223689:223748	257140:257262
WP_013635019.1|203539_204475_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	33.9	1.5e-27
WP_081479286.1|205740_206343_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_148361049.1|206731_207112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007421341.1|207264_208281_-|transposase	IS1595-like element ISAcr1 family transposase	transposase	NA	NA	NA	NA
WP_013635023.1|208441_209131_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_013635024.1|209589_209970_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	54.7	2.3e-08
WP_013635025.1|209966_210197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013635026.1|210423_211812_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013635027.1|211811_213182_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_148361037.1|213297_214029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082088294.1|214625_216122_+	recombinase family protein	NA	NA	NA	NA	NA
WP_041665639.1|216312_216999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013635032.1|217552_218206_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_013635035.1|219766_220576_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.7	3.5e-38
WP_081479289.1|220572_222126_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_013635038.1|222711_222921_-	hypothetical protein	NA	NA	NA	NA	NA
223689:223748	attL	GGGGCATAATGCCGAGATCCGGATTATGCCGCATCTGCTCGGCAGGGCGCGGTTGGCGGT	NA	NA	NA	NA
WP_011930445.1|223811_225023_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	31.7	3.8e-12
WP_011930444.1|225019_225961_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.8	7.1e-06
WP_011930443.1|225957_226950_+|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.2	9.1e-12
WP_154653557.1|227042_227189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013635040.1|227201_227483_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_013635041.1|227469_227733_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013635042.1|228271_229159_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013635043.1|229288_230968_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_048858261.1|231322_232114_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_013635045.1|232110_233316_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013635046.1|233340_233649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154653558.1|235808_236414_-	cytosine permease	NA	NA	NA	NA	NA
WP_007421341.1|236477_237494_+|transposase	IS1595-like element ISAcr1 family transposase	transposase	NA	NA	NA	NA
WP_172637355.1|237448_238399_-	cytosine permease	NA	NA	NA	NA	NA
WP_013635051.1|238446_238764_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_013635052.1|238773_240246_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_081479291.1|240242_240986_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013635054.1|241083_242118_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_148361008.1|242741_243680_-	flavin reductase	NA	NA	NA	NA	NA
WP_049796648.1|243676_244564_-	alpha/beta fold hydrolase	NA	A0A0A7RWQ4	Mycobacterium_phage	35.9	1.4e-08
WP_013635058.1|244493_245081_-	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_013635059.1|245227_245938_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013635060.1|246244_247597_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	43.2	4.4e-41
WP_013635061.1|247627_248311_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.9	2.4e-35
WP_081479285.1|248396_248537_+|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
WP_013635064.1|249088_249643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013635065.1|249678_249939_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_013635066.1|250103_250586_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_148361029.1|250739_251384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041665651.1|251433_251640_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_007424918.1|252137_252428_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013635068.1|252430_252604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013635069.1|252741_252960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013635070.1|253395_253935_-	hypothetical protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	42.5	7.1e-11
WP_011930443.1|253937_254930_-|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.2	9.1e-12
WP_011930444.1|254926_255868_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.8	7.1e-06
WP_011930445.1|255864_257076_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	31.7	3.8e-12
WP_154653559.1|257135_257861_-	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	28.2	5.3e-09
257140:257262	attR	ACCGCCAACCGCGCCCTGCCGAGCAGATGCGGCATAATCCGGATCTCGGCATTATGCCCCAGTTCATGCAGCGCCGTGCTGTAAAATCGATCCGCCGTCTTGAATTGGTCGCGCTCCGGCATC	NA	NA	NA	NA
WP_013635072.1|257817_258006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013635073.1|258220_258424_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_013635074.1|258495_261462_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	41.4	1.6e-213
>prophage 1
NC_015188	Acidiphilium multivorum AIU301 plasmid pACMV4, complete sequence	40588	13653	22377	40588		Escherichia_phage(50.0%)	8	NA	NA
WP_013641281.1|13653_16497_+	Ti-type conjugative transfer relaxase TraA	NA	V5UQN3	Mycobacterium_phage	28.2	1.5e-11
WP_013641282.1|16493_17099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641283.1|17272_18154_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013641284.1|18158_18986_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	3.9e-08
WP_081479299.1|18994_20041_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.1	3.0e-90
WP_013641286.1|20037_20919_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	55.0	2.5e-82
WP_013641287.1|20915_21470_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	4.3e-35
WP_013641288.1|21471_22377_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	7.5e-21
